TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5cc5546f5a79e
Sample: 5cc5546f5a79e

Download results

Summary
ID: 5cc5546f5a79e
Date: Sun Apr 28 08:22:28 2019
Strain: lineage1;lineage2;lineage4.3.1;lineage4.3.2.1;lineage4.1.1.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage1Indo-OceanicEAIRD239
lineage2East-AsianBeijingRD105
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.1.1.1Euro-American (X-type)X2RD183
lineageBOV AFRI???

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G1.000
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>G1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8366c.1065G>A1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760193c.387C>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C1.000
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB761036c.1230G>C1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761219c.1413G>C1.000
rpoB761234c.1428G>C1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C1.000
rpoB761264c.1458C>G1.000
rpoB761273c.1467T>C1.000
rpoB761303c.1497G>C1.000
rpoB761318c.1512G>T0.917
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.923
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G1.000
rpoB762510p.Ala902Pro1.000
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T1.000
rpoC764098c.729A>G1.000
rpoC764110c.741C>T1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764470c.1101C>T1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T1.000
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764896c.1527C>T1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765886c.2517C>T1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.976
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.947
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c0.971
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.806
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G0.967
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.917
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;