TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5ccbf0e85404f
Sample: 5ccbf0e85404f

Download results

Summary
ID: 5ccbf0e85404f
Date: Fri May 3 08:45:22 2019
Strain: lineage4.3;lineage4.1.2;lineage4.1.1;lineage1.1.1
Drug-resistance: Drug-resistant

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
EthambutolRembB p.Ala356Val (1.00), embB p.Tyr384Asn (1.00), embB p.Ala388Gly (1.00), embB p.Asn399Asp (0.82), embB p.Ala659Thr (1.00)
Pyrazinamide
StreptomycinRrrs r.462c>t (1.00)
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage1.1.1Indo-OceanicEAI4;EAI5RD239

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB5302c.63A>G1.000
gyrB5326c.87T>C1.000
gyrB5341c.102T>C1.000
gyrB5344c.105C>G1.000
gyrB5347c.108G>C1.000
gyrB5350c.111C>T1.000
gyrB5353c.114T>C1.000
gyrB5356c.117G>A1.000
gyrB5363c.124T>C1.000
gyrB5371c.132T>C1.000
gyrB5377c.138T>C1.000
gyrB5386c.147G>C1.000
gyrB5396p.Ala53Ser1.000
gyrB5401c.162C>G1.000
gyrB5477p.Asp80Asn1.000
gyrB5482c.243C>G1.000
gyrB5491c.252T>C1.000
gyrB5494c.255G>C1.000
gyrB5500c.261C>G1.000
gyrB5503c.264C>G1.000
gyrB5510p.Ser91Thr1.000
gyrB5518c.279A>C1.000
gyrB5542c.303A>C1.000
gyrB5548c.309A>C1.000
gyrB5551c.312T>C1.000
gyrB5998c.759T>C1.000
gyrB6004c.765T>C1.000
gyrB6008c.769C>T1.000
gyrB6022c.783G>C1.000
gyrB6025c.786A>G1.000
gyrB6034c.795C>T1.000
gyrB6037c.798C>G1.000
gyrB6047p.Ala270Pro1.000
gyrB6055c.816T>C1.000
gyrB6057p.Ser273Asn1.000
gyrB6070c.831C>T1.000
gyrB6073c.834T>C1.000
gyrB6100c.861G>C1.000
gyrB6103c.864G>A1.000
gyrB6115c.876A>G1.000
gyrB6127c.888G>C1.000
gyrB6130c.891T>C1.000
gyrB6209c.970C>T1.000
gyrB6229c.990G>A1.000
gyrB6247c.1008G>A1.000
gyrB6250c.1011A>C1.000
gyrB6262c.1023G>A1.000
gyrB6280c.1041T>C1.000
gyrB6286c.1047T>C1.000
gyrB6304c.1065C>A1.000
gyrB6307c.1068T>G1.000
gyrB6310c.1071G>C1.000
gyrB6313c.1074C>T1.000
gyrB6316c.1077G>C1.000
gyrB6319c.1080G>C1.000
gyrB6337c.1098G>A1.000
gyrB6355c.1116G>A1.000
gyrB6362c.1123T>C1.000
gyrB6382c.1143A>G1.000
gyrB6388c.1149T>C1.000
gyrB6403c.1164T>C1.000
gyrB6415c.1176G>C1.000
gyrB6418c.1179C>G1.000
gyrB6427c.1188T>C1.000
gyrB6440p.Thr401Ala1.000
gyrB6448c.1209G>C1.000
gyrB6452p.Val405Thr1.000
gyrB6460c.1221G>A1.000
gyrB6469c.1230T>A1.000
gyrB6472c.1233G>T1.000
gyrB6475c.1236C>G1.000
gyrB6481c.1242G>C1.000
gyrB6484c.1245A>G1.000
gyrB6490c.1251T>A1.000
gyrB6496c.1257G>A1.000
gyrB6499c.1260A>G1.000
gyrB6502c.1263T>C1.000
gyrB6508c.1269A>G1.000
gyrB6515c.1276T>C1.000
gyrB6523c.1284G>C1.000
gyrB6526c.1287T>C1.000
gyrB6542p.Ile435Leu1.000
gyrB6550c.1311A>G1.000
gyrB6551c.1312T>C1.000
gyrB6556c.1317C>A0.529
gyrB6565c.1326G>C0.543
gyrB6568c.1329C>A0.543
gyrB6571c.1332T>C0.568
gyrB6577c.1338T>C1.000
gyrB6583c.1344G>C1.000
gyrB6586c.1347T>C1.000
gyrB6592c.1353C>A0.966
gyrB6598c.1359C>G1.000
gyrB6610c.1371C>G1.000
gyrB6613c.1374A>G1.000
gyrB6616c.1377A>G1.000
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6649c.1410T>C1.000
gyrB6655c.1416T>C0.981
gyrB6667c.1428G>A0.982
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>C1.000
gyrB6685c.1446C>T1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6709c.1470A>G1.000
gyrB6730c.1491A>G1.000
gyrB6760c.1521G>C1.000
gyrB6772c.1533C>G1.000
gyrB6778c.1539C>T1.000
gyrB6793c.1554T>C1.000
gyrB6797p.Gly520Thr1.000
gyrB6805c.1566G>C1.000
gyrB6808c.1569C>G1.000
gyrB6841c.1602T>C1.000
gyrB6850c.1611C>G1.000
gyrB6856c.1617T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6878c.1639T>C1.000
gyrB6881c.1642T>C1.000
gyrB6901c.1662G>A1.000
gyrB6902c.1663C>T0.981
gyrB6910c.1671G>A1.000
gyrB6913c.1674C>T1.000
gyrB6919c.1680T>C1.000
gyrB6925c.1686T>C1.000
gyrB6934c.1695A>G1.000
gyrB6943c.1704G>A1.000
gyrB6949c.1710A>G1.000
gyrB6952c.1713C>G1.000
gyrB6967c.1728T>C1.000
gyrB6970c.1731C>T1.000
gyrB6973c.1734G>C1.000
gyrB6976c.1737A>G1.000
gyrB6982c.1743A>G1.000
gyrB6994c.1755C>T1.000
gyrB7006c.1767T>C1.000
gyrB7010c.1771C>T1.000
gyrB7021c.1782G>A1.000
gyrB7033c.1794G>C1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>C1.000
gyrB7078c.1839A>G1.000
gyrB7081c.1842T>C1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrB7108c.1869G>A1.000
gyrB7114c.1875C>G1.000
gyrB7120c.1881T>C1.000
gyrB7123c.1884C>G1.000
gyrB7126c.1887G>C1.000
gyrB7129c.1890T>G1.000
gyrB7132c.1893T>G1.000
gyrB7136c.1897T>C1.000
gyrB7141c.1902T>C1.000
gyrB7144c.1905A>G1.000
gyrB7147c.1908G>C1.000
gyrB7150c.1911G>C1.000
gyrB7153c.1914G>C1.000
gyrB7162c.1923C>G1.000
gyrB7165c.1926C>G1.000
gyrB7168c.1929C>G1.000
gyrB7178c.1939T>C1.000
gyrB7216c.1977G>C1.000
gyrB7246c.2007T>C1.000
gyrB7252c.2013G>C1.000
gyrA7287c.-15G>A1.000
gyrA7298c.-4A>T1.000
gyrA7307c.6A>C1.000
gyrA7313c.12G>C1.000
gyrA7317c.16T>C1.000
gyrA7322c.21G>C1.000
gyrA7325c.24T>C1.000
gyrA7327p.Asp9Gly1.000
gyrA7332p.Ser11Glu1.000
gyrA7335p.Leu12Val0.214
gyrA7349c.48A>G1.000
gyrA7355c.54T>A1.000
gyrA7361c.60C>T1.000
gyrA7362p.Glu21Gln1.000
gyrA7394c.93T>C1.000
gyrA7412c.111C>G1.000
gyrA7427c.126G>C1.000
gyrA7442c.141G>C1.000
gyrA7451c.150C>G1.000
gyrA7457c.156T>C1.000
gyrA7463c.162G>C1.000
gyrA7469c.168C>G1.000
gyrA7472c.171T>C1.000
gyrA7475c.174A>G1.000
gyrA7480p.Phe60Tyr1.000
gyrA7484c.183T>C1.000
gyrA7490c.189C>G1.000
gyrA7499c.198G>C1.000
gyrA7523c.222C>G1.000
gyrA7524c.223C>A1.000
gyrA7532c.231T>C1.000
gyrA7541c.240C>G1.000
gyrA7571c.270G>C1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7595c.294C>T1.000
gyrA7601c.300C>G1.000
gyrA7607c.306C>G1.000
gyrA7619c.318C>G1.000
gyrA7628c.327G>C1.000
gyrA7631c.330G>C1.000
gyrA7634c.333C>T1.000
gyrA7649c.348C>T1.000
gyrA7658c.357A>G1.000
gyrA7664c.363T>C1.000
gyrA7694c.393A>G1.000
gyrA7697c.396C>G1.000
gyrA7710c.409T>C1.000
gyrA7725c.424C>T1.000
gyrA7728c.427A>C1.000
gyrA7763c.462T>C1.000
gyrA7784c.483A>G1.000
gyrA7799c.498A>G1.000
gyrA7832c.531G>C1.000
gyrA7835c.534A>C1.000
gyrA7850c.549C>T1.000
gyrA7859c.558A>G1.000
gyrA7865c.564T>C1.000
gyrA7886c.585T>C1.000
gyrA7892c.591G>C1.000
gyrA7898p.Asp199Glu1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8177c.876A>C1.000
gyrA8189c.888G>C0.964
gyrA8191p.Ala297Gly0.963
gyrA8198c.897T>C1.000
gyrA8199p.Ser300Ala1.000
gyrA8205p.Ile302Val1.000
gyrA8210c.909G>A1.000
gyrA8217p.Ser306Gly1.000
gyrA8225c.924T>C1.000
gyrA8228c.927G>C1.000
gyrA8235p.Leu312Val1.000
gyrA8247p.Ile316Val1.000
gyrA8253p.Ile318Leu1.000
gyrA8264c.963T>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8321c.1020C>T1.000
gyrA8324c.1023T>C1.000
gyrA8339c.1038A>G1.000
gyrA8342c.1041G>C1.000
gyrA8360c.1059G>C1.000
gyrA8366c.1065G>C1.000
gyrA8391p.Tyr364His1.000
gyrA8399c.1098T>C1.000
gyrA8402p.Asp367Glu1.000
gyrA8420c.1119T>C1.000
gyrA8423c.1122G>C1.000
gyrA8438c.1137C>T1.000
gyrA8453c.1152A>C1.000
gyrA8459c.1158G>A1.000
gyrA8462c.1161A>G1.000
gyrA8471c.1170T>C1.000
gyrA8483c.1182G>A1.000
gyrA8486c.1185T>C1.000
gyrA8489c.1188A>G1.000
gyrA8510c.1209G>A1.000
gyrA8516c.1215T>C1.000
gyrA8519c.1218A>G1.000
gyrA8537c.1236G>A1.000
gyrA8546c.1245T>C1.000
gyrA8555c.1254G>C1.000
gyrA8561c.1260A>G1.000
gyrA8573c.1272G>C1.000
gyrA8588c.1287G>A1.000
gyrA8595p.Ala432Ser1.000
gyrA8603c.1302A>C1.000
gyrA8618c.1317G>A1.000
gyrA8619c.1318T>C1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C1.000
gyrA8637c.1336C>T1.000
gyrA8655p.Ile452Val1.000
gyrA8672c.1371A>G1.000
gyrA8678c.1377G>A1.000
gyrA8684c.1383G>A1.000
gyrA8693c.1392T>C1.000
gyrA8711c.1410A>C0.958
gyrA8717c.1416C>G1.000
gyrA8729c.1428T>C1.000
gyrA8738c.1437G>C1.000
gyrA8740p.Arg480His1.000
gyrA8751p.Ala484Gln1.000
gyrA8756c.1455A>G1.000
gyrA8762c.1461G>C1.000
gyrA8767p.Arg489Lys1.000
gyrA8783c.1482G>T1.000
gyrA8786c.1485T>C1.000
gyrA8796p.Ile499Val1.000
gyrA8801c.1500G>C1.000
gyrA8810c.1509A>C1.000
gyrA8816c.1515C>T0.964
gyrA8818p.Ser506Asn1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8903c.1602T>C1.000
gyrA8939c.1638T>C1.000
gyrA8942c.1641G>C1.000
gyrA8946c.1645T>C1.000
gyrA8954c.1653G>A1.000
gyrA8981c.1680G>C1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9023c.1722A>C1.000
gyrA9029c.1728T>G1.000
gyrA9050p.Asp583Glu1.000
gyrA9051c.1750T>C1.000
gyrA9056c.1755C>G1.000
gyrA9062c.1761C>T1.000
gyrA9071c.1770G>C1.000
gyrA9074c.1773G>C1.000
gyrA9080c.1779G>T0.986
gyrA9099c.1798T>C1.000
gyrA9119c.1818A>G1.000
gyrA9134c.1833C>G1.000
gyrA9143c.1842T>C1.000
gyrA9153p.Thr618Asp0.906
gyrA9167c.1866C>T1.000
gyrA9179c.1878C>G1.000
gyrA9182c.1881T>G1.000
gyrA9188c.1887C>T1.000
gyrA9191c.1890G>C1.000
gyrA9197c.1896G>C1.000
gyrA9200c.1899A>G1.000
gyrA9204p.Ser635Thr1.000
gyrA9218c.1917C>T1.000
gyrA9230c.1929T>C1.000
gyrA9251c.1950G>C1.000
gyrA9252p.Val651Ile1.000
gyrA9257c.1956C>T1.000
gyrA9275c.1974G>A1.000
gyrA9276c.1975C>T1.000
gyrA9284c.1983T>C1.000
gyrA9296c.1995T>C1.000
gyrA9299c.1998G>A1.000
gyrA9300p.Ala667Ser1.000
gyrA9304p.Gly668Glu0.970
gyrA9308p.Asp669Glu0.538
gyrA9335c.2034G>T1.000
gyrA9344c.2043C>T1.000
gyrA9345c.2044A>C1.000
gyrA9374c.2073G>A1.000
gyrA9377c.2076A>G1.000
gyrA9383c.2082T>C1.000
gyrA9386c.2085T>G1.000
gyrA9398c.2097T>C1.000
gyrA9401c.2100G>C1.000
gyrA9413c.2112G>A1.000
gyrA9419c.2118T>C1.000
gyrA9497c.2196G>C1.000
gyrA9500c.2199A>G1.000
gyrA9503c.2202T>C1.000
gyrA9518c.2217A>G1.000
gyrA9521c.2220C>T1.000
gyrA9527c.2226A>G1.000
rpoB759571c.-236C>G1.000
rpoB759606c.-201T>C1.000
rpoB759647c.-160T>C1.000
rpoB759656c.-151A>C1.000
rpoB759657c.-150G>T1.000
rpoB759659c.-148T>C1.000
rpoB759671c.-136G>T1.000
rpoB759672c.-135G>A1.000
rpoB759716c.-91A>T1.000
rpoB759726c.-81A>G1.000
rpoB759732c.-75C>T0.910
rpoB759755c.-52C>G1.000
rpoB759758c.-49CT>C1.000
rpoB759763c.-44C>T1.000
rpoB759765c.-42A>T1.000
rpoB759770c.-37C>T1.000
rpoB759773c.-34T>C1.000
rpoB759777c.-30T>G1.000
rpoB759778c.-29G>A1.000
rpoB759785c.-22T>C1.000
rpoB759788c.-19A>G1.000
rpoB759929c.123A>G1.000
rpoB759944c.138A>G1.000
rpoB759947c.141C>G1.000
rpoB759956c.150C>G1.000
rpoB759965c.159T>C1.000
rpoB759978c.172C>T1.000
rpoB759986c.180T>C1.000
rpoB760070c.264T>G1.000
rpoB760073c.267G>C1.000
rpoB760091c.285G>T1.000
rpoB760101c.295T>C1.000
rpoB760106c.300G>T1.000
rpoB760112c.306T>C1.000
rpoB760115c.309C>T1.000
rpoB760118c.312T>C1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760142c.336C>G1.000
rpoB760172c.366G>C1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760223c.417T>C1.000
rpoB760235c.429T>C1.000
rpoB760283c.477G>C1.000
rpoB760307c.501T>C1.000
rpoB760310c.504G>C1.000
rpoB760313c.507G>C1.000
rpoB760331c.525G>C1.000
rpoB760340c.534G>T1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760424c.618C>G1.000
rpoB760430c.624T>C1.000
rpoB760454c.648C>G1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760514c.708C>T1.000
rpoB760522p.Ser239Asn1.000
rpoB760528p.Gln241Arg1.000
rpoB760532c.726T>C1.000
rpoB760533p.Val243Thr1.000
rpoB760547c.741G>C1.000
rpoB760563p.Arg253Met1.000
rpoB760591p.Val262Ala1.000
rpoB760611c.805T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>C1.000
rpoB760670c.864G>C1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760716c.910C>A1.000
rpoB760721c.915C>T1.000
rpoB760724c.918T>C1.000
rpoB760727c.921C>T1.000
rpoB760730c.924T>C1.000
rpoB760795p.Glu330Ala1.000
rpoB760799c.993C>T1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760845p.Thr347Ala1.000
rpoB760856c.1050C>G1.000
rpoB760862c.1056G>C1.000
rpoB760886c.1080A>G0.577
rpoB760919c.1113C>G1.000
rpoB760925c.1119T>C1.000
rpoB760934c.1128C>G1.000
rpoB760946c.1140A>G1.000
rpoB760958c.1152G>C1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>G1.000
rpoB761037c.1231T>C1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761133c.1327T>C1.000
rpoB761150c.1344A>G1.000
rpoB761165c.1359G>C0.972
rpoB761168c.1362C>G0.972
rpoB761171c.1365C>T0.972
rpoB761180c.1374A>G1.000
rpoB761195c.1389G>C1.000
rpoB761196c.1390C>T1.000
rpoB761207c.1401C>T1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761261c.1455G>T1.000
rpoB761264c.1458C>G1.000
rpoB761273c.1467T>C1.000
rpoB761282c.1476C>T1.000
rpoB761309c.1503C>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761336c.1530C>T1.000
rpoB761339c.1533C>G1.000
rpoB761345c.1539G>T1.000
rpoB761348c.1542C>G1.000
rpoB761354c.1548C>T1.000
rpoB761357c.1551G>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761375c.1569G>C1.000
rpoB761408c.1602G>C1.000
rpoB761414c.1608A>G1.000
rpoB761423c.1617T>C1.000
rpoB761471c.1665C>T1.000
rpoB761505c.1699T>A1.000
rpoB761510c.1704T>C1.000
rpoB761537c.1731C>G1.000
rpoB761540c.1734C>G1.000
rpoB761552c.1746G>C0.735
rpoB761564c.1758G>C0.731
rpoB761573c.1767C>G1.000
rpoB761579c.1773G>C1.000
rpoB761606c.1800C>G1.000
rpoB761612c.1806G>C1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G0.977
rpoB761648c.1842T>C1.000
rpoB761657c.1851C>G1.000
rpoB761675c.1869G>C0.975
rpoB761724p.Glu640Thr1.000
rpoB761728c.1923 1924insCC0.968
rpoC763351c.-19T>C1.000
rpoC763352c.-18T>A1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>G1.000
rpoC763414c.45T>C1.000
rpoC763430c.61A>C1.000
rpoC763441c.72C>T1.000
rpoC763444c.75T>C1.000
rpoC763456c.87A>G1.000
rpoC763486c.117T>G1.000
rpoC763528c.159G>A1.000
rpoC763537c.168C>G1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763573c.204G>C1.000
rpoC763594c.225C>T1.000
rpoC763600c.231C>G1.000
rpoC763633c.264T>C1.000
rpoC763636c.267T>C1.000
rpoC763648c.279C>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763714c.345G>A1.000
rpoC763717c.348T>C1.000
rpoC763744c.375G>C1.000
rpoC763765c.396T>C1.000
rpoC763768c.399C>G1.000
rpoC763790p.Glu141Asn1.000
rpoC763801c.432C>G1.000
rpoC763807c.438T>C1.000
rpoC763813c.444C>G1.000
rpoC763816c.447C>G1.000
rpoC763835p.Ala156Met1.000
rpoC763851p.Ala161Gly1.000
rpoC763855c.486C>T1.000
rpoC763858c.489A>G1.000
rpoC763871p.Gly168Thr0.959
rpoC763879c.510A>G1.000
rpoC763888c.519G>T1.000
rpoC763894c.525A>G1.000
rpoC763927c.558C>G0.778
rpoC763948c.579G>C1.000
rpoC763963c.594C>T0.855
rpoC763978c.609C>G1.000
rpoC763996c.627T>C1.000
rpoC764024c.655T>C1.000
rpoC764044c.675T>C1.000
rpoC764059c.690G>C1.000
rpoC764071c.702G>C1.000
rpoC764083c.714A>G1.000
rpoC764098c.729A>G1.000
rpoC764101c.732C>G1.000
rpoC764110c.741C>T1.000
rpoC764188c.819A>G1.000
rpoC764203c.834G>C1.000
rpoC764206p.Asp279Glu1.000
rpoC764217p.Asn283Ser1.000
rpoC764245c.876C>G1.000
rpoC764257c.888G>C1.000
rpoC764266c.897T>C1.000
rpoC764269c.900G>C1.000
rpoC764272c.903G>C1.000
rpoC764278c.909A>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764339c.970C>T1.000
rpoC764380c.1011G>C1.000
rpoC764381c.1012T>A1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764429c.1060C>T1.000
rpoC764434c.1065A>G1.000
rpoC764438c.1069C>T1.000
rpoC764443c.1074C>T1.000
rpoC764446c.1077T>C1.000
rpoC764449c.1080G>C1.000
rpoC764452c.1083T>A1.000
rpoC764455c.1086G>T1.000
rpoC764458c.1089G>T1.000
rpoC764467c.1098C>T0.985
rpoC764497c.1128A>G1.000
rpoC764521c.1152T>C0.753
rpoC764533c.1164C>G0.727
rpoC764536c.1167G>C0.721
rpoC764539c.1170C>G0.913
rpoC764551c.1182G>C1.000
rpoC764566c.1197C>G1.000
rpoC764575c.1206T>G1.000
rpoC764576c.1207T>A1.000
rpoC764581c.1212T>C1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>C1.000
rpoC764651c.1282T>A1.000
rpoC764656c.1287C>T1.000
rpoC764695c.1326T>C1.000
rpoC764749c.1380G>C1.000
rpoC764752c.1383G>C1.000
rpoC764764c.1395T>C1.000
rpoC764809c.1440C>T1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764830c.1461C>G1.000
rpoC764851c.1482C>T1.000
rpoC764858c.1489T>C1.000
rpoC764861c.1492C>T1.000
rpoC764867c.1498C>A1.000
rpoC764875c.1506C>G1.000
rpoC764878c.1509C>G1.000
rpoC764881c.1512G>C1.000
rpoC764885c.1516C>A1.000
rpoC764893c.1524T>C1.000
rpoC764923c.1554A>G1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC764983c.1614T>C1.000
rpoC764986c.1617C>T1.000
rpoC764995c.1626C>G1.000
rpoC765019c.1650A>G1.000
rpoC765034c.1665T>C1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765052c.1683C>T1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>C1.000
rpoC765082c.1713G>T1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765103c.1734G>A0.975
rpoC765143p.Val592Ile1.000
rpoC765146p.Pro593Glu1.000
rpoC765151c.1782G>C1.000
rpoC765157c.1788C>G1.000
rpoC765176p.Ser603Ala1.000
rpoC765180p.Gly604Asp1.000
rpoC765184c.1815T>C1.000
rpoC765186p.His606Arg1.000
rpoC765193c.1824G>A1.000
rpoC765196c.1827T>G1.000
rpoC765202c.1833C>G1.000
rpoC765208c.1839T>C1.000
rpoC765220c.1851A>G1.000
rpoC765223c.1854G>C1.000
rpoC765232c.1863G>C1.000
rpoC765247c.1878C>T1.000
rpoC765278c.1909C>T1.000
rpoC765292c.1923G>T1.000
rpoC765300p.Val644Ala1.000
rpoC765307c.1938C>T1.000
rpoC765319c.1950A>G1.000
rpoC765326p.His653Thr1.000
rpoC765330p.Ser654Asn1.000
rpoC765346c.1977C>G1.000
rpoC765349c.1980T>C1.000
rpoC765383p.Met672Leu1.000
rpoC765409c.2040T>C1.000
rpoC765421c.2052C>G1.000
rpoC765478c.2109T>C1.000
rpoC765499c.2130C>G0.988
rpoC765541c.2172C>G1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>C1.000
rpoC765583c.2214G>T1.000
rpoC765612p.His748Arg1.000
rpoC765625c.2256C>G1.000
rpoC765628c.2259G>C1.000
rpoC765673p.Asp768Glu1.000
rpoC765700c.2331T>C1.000
rpoC765734c.2365T>C1.000
rpoC765752p.Asp795Ser0.973
rpoC765772c.2403C>G1.000
rpoC765784c.2415C>G1.000
rpoC765787c.2418C>T1.000
rpoC765793c.2424C>G1.000
rpoC765796c.2427C>T1.000
rpoC765811c.2442T>C1.000
rpoC765814c.2445A>G1.000
rpoC765823c.2454C>G1.000
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765883c.2514C>G1.000
rpoC765886c.2517C>G1.000
rpoC765892c.2523T>C1.000
rpoC765934c.2565C>G1.000
rpoC765967c.2598C>T1.000
rpoC765982c.2613C>G1.000
rpoC765985c.2616C>T1.000
rpoC765994c.2625A>G1.000
rpoC766009c.2640G>T1.000
rpoC766012c.2643C>G1.000
rpoC766021c.2652G>C1.000
rpoC766027c.2658G>T1.000
rpoC766054c.2685C>T1.000
rpoC766063c.2694C>T1.000
rpoC766081c.2712T>C1.000
rpoC766084c.2715A>G1.000
rpoC766085p.Pro906Ala1.000
rpoC766129c.2760C>G1.000
rpoC766141c.2772C>T1.000
rpoC766142c.2773C>T1.000
rpoC766148p.Thr927Ala1.000
rpoC766168c.2799C>G0.654
rpoC766178p.Ile937Val1.000
rpoC766185p.Glu939Ala1.000
rpoC766189c.2820T>C1.000
rpoC766193p.Gln942Glu1.000
rpoC766204c.2835C>T1.000
rpoC766207c.2838T>C1.000
rpoC766211p.Glu948Ser1.000
rpoC766216c.2847T>C1.000
rpoC766222c.2853T>C1.000
rpoC766231c.2862T>G1.000
rpoC766234c.2865T>G1.000
rpoC766237c.2868T>C1.000
rpoC766240c.2871T>C1.000
rpoC766243c.2874C>G1.000
rpoC766258c.2889T>C1.000
rpoC766270c.2901G>C1.000
rpoC766274p.Ala969Thr1.000
rpoC766280p.Ser971Gly1.000
rpoC766285c.2916C>G1.000
rpoC766312c.2943T>C1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766381c.3012C>T0.676
rpoC766384c.3015A>G0.688
rpoC766393c.3024C>G0.700
rpoC766408c.3039C>G1.000
rpoC766426c.3057C>T1.000
rpoC766447c.3078T>C1.000
rpoC766456c.3087C>G1.000
rpoC766483c.3114G>C1.000
rpoC766486c.3117A>C1.000
rpoC766492c.3123T>C1.000
rpoC766504c.3135G>C1.000
rpoC766522c.3153C>G1.000
rpoC766528c.3159T>C1.000
rpoC766531c.3162G>T0.974
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766573c.3204T>C1.000
rpoC766582c.3213C>G1.000
rpoC766585c.3216T>C1.000
rpoC766591c.3222A>G1.000
rpoC766594c.3225G>C1.000
rpoC766597c.3228C>G1.000
rpoC766607p.Ile1080Leu1.000
rpoC766627c.3258G>C1.000
rpoC766630c.3261G>C1.000
rpoC766645c.3276A>G1.000
rpoC766651c.3282T>C1.000
rpoC766657c.3288A>G1.000
rpoC766658p.Arg1097Gly1.000
rpoC766666c.3297C>G1.000
rpoC766672c.3303T>C1.000
rpoC766726c.3357T>C1.000
rpoC766738c.3369G>C1.000
rpoC766765c.3396A>C1.000
rpoC766774c.3405T>C1.000
rpoC766804c.3435A>G1.000
rpoC766861c.3492G>A1.000
rpoC766864c.3495G>C1.000
rpoC766883p.Ser1172Ala1.000
rpoC766894c.3525T>C1.000
rpoC766895c.3526T>C1.000
rpoC766900c.3531T>C1.000
rpoC766915p.Asp1182Glu1.000
rpoC766918c.3549C>T0.974
rpoC766923p.Glu1185Gly1.000
rpoC766931p.Ala1188Ser1.000
rpoC766945c.3576A>G1.000
rpoC766963c.3594T>C1.000
rpoC766972c.3603G>C1.000
rpoC766978c.3609C>T1.000
rpoC766996c.3627C>T1.000
rpoC767032c.3663G>C0.981
rpoC767059c.3690T>G1.000
rpoC767062c.3693C>G1.000
rpoC767098c.3729T>C1.000
rpoC767119c.3750A>G1.000
rpoC767152c.3783T>C1.000
rpoC767158c.3789T>G1.000
rpoC767180p.Ala1271Gln1.000
rpoC767188c.3819G>A1.000
rpoC767209c.3840T>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767242p.Gln1291His1.000
rpoC767263c.3894T>C1.000
rpoC767264p.Ala1299Gln1.000
rpoC767275c.3906T>G1.000
rpoC767278c.3909T>C1.000
rpoC767281c.3912C>G1.000
rpsL781348c.-212C>G1.000
rpsL781353c.-207T>C1.000
rpsL781358c.-202G>A1.000
rpsL781366c.-194T>C1.000
rpsL781372c.-188T>A1.000
rpsL781395c.-165T>C1.000
rpsL781399c.-161T>C1.000
rpsL781403c.-157G>A1.000
rpsL781406c.-154G>A1.000
rpsL781407c.-153C>A1.000
rpsL781421c.-139C>G1.000
rpsL781435c.-125G>A1.000
rpsL781571c.12C>T1.000
rpsL781608p.Ser17Gly1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781682c.123T>G1.000
rpsL781715c.156T>C1.000
rpsL781718c.159C>G1.000
rpsL781728c.169T>C1.000
rpsL781736c.177T>C1.000
rpsL781754c.195G>C1.000
rpsL781808c.249C>T1.000
rpsL781820c.261G>C1.000
rpsL781832c.273T>C1.000
rpsL781835c.276T>C1.000
rpsL781841c.282C>G1.000
rpsL781865c.306G>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>C1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rplC800798c.-11TGG>T1.000
rplC800801c.-8A>C1.000
rplC800814c.6A>G1.000
rplC800844c.36T>C1.000
rplC800867p.Ser20Asn1.000
rplC800874c.66A>G0.976
rplC800877c.69A>C1.000
rplC800880c.72A>C1.000
rplC800889c.81C>G1.000
rplC800907c.99C>G1.000
rplC800916c.108A>G1.000
rplC800934c.126C>G1.000
rplC800937c.129A>G1.000
rplC800946c.138T>C1.000
rplC800949c.141T>C1.000
rplC800967c.159C>A1.000
rplC800970c.162T>C1.000
rplC800973c.165C>T1.000
rplC800982c.174C>T1.000
rplC800985c.177A>G1.000
rplC801004p.Leu66Val1.000
rplC801009c.201A>C1.000
rplC801027c.219C>G1.000
rplC801039c.231A>G1.000
rplC801045c.237A>G1.000
rplC801054c.246G>C1.000
rplC801057c.249G>A1.000
rplC801063c.255G>C1.000
rplC801134p.Gly109Ala1.000
rplC801137p.Ser110Thr1.000
rplC801147c.339T>C1.000
rplC801153c.345G>C1.000
rplC801171c.363A>G1.000
rplC801174c.366T>C1.000
rplC801201c.393C>T1.000
rplC801222c.414T>C1.000
rplC801228c.420T>C1.000
rplC801255c.447C>T1.000
rplC801264c.456C>T1.000
rplC801267c.459A>C1.000
rplC801270c.462T>C1.000
rplC801276c.468G>C1.000
rplC801288c.480G>C1.000
rplC801312c.504G>C1.000
rplC801315c.507G>C1.000
rplC801324c.516T>C1.000
rplC801339c.531T>G1.000
rplC801341p.Leu178Gln1.000
rplC801348c.540T>G1.000
rplC801357c.549T>C1.000
rplC801367p.Ala187Thr1.000
rplC801396c.588T>C1.000
rplC801400p.Val198Ile1.000
rplC801405c.597T>C1.000
rplC801423c.615G>C1.000
rplC801426c.618C>G1.000
rplC801432c.624C>G1.000
rrs1471970r.125g>a1.000
rrs1472019r.174g>a1.000
rrs1472028r.183a>c1.000
rrs1472031r.186g>a1.000
rrs1472033r.188a>g1.000
rrs1472034r.189t>c1.000
rrs1472040r.195t>c1.000
rrs1472045r.200t>g1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472075r.230a>g1.000
rrs1472489r.644a>g1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1473105r.1260g>a1.000
rrs1473120r.1275c>ct0.969
rrs1473123r.1278a>t1.000
rrl1473399c.-259A>AG0.964
rrl1473417c.-241C>T1.000
rrl1473419c.-239T>C1.000
rrl1473421c.-237G>A1.000
rrl1473437c.-221T>C1.000
rrl1473439c.-219T>C1.000
rrl1473452c.-206A>G1.000
rrl1473454c.-204A>G1.000
rrl1473569c.-89A>T1.000
rrl1473571c.-87C>T1.000
rrl1473595c.-63T>C1.000
rrl1473600c.-58A>G1.000
rrl1473608c.-50G>C1.000
rrl1473609c.-49GC>G1.000
rrl1473613c.-45GC>G1.000
rrl1473617c.-41T>A1.000
rrl1473618c.-40G>C0.947
rrl1473623c.-35G>A1.000
rrl1473626c.-32C>CGT1.000
rrl1473633c.-25C>T1.000
rrl1473637c.-21A>C1.000
rrl1473648c.-10TTTG>T1.000
rrl1473659r.2t>a1.000
rrl1473667r.10t>c1.000
rrl1473668r.11c>t1.000
rrl1473758r.101g>t1.000
rrl1473806r.149c>t1.000
rrl1473813r.156c>t1.000
rrl1473877r.220g>a1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>t1.000
rrl1473924r.267a>at1.000
rrl1473981r.324g>t0.980
rrl1473986r.329t>c1.000
rrl1473995r.338g>t1.000
rrl1474001r.344c>t1.000
rrl1474009r.352a>g1.000
rrl1474012r.355c>t1.000
rrl1474040r.383g>a1.000
rrl1474060r.403g>a1.000
rrl1474089r.432c>t1.000
rrl1474111r.454t>c1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>t1.000
rrl1474249r.592g>a1.000
rrl1474289r.632c>t0.962
rrl1474290r.633ttttcctctccggag>t0.981
rrl1474292r.635t>a0.980
rrl1474292r.635ttcctctccggagg>t1.000
rrl1474293r.636tcctctccggaggagg>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.989
rrl1474413r.756a>t1.000
rrl1474414r.757c>t1.000
rrl1474415r.758c>t1.000
rrl1474416r.759cacacgcgcatacgcgcgtgtgaat>c1.000
rrl1474552r.895c>t0.987
rrl1474632r.975g>t0.988
rrl1474639r.982g>a1.000
rrl1474717r.1060a>t0.985
rrl1474794r.1137c>t1.000
rrl1474950r.1293g>a1.000
rrl1474961r.1304t>g1.000
rrl1474962r.1305t>c1.000
rrl1474963r.1306g>a1.000
rrl1474964r.1307t>a1.000
rrl1474997r.1340a>t1.000
rrl1475006r.1349a>g1.000
rrl1475061r.1404c>t1.000
rrl1475088r.1431a>t1.000
rrl1475213r.1556c>t1.000
rrl1475252r.1595c>t1.000
rrl1475253r.1596t>g1.000
rrl1475273r.1616t>g1.000
rrl1475275r.1618c>t1.000
rrl1475276r.1619t>c1.000
rrl1475289r.1632g>a0.972
rrl1475291r.1634a>c0.972
rrl1475313r.1656g>a1.000
rrl1475315r.1658a>t1.000
rrl1475355r.1698c>t1.000
rrl1475363r.1706c>t1.000
rrl1475366r.1709g>a1.000
rrl1475369r.1712g>t1.000
rrl1475402r.1745c>t1.000
rrl1475409r.1752t>c1.000
rrl1475419r.1762c>t1.000
rrl1475429r.1772g>a1.000
rrl1475532r.1875a>g1.000
rrl1475606r.1949t>c1.000
rrl1475608r.1951t>c1.000
rrl1475616r.1959a>g1.000
rrl1475617r.1960c>g1.000
rrl1475625r.1968g>c1.000
rrl1475626r.1969t>c1.000
rrl1475639r.1982c>t1.000
rrl1475655r.1998t>c1.000
rrl1475659r.2002g>a1.000
rrl1475883r.2226a>g1.000
rrl1475988r.2331a>g1.000
rrl1476035r.2378g>a1.000
rrl1476086r.2429g>a1.000
rrl1476089r.2432t>c1.000
rrl1476095r.2438c>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476115r.2458t>c1.000
rrl1476117r.2460g>c1.000
rrl1476251r.2594t>c1.000
rrl1476256r.2599a>c0.972
rrl1476583r.2926g>c1.000
rrl1476597r.2940g>a1.000
rrl1476628r.2971t>a1.000
rrl1476689r.3032a>t1.000
rrl1476690r.3033c>t1.000
rrl1476693r.3036g>a1.000
rrl1476695r.3038t>a1.000
rrl1476716r.3059a>c1.000
rrl1476723r.3066t>a0.988
rrl1476726r.3069a>g1.000
rrl1476732r.3075t>c1.000
rrl1476750r.3093t>c1.000
rrl1476759r.3102t>a1.000
rrl1476770r.3113t>c1.000
rrl1476771r.3114g>a1.000
fabG11674099c.660G>C1.000
fabG11674114c.675T>G1.000
fabG11674123c.684T>C1.000
fabG11674126c.687G>C1.000
fabG11674127c.688A>T1.000
fabG11674132c.693T>C1.000
fabG11674138c.699C>G1.000
fabG11674141c.702T>C1.000
fabG11674166p.Met243Ala1.000
fabG11674171c.732T>C1.000
fabG11674183r.744acacaacac>a1.000
inhA1674192c.-10A>G1.000
inhA1674197c.-5C>T1.000
inhA1674199c.-3C>G1.000
inhA1674205p.Thr2Ala1.000
inhA1674216c.15G>C1.000
inhA1674219p.Asp6Glu1.000
inhA1674225c.24A>G1.000
inhA1674237c.36T>C1.000
inhA1674239p.Ser13Thr1.000
inhA1674243c.42A>G1.000
inhA1674249c.48C>T1.000
inhA1674279c.78A>G1.000
inhA1674285c.84A>G1.000
inhA1674300c.99C>G1.000
inhA1674304p.Gln35Glu1.000
inhA1674315c.114C>G1.000
inhA1674342c.141T>C1.000
inhA1674352p.Thr51Ala1.000
inhA1674387c.186A>G1.000
inhA1674406p.Glu69Lys1.000
inhA1674416p.Ala72Asp1.000
inhA1674419p.Ser73Thr1.000
inhA1674421c.220T>C1.000
inhA1674425p.Ala75Gly1.000
inhA1674428p.Gly76Glu1.000
inhA1674443p.Ala81Val1.000
inhA1674450c.249G>T1.000
inhA1674452p.Ala84Glu1.000
inhA1674471c.270G>C1.000
inhA1674486c.285T>C1.000
inhA1674489c.288G>C1.000
inhA1674503p.Thr101Ser1.000
inhA1674542p.Ala114Glu0.756
inhA1674546c.345T>C1.000
inhA1674549c.348G>C1.000
inhA1674550p.Ser117Ala1.000
inhA1674570c.369G>C1.000
inhA1674576c.375T>C1.000
inhA1674582c.381T>C1.000
inhA1674585c.384T>C1.000
inhA1674589p.Met130Leu1.000
inhA1674624c.423A>C1.000
inhA1674627c.426T>C1.000
inhA1674628p.Ser143Gly1.000
inhA1674654c.453G>C1.000
inhA1674660c.459G>T1.000
inhA1674663c.462G>C1.000
inhA1674703c.502T>C1.000
inhA1674714c.513C>G1.000
inhA1674718c.517A>C1.000
inhA1674726c.525G>A1.000
inhA1674729c.528G>C1.000
inhA1674750c.549T>C1.000
inhA1674756c.555T>C1.000
inhA1674765c.564C>T1.000
inhA1674771c.570C>G1.000
inhA1674777c.576C>G1.000
inhA1674780c.579T>G1.000
inhA1674792c.591G>C1.000
inhA1674801c.600T>C1.000
inhA1674816c.615T>A1.000
inhA1674822c.621C>G1.000
inhA1674825c.624C>T1.000
inhA1674846c.645C>A1.000
inhA1674849p.Gln216His1.000
inhA1674870c.669T>C1.000
inhA1674876c.675C>G1.000
inhA1674879c.678T>G1.000
inhA1674883p.Ile228Leu1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674933c.732G>C1.000
inhA1674939c.738G>C1.000
inhA1674942c.741T>G1.000
inhA1674945p.Asp248Glu1.000
inhA1674957c.756G>A1.000
inhA1674966c.765T>C1.000
inhA1674967p.Asp256Thr1.000
inhA1674970p.Ile257Val1.000
inhA1674993c.792G>C1.000
inhA1674994p.His265Ser1.000
rpsA1833470c.-72T>TG0.923
rpsA1833471c.-71A>C1.000
rpsA1833489c.-53T>A1.000
rpsA1833490c.-52C>T1.000
rpsA1833491c.-51A>G1.000
rpsA1833495c.-47A>AAATC1.000
rpsA1833498c.-44A>G1.000
rpsA1833501c.-41C>T1.000
rpsA1833517c.-25AC>A0.509
rpsA1833541c.-1T>C1.000
rpsA1833554p.Thr5Ala1.000
rpsA1833578p.Val13Ile1.000
rpsA1833595c.54T>C1.000
rpsA1833613c.72C>A1.000
rpsA1833625c.84A>G1.000
rpsA1833673c.132C>A1.000
rpsA1833724c.183C>G1.000
rpsA1833727c.186G>C1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833793c.252C>T0.978
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833874c.333T>C1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833979c.438T>C1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>G1.000
rpsA1834012c.471G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834051c.510G>A1.000
rpsA1834099c.558C>G1.000
rpsA1834102c.561T>G1.000
rpsA1834105c.564C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834123c.582C>G1.000
rpsA1834126c.585G>A1.000
rpsA1834129c.588C>G1.000
rpsA1834132c.591G>A1.000
rpsA1834135c.594G>T1.000
rpsA1834138c.597C>T1.000
rpsA1834144c.603G>A1.000
rpsA1834148c.607C>T1.000
rpsA1834153c.612T>C1.000
rpsA1834154p.Asn205Gln1.000
rpsA1834157c.616T>C1.000
rpsA1834162c.621A>G1.000
rpsA1834165c.624A>G1.000
rpsA1834177c.636A>C1.000
rpsA1834183c.642T>C1.000
rpsA1834186c.645C>G1.000
rpsA1834189c.648G>C1.000
rpsA1834192c.651C>G1.000
rpsA1834249c.708T>C1.000
rpsA1834261c.720A>G1.000
rpsA1834262c.721T>A1.000
rpsA1834303c.762T>C1.000
rpsA1834306c.765T>C1.000
rpsA1834348c.807T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>A1.000
rpsA1834378c.837T>C1.000
rpsA1834411c.870T>G1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834432c.891G>A1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834465c.924T>C1.000
rpsA1834468c.927A>G1.000
rpsA1834474c.933C>G1.000
rpsA1834489c.948T>C1.000
rpsA1834528c.987T>C1.000
rpsA1834546c.1005T>C1.000
rpsA1834555c.1014T>C1.000
rpsA1834606c.1065C>G1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834654p.Glu371Asp1.000
rpsA1834690c.1149T>C1.000
rpsA1834732c.1191T>C1.000
rpsA1834733p.Ala398Ser1.000
rpsA1834753c.1212T>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834775p.Ala412Thr1.000
rpsA1834780c.1239A>G1.000
rpsA1834786c.1245A>G1.000
rpsA1834788p.Ala416Gly1.000
rpsA1834792c.1251G>C1.000
rpsA1834852c.1311C>G0.860
rpsA1834930c.1389A>G1.000
rpsA1834939c.1398C>T1.000
rpsA1834948c.1407G>A1.000
rpsA1834949c.1408C>T1.000
rpsA1834957c.1416C>T1.000
rpsA1834969c.1428A>G1.000
rpsA1834980p.Ser480Asn1.000
rpsA1834984c.1443T>C1.000
rpsA1834985c.1445 1445del1.000
tlyA1917939c.-1C>CG1.000
tlyA1917951c.12T>C1.000
tlyA1917972c.33A>C1.000
tlyA1917978c.39G>C1.000
tlyA1917981c.42G>C1.000
tlyA1917984c.45C>G1.000
tlyA1917987c.48G>C1.000
tlyA1917996c.57A>T1.000
tlyA1917999c.60T>C1.000
tlyA1918002c.63A>G1.000
tlyA1918015c.76T>C1.000
tlyA1918029c.90C>G1.000
tlyA1918272c.333C>G1.000
tlyA1918275c.336T>C1.000
tlyA1918281c.342A>C1.000
tlyA1918296c.357G>C1.000
tlyA1918300p.Ser121Pro1.000
tlyA1918377c.438T>G0.966
tlyA1918379p.Arg147Pro0.966
tlyA1918392c.453A>G0.315
tlyA1918417c.478T>C1.000
tlyA1918422c.483T>C1.000
tlyA1918434c.495C>G1.000
tlyA1918446c.507A>G1.000
tlyA1918449c.510C>T1.000
tlyA1918452c.513T>C1.000
tlyA1918454p.Ser172Trp1.000
tlyA1918456173RD>173PS1.000
tlyA1918464c.525C>G1.000
tlyA1918476c.537A>C1.000
tlyA1918477p.Leu180Met1.000
tlyA1918485c.546G>A1.000
tlyA1918497c.558G>A1.000
tlyA1918506c.567A>G1.000
tlyA1918509c.570T>C1.000
tlyA1918519p.Pro194Ala1.000
tlyA1918524c.585T>C1.000
tlyA1918604p.Ser222Thr1.000
tlyA1918614c.675C>G1.000
tlyA1918615p.Lys226Ala1.000
tlyA1918638c.699A>G1.000
tlyA1918647c.708T>C1.000
katG2154135c.1977C>G1.000
katG2155566c.546C>G1.000
katG2155572c.540C>G1.000
katG2155581c.531G>C1.000
katG2155590c.522T>C1.000
katG2155596c.516C>G1.000
katG2155616p.Val166Ile1.000
katG2155617c.495A>G1.000
katG2155632c.480T>G1.000
katG2155637p.Leu159Ile1.000
katG2155641p.Lys157Asn1.000
katG2155676c.436G>T1.000
katG2155691c.421A>G1.000
katG2155696p.Ala139Val1.000
katG2155704c.408G>C1.000
katG2155716c.396A>G1.000
katG2155722c.390C>G1.000
katG2155728c.384C>G1.000
katG2155742p.Gly124Gln1.000
katG2155743c.369C>A1.000
katG2155747p.Ala122Gly1.000
katG2155764p.His116Gln1.000
katG2155767c.345G>A1.000
pncA2289029c.213A>G1.000
pncA2289035c.207T>C1.000
pncA2289041c.201C>G1.000
pncA2289047c.195G>C1.000
pncA2289061p.Thr61His1.000
pncA2289063p.Gly60Asp1.000
pncA2289088p.Ile52Val1.000
pncA2289100p.Lys48Gln1.000
pncA2289101c.141G>A1.000
pncA2289104c.138T>G1.000
pncA2289116p.His42Gln1.000
pncA2289123p.Asp40Gly1.000
pncA2289127p.Ala39Pro1.000
pncA2289129p.Ala38Glu1.000
pncA2289133p.Glu37Arg1.000
pncA2289140c.102G>A1.000
pncA2289147p.Ser32Asn1.000
pncA2289157p.Arg29Ser1.000
pncA2289164c.78C>G1.000
pncA2289173c.69A>G1.000
pncA2289178p.Thr22Ala1.000
pncA2289184p.Ala20Pro1.000
pncA2289187p.Leu19Val1.000
pncA2289194c.48A>G1.000
pncA2289199p.Glu15Lys1.000
kasA2518132c.18C>T1.000
kasA2518146p.Phe11Tyr1.000
kasA2518156c.42T>C1.000
kasA2518162c.48G>A1.000
kasA2518172p.Thr20Ala1.000
kasA2518190p.Ser26Ala1.000
kasA2518195c.81G>A1.000
kasA2518220c.106C>T0.983
kasA2518226p.Ala38Ser1.000
kasA2518245p.His44Arg1.000
kasA2518248p.Ala45Val1.000
kasA2518279c.165T>C1.000
kasA2518282c.168A>G1.000
kasA2518283p.Ala57Pro1.000
kasA2518297c.183C>T1.000
kasA2518300c.186T>A1.000
kasA2518312p.Asp66Glu1.000
kasA2518316p.Val68Ile1.000
kasA2518323p.Ser70Asn1.000
kasA2518336c.222A>G1.000
kasA2518339c.225C>G1.000
kasA2518343p.Met77Leu1.000
kasA2518348c.234A>G1.000
kasA2518369c.255G>C1.000
kasA2518370p.Met86Leu1.000
kasA2518374p.Gly87Ala1.000
kasA2518378c.264G>A1.000
kasA2518381p.Leu89Phe1.000
kasA2518385p.Gly91Ser0.909
kasA2518390c.276A>C1.000
kasA2518396c.282A>G1.000
kasA2518403p.Ser97Ala1.000
kasA2518408c.294C>G1.000
kasA2518417c.303G>C1.000
kasA2518429c.315A>G1.000
kasA2518435c.321G>C1.000
kasA2518439p.Ala109Ser1.000
kasA2518444c.330T>C1.000
kasA2518447c.333T>G1.000
kasA2518456c.342C>G1.000
kasA2518459c.345T>C1.000
kasA2518462c.348A>G1.000
kasA2518468c.354A>C1.000
kasA2518475c.361A>C1.000
kasA2518480c.366T>C1.000
kasA2518483c.369C>G1.000
kasA2518492c.378C>T1.000
kasA2518504c.390T>C1.000
kasA2518506p.Ala131Glu1.000
kasA2518519c.405G>C1.000
kasA2518528c.414C>G1.000
kasA2518534c.420G>C1.000
kasA2518567c.453G>C1.000
kasA2518571p.Val153Thr1.000
kasA2518574p.Ile154Val1.000
kasA2518579c.465T>G1.000
kasA2518588c.474T>G1.000
kasA2518594c.480C>G1.000
kasA2518603c.489G>A1.000
kasA2518627c.513T>C1.000
kasA2518642c.528A>G1.000
kasA2518645c.531G>C1.000
kasA2518657c.543G>A1.000
kasA2518663c.549T>C1.000
kasA2518672c.558G>C1.000
kasA2518678c.564C>T1.000
kasA2518681c.567C>T1.000
kasA2518684c.570C>G1.000
kasA2518697p.Cys195Ala1.000
kasA2518711c.597A>G1.000
kasA2518714c.600A>C1.000
kasA2518717c.603C>G1.000
kasA2518747c.633C>G0.951
kasA2518783c.669T>C1.000
kasA2518789c.675G>C1.000
kasA2518795c.681C>A1.000
kasA2518798c.684G>T1.000
kasA2518816c.702C>G0.214
kasA2518822c.708C>T0.225
kasA2518825c.711T>C1.000
kasA2518843c.729T>G0.769
kasA2518849c.735G>C1.000
kasA2518855c.741C>G1.000
kasA2518864c.750G>C1.000
kasA2518877p.Lys255Arg1.000
kasA2518885c.771T>C1.000
kasA2518893p.Lys260Arg1.000
kasA2518898c.784T>C1.000
kasA2518906c.792A>G1.000
kasA2518907c.793T>C1.000
kasA2518912c.798G>C1.000
kasA2518921c.807T>C1.000
kasA2518939c.825T>C1.000
kasA2518942c.828T>C1.000
kasA2518960c.846C>G1.000
kasA2519008c.894C>G0.600
kasA2519011c.897G>C0.600
kasA2519012c.898T>C0.600
kasA2519017c.903G>C0.600
kasA2519020c.906G>C0.600
kasA2519021p.Ala303Lys0.600
kasA2519062c.948T>G1.000
kasA2519072p.Ala320Thr1.000
kasA2519077c.963G>C1.000
kasA2519092c.978C>T1.000
kasA2519095c.981C>G1.000
kasA2519107c.993T>C1.000
kasA2519110p.Asp332Glu1.000
kasA2519112p.Gln333Arg1.000
kasA2519137c.1023T>G1.000
kasA2519152c.1038G>C1.000
kasA2519167c.1053T>C0.647
kasA2519173c.1059C>G0.591
kasA2519176c.1062G>A1.000
kasA2519179c.1065G>T1.000
kasA2519182c.1068G>C1.000
kasA2519191c.1077G>A1.000
kasA2519192c.1078C>T1.000
kasA2519197c.1083G>C1.000
kasA2519200c.1086G>T1.000
kasA2519203c.1089C>G1.000
kasA2519215c.1101C>A1.000
kasA2519221c.1107G>C1.000
kasA2519224c.1110C>G1.000
kasA2519239c.1125A>C1.000
kasA2519263c.1149C>T1.000
kasA2519266c.1152C>T1.000
kasA2519272c.1158C>G1.000
kasA2519281c.1167G>T1.000
kasA2519287c.1173T>C1.000
kasA2519295p.Tyr394Phe1.000
kasA2519299c.1185C>T1.000
kasA2519305c.1191A>G1.000
kasA2519306p.Val398Ile1.000
kasA2519323c.1209G>A1.000
kasA2519338c.1224T>C1.000
kasA2519347c.1233T>C1.000
kasA2519350c.1236C>G1.000
ahpC2726204c.12A>G1.000
ahpC2726210c.18T>C1.000
ahpC2726216c.24T>C1.000
ahpC2726233p.Gln14Arg1.000
ahpC2726237c.45C>G1.000
ahpC2726243c.51T>G1.000
ahpC2726246c.54C>G1.000
ahpC2726252c.60C>T1.000
ahpC2726255c.63T>C1.000
ahpC2726264c.72C>G1.000
ahpC2726282c.90G>A1.000
ahpC2726303c.111T>C1.000
ahpC2726304p.Ile38Leu1.000
ahpC2726312c.120T>C1.000
ahpC2726318p.Glu42Asp1.000
ahpC2726322p.Pro44Glu1.000
ahpC2726336c.144G>C1.000
ahpC2726348c.156T>C1.000
ahpC2726357c.165A>G1.000
ahpC2726366c.174G>C1.000
ahpC2726369c.177C>T1.000
ahpC2726378c.186T>C1.000
ahpC2726397p.Ser69Gly1.000
ahpC2726408c.216T>C1.000
ahpC2726432c.240C>G1.000
ahpC2726441c.249G>C1.000
ahpC2726444c.252G>A1.000
ahpC2726447c.255T>C1.000
ahpC2726453c.261T>C1.000
ahpC2726467p.Ala92Val1.000
ahpC2726471c.279T>C1.000
ahpC2726477c.285G>A1.000
ahpC2726483c.291T>C1.000
ahpC2726493p.Asn101Glu1.000
ahpC2726504c.312A>G1.000
ahpC2726506p.Thr105Lys1.000
ahpC2726508c.316T>C1.000
ahpC2726513c.321C>G1.000
ahpC2726528c.336C>G1.000
ahpC2726591c.399C>G1.000
ahpC2726600c.408T>C1.000
ahpC2726621c.429G>A1.000
ahpC2726627c.435G>A1.000
ahpC2726639c.447C>G1.000
ahpC2726645c.453C>G1.000
ahpC2726648c.456T>A1.000
ahpC2726651c.459G>C1.000
ahpC2726657c.465A>C1.000
ahpC2726660c.468C>A1.000
ahpC2726669c.477T>C1.000
ahpC2726675c.483A>G1.000
ahpC2726681c.489A>G1.000
ahpC2726684c.492G>C1.000
ahpC2726687c.495C>G1.000
ahpC2726693c.501C>G1.000
ahpC2726696c.504C>G1.000
ahpC2726699c.507G>A1.000
ahpC2726717c.525A>C1.000
ahpC2726744c.552G>C1.000
ahpC2726745p.Leu185Ile1.000
ahpC2726759c.567A>G1.000
ahpC2726762c.570C>G1.000
ahpC2726771c.579T>C1.000
folC2746141c.1458C>T1.000
folC2746158c.1441A>G0.950
folC2746165c.1434A>T1.000
folC2746174c.1425T>G1.000
folC2746183c.1416A>C1.000
folC2746197p.Ile468Val1.000
folC2746240p.Asp453Glu0.263
folC2746243c.1356G>A0.263
folC2746266p.Ser445Ala1.000
folC2746270c.1329G>C1.000
folC2746273c.1326A>G1.000
folC2746282c.1317A>G1.000
folC2746285c.1314A>G1.000
folC2746308p.Arg431Thr1.000
folC2746330p.Glu423Asp1.000
folC2746335p.Gly422Arg1.000
folC2746336c.1263G>C1.000
folC2746351c.1248G>C1.000
folC2746360c.1239A>G1.000
folC2746378c.1221C>A1.000
folC2746390c.1209C>G1.000
folC2746401p.Ser400Val1.000
folC2746420c.1179T>C1.000
folC2746426c.1173C>G1.000
folC2746440p.Val387Thr1.000
folC2746451p.Gly383Ala1.000
folC2746455p.Leu382Met1.000
folC2746456c.1143C>G1.000
folC2746566p.Ala345Thr1.000
folC2746584c.1015A>G1.000
folC2746594c.1005A>G1.000
folC2746609c.990A>G1.000
folC2746612c.987G>A1.000
folC2746617p.Ala328Ser1.000
folC2746624c.975G>C1.000
folC2746627p.Asp324Glu1.000
folC2746631p.Gly323Val1.000
folC2746642c.957A>G1.000
folC2746657c.942A>G1.000
folC2746663c.936A>G1.000
folC2746677p.Ser308Ala1.000
folC2746678c.921A>C1.000
folC2746684c.915G>C1.000
folC2746689p.Leu304Val1.000
folC2746691p.Val303Ala1.000
folC2746714c.885A>G1.000
folC2746728c.871A>G1.000
folC2746734p.Ile289Val1.000
folC2746744c.855A>C1.000
folC2746759c.840C>T0.963
folC2746765c.834T>C1.000
folC2746771c.828T>G1.000
folC2746777c.822A>T1.000
folC2746785p.Val272Ile1.000
folC2746813c.786T>C1.000
folC2746819c.780A>G1.000
folC2746836p.Ser255Ala1.000
folC2746837c.762C>G1.000
folC2746857p.Glu248Gln1.000
folC2746877p.Val241Ala1.000
folC2746881p.Lys240Glu1.000
folC2746885c.714G>C1.000
folC2746891c.708A>G1.000
folC2746895p.Gly235Ala1.000
folC2746903c.696C>G1.000
folC2746920p.Ser227Ala1.000
folC2746921c.678A>G1.000
folC2746929p.Pro224Ala1.000
folC2746935p.Arg222Lys1.000
folC2746937p.Thr221Asn1.000
folC2746948c.651C>G1.000
folC2746957c.642C>A1.000
folC2746975c.624A>G1.000
folC2746979p.Ala207Asp1.000
folC2746981c.618A>G1.000
folC2746990p.Asp203Glu1.000
folC2746999c.600A>G1.000
folC2747002c.597A>G1.000
folC2747007p.Ser198Gly1.000
folC2747011c.588C>T1.000
folC2747023c.576G>C1.000
folC2747032c.567T>C1.000
folC2747036p.Asn188Ser1.000
folC2747059c.540A>C1.000
folC2747062c.537T>A1.000
folC2747070p.Met177Leu1.000
folC2747074c.525C>G1.000
folC2747086c.513T>C1.000
folC2747089c.510C>G1.000
folC2747107c.492C>G1.000
folC2747110c.489A>G1.000
folC2747113c.486G>C1.000
folC2747116c.483C>G1.000
folC2747137c.462C>G1.000
folC2747146c.453C>T1.000
folC2747230c.369G>C1.000
folC2747239c.360A>G1.000
folC2747262p.Lys113His1.000
folC2747263c.336G>T1.000
folC2747274p.Ser109Ala1.000
folC2747275c.324A>G1.000
folC2747278c.321G>C1.000
folC2747284c.315C>G1.000
folC2747289p.Pro104Ala1.000
folC2747290c.309T>C1.000
folC2747293c.306C>T1.000
folC2747302c.297T>C1.000
folC2747341c.258G>C1.000
folC2747359c.240G>C1.000
folC2747365c.234C>G1.000
folC2747371c.228G>C1.000
folC2747395c.204A>G1.000
folC2747407c.192A>G1.000
folC2747412p.Ser63Gly1.000
folC2747414p.Arg62Leu1.000
folC2747419c.180G>C1.000
folC2747442c.157A>G1.000
folC2747443c.156C>G1.000
folC2747467p.Asp44Glu1.000
folC2747475p.Arg42Lys1.000
folC2747482c.117C>G1.000
folC2747494c.105G>A1.000
folC2747497c.102G>C1.000
folC2747500c.99T>C1.000
folC2747503c.96A>G1.000
folC2747506c.93C>T1.000
folC2747509c.90A>G1.000
folC2747521c.78G>C1.000
folC2747539c.60A>G1.000
ribD2987453c.615T>C1.000
ribD2987457p.Val207Met1.000
ribD2987474c.636T>C1.000
ribD2987486c.648C>G1.000
ribD2987489c.651C>G1.000
ribD2987493p.Val219Leu1.000
ribD2987510c.672G>C1.000
ribD2987513c.675C>A1.000
ribD2987519c.681A>C1.000
ribD2987521p.Val228Ala1.000
ribD2987525c.687G>C1.000
ribD2987558c.720T>C1.000
ribD2987564c.726T>C1.000
ribD2987565p.Val243Ile1.000
ribD2987570c.732C>G1.000
ribD2987579c.741C>T1.000
ribD2987580p.Ser248Ala1.000
ribD2987585c.747C>T1.000
ribD2987588c.750C>T0.929
thyX3067194752C>T1.000
thyX3067199c.747T>C1.000
thyX3067205c.741C>G1.000
thyX3067220c.726C>G1.000
thyX3067223c.723C>G0.659
thyX3067245p.Thr234Arg1.000
thyX3067249p.Thr233Ser1.000
thyX3067252p.Val232Ile1.000
thyX3067253c.693C>T0.962
thyX3067277c.669G>T0.970
thyX3067282p.Val222Met1.000
thyX3067284p.Ala221Gly1.000
thyX3067304c.642T>C1.000
thyX3067355c.591T>G1.000
thyX3067373c.573G>C1.000
thyX3067394c.552C>G1.000
thyX3067406c.540T>C1.000
thyX3067439c.507T>C1.000
thyX3067442c.504G>A1.000
thyX3067459c.487G>C1.000
thyX3067462c.484G>A1.000
thyX3067465p.Ile161Val1.000
thyX3067470p.Asn159Ser1.000
thyX3067477p.Gln157Glu1.000
thyX3067479p.Asp156Gly1.000
thyX3067516p.Ser144Ala1.000
thyX3067531p.Ala139Ser1.000
thyX3067535c.411G>A1.000
thyX3067541c.405G>C1.000
thyX3067545p.Glu134Ala1.000
thyX3067550c.396C>G1.000
thyX3067556p.His130Gln1.000
thyX3067559c.387G>C0.791
thyX3067565p.Asp127Glu0.816
thyX3067570p.Ala126Pro0.820
thyX3067577p.Glu123Asp0.827
thyX3067586c.360G>C1.000
thyX3067610p.Lys112Asn1.000
thyX3067613c.333C>T1.000
thyX3067616c.330G>C1.000
thyX3067619c.327T>C1.000
thyX3067631c.315G>C1.000
thyX3067636c.310G>C1.000
thyX3067652c.294A>G1.000
thyX3067658c.288G>A1.000
thyX3067661c.285G>C1.000
thyX3067673c.273G>A1.000
thyX3067694c.252C>G1.000
thyX3067718c.228G>C1.000
thyX3067721c.225A>G1.000
thyX3067727c.219T>G1.000
thyX3067739c.207A>G1.000
thyX3067742c.204T>G1.000
thyX3067762p.Arg62Lys0.984
thyX3067765p.Leu61Ile1.000
thyX3067781c.165G>C1.000
thyX3067802c.144G>C1.000
thyX3067814c.132A>G1.000
thyX3067850c.96T>G1.000
thyX3067874c.72G>C1.000
thyX3067883c.63G>C1.000
thyX3067886c.60T>C1.000
thyX3067889c.57G>C1.000
thyX3067894c.52A>G1.000
thyX3067898p.Asp16Glu1.000
thyX3067915c.31G>A1.000
thyX3067925c.21C>T1.000
thyX3067939p.Glu3Gln1.000
thyA3073686c.786C>A1.000
thyA3073692c.780T>G1.000
thyA3073695c.777A>G1.000
thyA3073710c.762A>G1.000
thyA3073731c.741A>C0.982
thyA3073736p.Ile246Val1.000
thyA3073740p.Glu244Asp1.000
thyA3073743c.729A>G1.000
thyA3073752p.Glu240Asp1.000
thyA3073761c.711T>C1.000
thyA3073830c.642C>T1.000
thyA3073839c.633A>G1.000
thyA3073860c.612G>C1.000
thyA3073863c.609A>G1.000
thyA3073874p.Ile200Val1.000
thyA3073889p.Ser195Gly1.000
thyA3073892c.580A>G1.000
thyA3073893c.579G>T1.000
thyA3073908p.Met188Ile0.980
thyA3073925c.547C>T1.000
thyA3073929c.543A>G1.000
thyA3073950c.522C>G1.000
thyA3073953c.519A>G1.000
thyA3073956c.516C>G1.000
thyA3073959c.513A>G1.000
thyA3073977c.495T>C1.000
thyA3073989c.483A>G1.000
thyA3074001c.471G>C1.000
thyA3074004c.468A>G1.000
thyA3074010c.462G>C1.000
thyA3074028c.444C>T1.000
thyA3074031c.441A>G1.000
thyA3074034c.438A>G1.000
thyA3074037c.435G>C1.000
thyA3074057p.Glu139Pro1.000
thyA3074061p.Glu137Asp1.000
thyA3074076c.396G>T1.000
thyA3074094c.378C>T1.000
thyA3074102p.Asp124Asn1.000
thyA3074103c.369G>C1.000
thyA3074106c.366A>G1.000
thyA3074120c.352A>G1.000
thyA3074121p.Asp117Glu1.000
thyA3074130c.342C>G1.000
thyA3074147p.Ile109Val1.000
thyA3074154c.318A>G1.000
thyA3074157c.315G>C1.000
thyA3074160c.312T>C1.000
thyA3074165p.Ala103Thr1.000
thyA3074166c.306C>G1.000
thyA3074172c.300C>G1.000
thyA3074175c.297T>C1.000
thyA3074181c.291T>C1.000
thyA3074184c.288T>C1.000
thyA3074195p.Ile93Val1.000
thyA3074196c.276C>T1.000
thyA3074199c.273C>A1.000
thyA3074205p.Glu89Asp1.000
thyA3074211c.261T>G1.000
thyA3074214c.258A>G1.000
thyA3074217c.255A>G1.000
thyA3074244c.228T>G1.000
thyA3074250c.222C>T1.000
thyA3074263p.Gly70Ala1.000
thyA3074267p.Ile69Val1.000
thyA3074268c.204A>G1.000
thyA3074274c.198A>G1.000
thyA3074285c.187A>G1.000
thyA3074286c.186A>G1.000
thyA3074305p.Ala56Val1.000
thyA3074307c.165T>C1.000
thyA3074313c.159T>C1.000
thyA3074322c.150G>C1.000
thyA3074325c.147T>C1.000
thyA3074334c.138A>G1.000
thyA3074349c.123A>G1.000
thyA3074360c.112A>G1.000
thyA3074361c.111A>G1.000
thyA3074364c.108A>G1.000
thyA3074397c.75T>G1.000
thyA3074415c.57G>C1.000
thyA3074418c.54T>C1.000
thyA3074423p.Pro17Ala1.000
thyA3074426p.Thr16Ala1.000
thyA3074433c.39T>C1.000
thyA3074444p.Phe10Leu1.000
thyA3074463c.9T>G1.000
thyA3074470p.Val1Ala1.000
ald3087183p.Thr122Ala1.000
ald3087195p.Ala126Thr1.000
ald3087200c.381A>G1.000
ald3087203c.384C>G1.000
ald3087209c.390T>G1.000
ald3087224c.405A>G1.000
ald3087233c.414T>C1.000
ald3087236c.417A>G1.000
ald3087240p.Ala141Ser0.938
ald3087251c.432T>C1.000
ald3087254c.435C>G1.000
ald3087257c.438T>C1.000
ald3087260c.441C>T1.000
ald3087272c.453A>G1.000
ald3087281c.462G>C1.000
ald3087284c.465C>G1.000
ald3087290c.471T>C1.000
ald3087311c.492C>G1.000
ald3087318p.Glu167Lys1.000
ald3087321p.Pro168Ala1.000
ald3087368c.549A>C1.000
ald3087375p.Ile186Val1.000
ald3087381p.Asn188Gly1.000
ald3087392c.573C>G1.000
ald3087423p.Asp202Asn1.000
ald3087428c.609A>G1.000
ald3087431c.612T>G1.000
ald3087436p.Gln206Leu1.000
ald3087446c.627C>G1.000
ald3087453p.Cys212Gly1.000
ald3087465p.His216Gly1.000
ald3087470c.651T>C1.000
ald3087479c.660A>G1.000
ald3087485c.666C>G1.000
ald3087497c.678G>A1.000
ald3087500c.681T>C1.000
ald3087509c.690A>G1.000
ald3087512c.693T>C1.000
ald3087527c.708T>C1.000
ald3087530c.711G>C1.000
ald3087545c.726A>C1.000
ald3087557c.738A>T1.000
ald3087562p.Lys248Thr1.000
ald3087564c.745T>C1.000
ald3087567p.Val250Ile1.000
ald3087578c.759A>G1.000
ald3087587c.768G>A1.000
ald3087590p.His257Gln1.000
ald3087596c.777A>G1.000
ald3087599c.780A>G1.000
ald3087602c.783T>C1.000
ald3087608c.789A>G1.000
ald3087617c.798T>C1.000
ald3087620c.801A>C1.000
ald3087621p.Ala268Ser1.000
ald3087641c.822T>C1.000
ald3087647c.828A>G1.000
ald3087649p.Gly277Asp1.000
ald3087653c.834A>C1.000
ald3087656c.837A>G0.979
ald3087659c.840G>C1.000
ald3087666p.Tyr283His1.000
ald3087671c.852C>T0.983
ald3087698c.879G>C1.000
ald3087704c.885T>C1.000
ald3087726p.Ala303Ser1.000
ald3087729p.Ser304Ala1.000
ald3087751p.Tyr311Phe1.000
ald3087779c.960T>C1.000
ald3087786p.Glu323Lys1.000
ald3087791c.972T>C1.000
ald3087800c.981T>C1.000
ald3087809c.990G>A1.000
ald3087815c.996G>A1.000
ald3087825p.Asn336Asp1.000
ald3087830c.1011G>C1.000
ald3087833c.1014A>T1.000
ald3087836c.1017A>G1.000
ald3087840p.Lys341His1.000
ald3087845c.1026T>G1.000
ald3087860p.Glu347Asp1.000
ald3087867c.1048T>C1.000
ald3087888p.Thr357Ala1.000
ald3087896c.1077G>C1.000
ald3087899c.1080G>C1.000
ald3087900p.Val361Leu1.000
ald3087907p.Phe363Cys1.000
ald3087914p.Glu365Asp1.000
ald3087917c.1098C>G1.000
ald3087927c.1108C>T1.000
fbiA3640291c.-252T>C1.000
fbiA3640301c.-242GTTAAC>G1.000
fbiA3640307c.-236C>A1.000
fbiA3640347c.-196A>G1.000
fbiA3640350c.-193C>T1.000
fbiA3640357c.-186G>A1.000
fbiA3640365c.-178C>G1.000
fbiA3640378c.-165A>T1.000
fbiA3640560c.18G>C1.000
fbiA3640562p.Ala7Val1.000
fbiA3640566c.24T>C1.000
fbiA3640569c.27A>G1.000
fbiA3640593c.51C>G1.000
fbiA3640604p.Gln21Arg1.000
fbiA3640614c.72C>G1.000
fbiA3640620c.78C>T1.000
fbiA3640701c.159C>T1.000
fbiA3640713c.171T>C1.000
fbiA3640719c.177C>T1.000
fbiA3640726c.184C>T1.000
fbiA3640797c.255T>C1.000
fbiA3640808p.Met89Lys1.000
fbiA3640810p.Gln90Glu1.000
fbiA3640816c.274C>T1.000
fbiA3640820p.Val93Ala1.000
fbiA3640827c.285T>C1.000
fbiA3640833c.291G>C1.000
fbiA3640839c.297C>G1.000
fbiA3640850p.Glu103Ala1.000
fbiA3640854c.312C>G1.000
fbiA3640857c.315G>C0.980
fbiA3640866c.324T>C1.000
fbiA3640901p.Gln120Arg1.000
fbiA3640911c.369C>T1.000
fbiA3640914c.372C>G1.000
fbiA3640917c.375G>A1.000
fbiA3640920c.378A>G1.000
fbiA3640930p.Glu130Thr1.000
fbiA3640935c.393C>G1.000
fbiA3640938c.396A>G1.000
fbiA3640944c.402T>C1.000
fbiA3640962c.420C>T0.950
fbiA3640965c.423C>G1.000
fbiA3640966c.424T>C1.000
fbiA3640974c.432T>G1.000
fbiA3640979p.Thr146Ser1.000
fbiA3640983c.441C>T1.000
fbiA3640989c.447T>C1.000
fbiA3640995c.453A>G1.000
fbiA3640998c.456C>A1.000
fbiA3641001c.459T>C1.000
fbiA3641004c.462A>G1.000
fbiA3641016c.474C>T1.000
fbiA3641021p.Val160Ala1.000
fbiA3641028p.Glu162Asp1.000
fbiA3641029p.Ser163Gly1.000
fbiA3641034c.492C>T1.000
fbiA3641035p.Lys165Arg1.000
fbiA3641040c.498G>A1.000
fbiA3641046c.504T>C1.000
fbiA3641049c.507T>C1.000
fbiA3641073c.531T>G1.000
fbiA3641097c.555T>C1.000
fbiA3641100c.558T>A1.000
fbiA3641103c.561T>C1.000
fbiA3641112c.570T>C1.000
fbiA3641118p.Lys192Asn1.000
fbiA3641119p.Ser193Ala1.000
fbiA3641127c.585T>C1.000
fbiA3641128p.Ala196Thr1.000
fbiA3641140p.Ile200Val1.000
fbiA3641149p.Leu203Ile1.000
fbiA3641164p.Ile208Val1.000
fbiA3641170p.Met210Leu1.000
fbiA3641184c.642T>C1.000
fbiA3641187c.645T>C1.000
fbiA3641200p.Ile220Val1.000
fbiA3641220c.678C>G1.000
fbiA3641226c.684G>C1.000
fbiA3641234p.Ala231Gly1.000
fbiA3641244c.702G>T1.000
fbiA3641246p.Glu235Ala1.000
fbiA3641256c.714A>C1.000
fbiA3641260p.Ile240Val1.000
fbiA3641286c.744C>T0.960
fbiA3641288p.Glu249Gly1.000
fbiA3641314p.Thr258Ala1.000
fbiA3641328c.786T>G1.000
fbiA3641337c.795G>C1.000
fbiA3641338p.Asp266Lys1.000
fbiA3641351p.Ala270Glu1.000
fbiA3641355c.813T>G1.000
fbiA3641358c.816G>C1.000
fbiA3641367c.825C>T1.000
fbiA3641373c.831C>G1.000
fbiA3641379c.837G>C1.000
fbiA3641380p.Cys280Arg1.000
fbiA3641400c.858C>T1.000
alr3840204p.Glu406Ala1.000
alr3840215c.1206A>G1.000
alr3840221c.1200C>T1.000
alr3840230c.1191A>C1.000
alr3840233c.1188T>C1.000
alr3840236c.1185T>G1.000
alr3840239c.1182C>G1.000
alr3840244p.Ser393Gly1.000
alr3840248c.1173G>C1.000
alr3840274p.Val383Leu1.000
alr3840275c.1146A>C1.000
alr3840278c.1143A>G1.000
alr3840287c.1134G>A1.000
alr3840293c.1128A>C1.000
alr3840296c.1125C>G1.000
alr3840305c.1116A>G1.000
alr3840310p.Arg371Ala1.000
alr3840312p.Ile370Thr1.000
alr3840328c.1093A>G1.000
alr3840329c.1092A>G1.000
alr3840358p.Leu355Val1.000
alr3840360p.Pro354Gln1.000
alr3840382p.Met347Leu1.000
alr3840407c.1014C>G1.000
alr3840418p.Cys335Arg1.000
alr3840419c.1002T>C1.000
alr3840424p.Arg333Gly1.000
alr3840460p.Ser321Thr1.000
alr3840476c.945T>C1.000
alr3840482c.939A>G1.000
alr3840512c.909G>A1.000
alr3840517p.Pro302Asp1.000
alr3840518c.903C>G1.000
alr3840523p.Ile300Val1.000
alr3840527c.894T>G1.000
alr3840533c.888C>T1.000
alr3840539c.882C>G1.000
alr3840551c.870C>G1.000
alr3840556p.Ala289Thr1.000
alr3840557c.864A>C1.000
alr3840562p.Ile287Val1.000
alr3840575c.846C>T1.000
alr3840578c.843A>G1.000
alr3840584c.837A>G1.000
alr3840593c.828G>C1.000
alr3840607p.Val272Ile1.000
alr3840627p.Ala265Gly1.000
alr3840632c.789T>C1.000
alr3840635c.786C>G1.000
alr3840641c.780T>C1.000
alr3840644c.777C>G1.000
alr3840647c.774A>G1.000
alr3840662c.759C>G1.000
alr3840682p.Thr247Ala1.000
alr3840794c.627A>G1.000
alr3840797c.624G>A1.000
alr3840802p.Ile207Phe1.000
alr3840805p.Ser206Pro1.000
alr3840808p.Asp205Asn1.000
alr3840817p.Lys202Gln1.000
alr3840827c.594A>C1.000
alr3840833c.588A>G1.000
alr3840848c.573C>A1.000
alr3840859p.Val188Ile1.000
alr3840860c.561G>C1.000
alr3840874p.Met183Val1.000
alr3840879p.Gln181Leu1.000
alr3840886c.535T>C1.000
alr3840899c.522G>C1.000
alr3840909p.Gln171Leu1.000
alr3840918p.Gly168Ala1.000
alr3840920c.501C>G1.000
alr3840926c.495A>G1.000
alr3840941c.480G>C1.000
alr3840944c.477A>G1.000
alr3840959c.462C>G1.000
alr3840971c.450C>G1.000
alr3840974c.447G>T1.000
alr3840994p.His143Asp1.000
alr3840997c.424A>G1.000
alr3841001c.420T>C1.000
alr3841010c.411T>C1.000
alr3841013c.408G>A1.000
alr3841018p.Leu135Val0.969
alr3841028c.393C>G1.000
alr3841033p.Val130Ile1.000
alr3841036p.Gln129Glu1.000
alr3841055c.366G>C1.000
alr3841064c.357G>A1.000
alr3841096p.Val109Ile1.000
alr3841100c.321T>G1.000
alr3841106c.315A>G1.000
alr3841109c.312G>T1.000
alr3841112c.309A>G1.000
alr3841115c.306A>G1.000
alr3841127c.294T>C1.000
alr3841130c.291C>T1.000
alr3841133c.288C>T1.000
alr3841154c.267G>C1.000
alr3841157c.264T>C1.000
alr3841166c.255A>T1.000
alr3841229c.192C>G1.000
alr3841232c.189C>G1.000
alr3841240p.Leu61Val1.000
alr3841242p.Gln60Pro1.000
alr3841249p.His58Ser1.000
alr3841262c.159A>G1.000
alr3841274c.147C>G1.000
panD4043927p.His119Asp1.000
panD4043933p.Met117Leu1.000
panD4043943c.339T>C1.000
panD4043951p.Tyr111Asp1.000
panD4043952c.330A>G1.000
panD4043961c.321A>G1.000
panD4044024c.258A>G1.000
panD4044036c.246C>A1.000
panD4044045c.237C>A1.000
panD4044050c.232C>G1.000
panD4044051c.231G>A1.000
panD4044057c.225G>T1.000
panD4044072c.210G>T0.963
panD4044075c.207A>G1.000
panD4044080p.Val68Met1.000
panD4044081c.201A>C1.000
panD4044085p.Ser66Thr1.000
panD4044093c.189T>C1.000
panD4044120c.162T>G1.000
panD4044123c.159A>G1.000
panD4044126c.156A>G1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044159c.123G>A1.000
panD4044162c.120T>C1.000
panD4044165c.117C>G1.000
panD4044188c.94A>G1.000
panD4044195c.87A>G1.000
panD4044237c.45C>G1.000
panD4044240c.42C>G1.000
panD4044264c.18C>G1.000
panD4044270c.12C>G1.000
embC4239994c.132C>G1.000
embC4240006c.144A>G1.000
embC4240033c.171G>C1.000
embC4240048c.186C>G1.000
embC4240051c.189A>G1.000
embC4240065p.Ala68Glu1.000
embC4240069c.207T>C1.000
embC4240078c.216A>G1.000
embC4240090c.228C>G1.000
embC4240105c.243C>T1.000
embC4240111c.249C>T1.000
embC4240120c.258C>G1.000
embC4240141c.279A>G1.000
embC4240178c.316T>C1.000
embC4240183c.321A>G1.000
embC4240201c.339G>C1.000
embC4240204c.342T>G1.000
embC4240211p.Val117Ile1.000
embC4240216c.354T>C1.000
embC4240228c.366G>C1.000
embC4240229p.Leu123Ile1.000
embC4240234c.372A>G1.000
embC4240237c.375G>C1.000
embC4240258c.396T>G1.000
embC4240264c.402G>C1.000
embC4240267c.405T>C1.000
embC4240270c.408T>C1.000
embC4240273c.411C>T1.000
embC4240277p.Leu139Val1.000
embC4240292c.430C>T1.000
embC4240297c.435T>C1.000
embC4240313p.Thr151Ala1.000
embC4240318c.456T>C1.000
embC4240325c.463T>C1.000
embC4240330c.468A>G1.000
embC4240348c.486T>C1.000
embC4240355p.Ala165Thr0.560
embC4240372c.510A>G1.000
embC4240376p.Val172Thr1.000
embC4240381c.519G>A1.000
embC4240384c.522A>G1.000
embC4240390c.528T>C1.000
embC4240393c.531T>C1.000
embC4240399c.537C>T1.000
embC4240405c.543T>C1.000
embC4240406p.Ala182Ser1.000
embC4240424p.Arg188Lys1.000
embC4240450c.588G>A1.000
embC4240459c.597G>C1.000
embC4240471c.609C>T1.000
embC4240543c.681G>C1.000
embC4240553p.Met231Leu1.000
embC4240561c.699C>G1.000
embC4240632p.Met257Thr1.000
embC4240642c.780G>C1.000
embC4240655p.Ala265Pro1.000
embC4240660c.798C>T1.000
embC4240669c.807G>C1.000
embC4240671p.Thr270Ile1.000
embC4240685p.Thr275Gly1.000
embC4240690c.828G>C1.000
embC4240693c.831T>C1.000
embC4240726c.864G>C1.000
embC4240780c.918T>C1.000
embC4240783c.921G>C1.000
embC4240786c.924C>T1.000
embC4240789c.927T>C1.000
embC4240807c.945C>T1.000
embC4240816c.954C>T1.000
embC4240819c.957A>G1.000
embC4240828c.966G>C1.000
embC4240831c.969T>G1.000
embC4240858c.996G>C1.000
embC4240867c.1005T>A1.000
embC4240870c.1008T>C1.000
embC4240879c.1017G>C1.000
embC4240885c.1023T>C1.000
embC4240897c.1035C>G1.000
embC4240898c.1036C>T1.000
embC4240911p.Ala350Val1.000
embC4240921c.1059C>G1.000
embC4240936c.1074A>G1.000
embC4240957c.1095C>G1.000
embC4240960c.1098G>C1.000
embC4240966c.1104G>T1.000
embC4240969c.1107C>T1.000
embC4240979p.Thr373Gln1.000
embC4240990c.1128A>C1.000
embC4241002c.1140G>C1.000
embC4241017c.1155T>C1.000
embC4241023c.1161T>G1.000
embC4241050c.1188T>G1.000
embC4241071c.1209C>G1.000
embC4241095c.1233C>T1.000
embC4241107c.1245G>C1.000
embC4241140c.1278A>G1.000
embC4241158c.1296T>C1.000
embC4241162c.1300T>C1.000
embC4241167c.1305C>G1.000
embC4241203c.1341T>C1.000
embC4241230c.1368A>G1.000
embC4241374c.1512T>C1.000
embC4241380c.1518A>C1.000
embC4241394p.Lys511Ser1.000
embC4241411p.Ile517Leu1.000
embC4241449c.1587C>A1.000
embC4241455c.1593C>T1.000
embC4241470c.1608C>G1.000
embC4241479c.1617C>G0.680
embC4241496p.Ala545Gly1.000
embC4241498p.Val546Ile1.000
embC4241501p.Ser547Thr1.000
embC4241518c.1656A>G1.000
embC4241521c.1659T>C1.000
embC4241530c.1668C>A1.000
embC4241536c.1674A>G1.000
embC4241539c.1677T>C1.000
embC4241542c.1680C>G1.000
embC4241545c.1683T>G1.000
embC4241548c.1686T>C1.000
embC4241551c.1689A>G1.000
embC4241567p.Ile569Val1.000
embC4241572c.1710C>G1.000
embC4241995c.2133C>G1.000
embC4241996p.Thr712Ala1.000
embC4242002p.Leu714Ala1.000
embC4242011p.Leu717Ile1.000
embC4242024p.Val721Ala1.000
embC4242036p.Gln725Leu1.000
embC4242045p.Ile728Thr1.000
embC4242047p.Ser729Ala1.000
embC4242058c.2196G>C1.000
embC4242061c.2199G>A1.000
embC4242070c.2208T>G1.000
embC4242079c.2217T>C1.000
embC4242085c.2223A>G1.000
embC4242092c.2230T>C1.000
embC4242100c.2238C>T1.000
embC4242101p.Lys747Arg1.000
embC4242104p.Thr748Ser1.000
embC4242121c.2259A>G1.000
embC4242128p.Leu756Met1.000
embC4242138p.Leu759Pro1.000
embC4242148c.2286C>T1.000
embC4242151c.2289A>C1.000
embC4242158c.2296C>T0.947
embC4242161p.Ala767Pro0.946
embC4242171p.Thr770Ser0.850
embC4242176p.Pro772Ser0.897
embC4242179p.Leu773Val0.902
embC4242199c.2337C>G1.000
embC4242202c.2340C>T1.000
embC4242203c.2341C>T1.000
embC4242208c.2346T>G1.000
embC4242217c.2355C>T1.000
embC4242220c.2358A>C1.000
embC4242245p.Thr795Arg1.000
embC4242265c.2403A>G1.000
embC4242271c.2409A>G1.000
embC4242274c.2412G>C1.000
embC4242277c.2415T>C1.000
embC4242280c.2418C>T1.000
embC4242283c.2421T>C1.000
embC4242286c.2424C>T1.000
embC4242287p.Leu809Ile1.000
embC4242299p.Gly813Arg1.000
embC4242394c.2532C>T1.000
embC4242397c.2535G>C1.000
embC4242400c.2538C>G1.000
embC4242403c.2541T>C1.000
embC4242406c.2544A>G1.000
embC4242409c.2547G>T1.000
embC4242427c.2565A>G1.000
embC4242428p.Ala856Ser1.000
embC4242434p.Val858Ile1.000
embC4242449p.Met863Arg1.000
embC4242479p.Thr873Ala1.000
embC4242498p.Arg879Lys0.923
embC4242517c.2655G>C1.000
embC4242519p.Thr886Ser1.000
embC4242529c.2667G>C1.000
embC4242532c.2670A>C1.000
embC4242539p.Ser893Pro1.000
embC4242552p.Arg897Gln1.000
embC4242554p.Leu898Val1.000
embC4242625c.2763T>G1.000
embC4242629p.Ala923Ser1.000
embC4242647c.2785C>T1.000
embC4242652c.2790C>G1.000
embC4242653p.Ala931Leu1.000
embC4242658c.2796A>G1.000
embC4242667c.2805C>G1.000
embC4242674p.Ser938Ala1.000
embC4242688c.2826G>A1.000
embC4242689p.Val943Ile1.000
embC4242694c.2832G>C1.000
embC4242695c.2833T>C1.000
embC4242710p.Gln950Glu1.000
embC4242715c.2853T>C1.000
embC4242739c.2877C>G1.000
embC4242742c.2880C>T1.000
embC4242745c.2883A>C1.000
embC4242748c.2886A>G1.000
embC4242764p.Val968Leu1.000
embC4242779p.Asn973Asp1.000
embC4242787c.2925G>C1.000
embC4242789c.2928 2929insTT1.000
embA4243216c.-17G>C1.000
embA4243251p.Glu7Gln1.000
embA4243290p.Ser20Ala1.000
embA4243304c.72T>A1.000
embA4243305c.73C>T1.000
embA4243311c.79C>T1.000
embA4243318p.Gly29Ala1.000
embA4243321p.Ile30Thr1.000
embA4243340c.108G>C1.000
embA4243343p.Asn37Lys1.000
embA4243346c.114A>G1.000
embA4243356p.Thr42Ala1.000
embA4243359p.Ile43Val1.000
embA4243362p.Phe44Leu1.000
embA4243370c.138G>C1.000
embA4243374c.143 145del1.000
embA4243391c.159C>G1.000
embA4243392p.Asn54His1.000
embA4243395p.Ile55Val1.000
embA4243415c.183T>G1.000
embA4243418c.186G>C1.000
embA4243421c.189A>G1.000
embA4243433c.201A>G1.000
embA4243442c.210G>C1.000
embA4243589c.357C>G1.000
embA4243722p.Pro164Ser1.000
embA4243733c.501G>A1.000
embA4243742c.510T>C1.000
embA4243748c.516C>G1.000
embA4243751c.519C>T1.000
embA4244027c.795T>C1.000
embA4244048c.816C>G1.000
embA4244051c.819T>C1.000
embA4244061p.Leu277Asn1.000
embA4244070p.Val280Ile1.000
embA4244084c.852C>G1.000
embA4244099c.867T>C1.000
embA4244102c.870A>C1.000
embA4244111c.879C>T1.000
embA4244117c.885G>C1.000
embA4244120c.888T>C1.000
embA4244126c.894C>G1.000
embA4244135p.Glu301Asp1.000
embA4244156c.924A>C1.000
embA4244158c.927 928insGG1.000
embB4246600c.87G>C1.000
embB4246603c.90C>G1.000
embB4246606c.93C>G1.000
embB4246621c.108T>C1.000
embB4246624c.111C>G1.000
embB4246627c.114T>C0.968
embB4246639c.126G>C1.000
embB4246642c.129G>C1.000
embB4246654c.141G>A1.000
embB4246675c.162G>A1.000
embB4246804c.291G>C1.000
embB4246811p.Gly100Ser1.000
embB4246826p.Gln105Lys1.000
embB4246849p.Gln112His1.000
embB4246853c.340T>C1.000
embB4246869p.Ser119Asn1.000
embB4246872p.Ala120Gly1.000
embB4246882c.369G>C1.000
embB4247065c.552G>A1.000
embB4247068c.555T>C1.000
embB4247074c.561G>C1.000
embB4247077c.564G>A1.000
embB4247086c.573C>T1.000
embB4247095c.582G>T1.000
embB4247098c.585C>G1.000
embB4247104c.591G>T1.000
embB4247109p.Gly199Glu1.000
embB4247114p.Ala201Arg1.000
embB4247117p.Val202Leu1.000
embB4247137c.624C>G1.000
embB4247150p.Arg213Thr1.000
embB4247158c.645C>G1.000
embB4247173c.660G>C1.000
embB4247179p.Ile222Met1.000
embB4247180p.Ile223Val1.000
embB4247185c.672G>C1.000
embB4247195p.Ala228Ser1.000
embB4247201p.Val230Ile0.933
embB4247209c.696A>G1.000
embB4247213p.Ile234Val1.000
embB4247219c.706T>C1.000
embB4247230c.717G>C1.000
embB4247237c.724T>C1.000
embB4247365c.852A>C1.000
embB4247371c.858C>G1.000
embB4247380c.867C>G1.000
embB4247389c.876C>G1.000
embB4247404c.891G>C1.000
embB4247407c.894G>C1.000
embB4247437c.924A>G1.000
embB4247470c.957T>C1.000
embB4247491c.978G>C1.000
embB4247497c.984T>C1.000
embB4247500c.987C>G0.950
embB4247512c.999T>C1.000
embB4247539c.1026T>C1.000
embB4247550p.Ala346Asp1.000
embB4247554c.1041T>C1.000
embB4247566c.1053C>G1.000
embB4247567c.1054C>T1.000
embB4247572c.1059A>C1.000
embB4247590c.1077A>G1.000
embB4247602c.1089G>A1.000
embB4247629c.1116C>G1.000
embB4247632c.1119C>G1.000
embB4247645p.Glu378Thr1.000
embB4247650c.1137C>G1.000
embB4247656c.1143A>G1.000
embB4247657p.Pro382Ala1.000
embB4247662c.1149C>G1.000
embB4247674c.1161G>C0.976
embB4247684c.1171T>C1.000
embB4247719c.1206G>T0.743
embB4247722c.1209G>C0.743
embB4247725c.1212G>C1.000
embB4247729p.Gly406Pro0.962
embB4247746c.1233C>T1.000
embB4247749c.1236G>A1.000
embB4247760p.Tyr416Trp1.000
embB4247776c.1263G>C1.000
embB4247779c.1266C>G1.000
embB4247783p.Arg424Cys1.000
embB4247787p.Tyr425Cys1.000
embB4247789c.1276A>T1.000
embB4247797c.1284C>G1.000
embB4247800c.1287A>G1.000
embB4247816p.Val435Ile1.000
embB4247821c.1308T>C1.000
embB4247827c.1314C>G1.000
embB4247830c.1317A>G1.000
embB4247836c.1323A>C1.000
embB4247842c.1329T>C1.000
embB4247857c.1344C>G1.000
embB4247881c.1368G>C1.000
embB4247887c.1374C>T1.000
embB4247893c.1380C>T1.000
embB4247897p.Met462Val1.000
embB4247905c.1392G>A1.000
embB4247914c.1401G>C1.000
embB4247916p.Arg468His1.000
embB4247920c.1407T>C1.000
embB4247940p.Leu476Trp1.000
embB4247945c.1432T>C1.000
embB4247951p.Ser480Ala1.000
embB4247957p.Met482Leu1.000
embB4247965c.1452C>G1.000
embB4247971c.1458C>T1.000
embB4247972p.Thr487Ser1.000
embB4247983c.1470G>C1.000
embB4248007c.1494C>T1.000
embB4248011p.Ser500Arg1.000
embB4248014p.Thr501Ala1.000
embB4248035p.Val508Ile1.000
embB4248041p.Ala510Asn1.000
embB4248044p.Lys511Glu1.000
embB4248055c.1542G>C1.000
embB4248070c.1557T>C1.000
embB4248085c.1572T>C1.000
embB4248118c.1605T>C1.000
embB4248121c.1608G>A1.000
embB4248133c.1620C>A0.964
embB4248143c.1630T>C1.000
embB4248157c.1644A>C1.000
embB4248173p.Val554Met1.000
embB4248178c.1665C>T1.000
embB4248206p.Ser565Gly1.000
embB4248220c.1707A>G1.000
embB4248252p.Gly580Ala1.000
embB4248277c.1764G>C1.000
embB4248283c.1770C>G1.000
embB4248316c.1803C>G1.000
embB4248319c.1806A>G1.000
embB4248322c.1809G>T1.000
embB4248343c.1830G>C1.000
embB4248349c.1836G>C1.000
embB4248350c.1837T>C1.000
embB4248355c.1842A>C1.000
embB4248358c.1845C>G1.000
embB4248361c.1848A>G1.000
embB4248362p.Ser617Lys1.000
embB4248382c.1869C>T1.000
embB4248397c.1884C>T1.000
embB4248398c.1885C>T1.000
embB4248406c.1893G>C1.000
embB4248407c.1894T>C1.000
embB4248412p.Phe633Leu1.000
embB4248416c.1903C>T1.000
embB4248419p.Leu636Met1.000
embB4248425c.1912T>C1.000
embB4248430c.1917T>C1.000
embB4248432p.Trp640Phe1.000
embB4248457c.1944T>C1.000
embB4248472c.1959T>C1.000
embB4248499c.1986G>A1.000
embB4248504p.Asp664Gly1.000
embB4248508c.1995G>A1.000
embB4248514c.2001A>C1.000
embB4248515p.Val668Ile1.000
embB4248534p.Ala674Val1.000
embB4248541c.2028T>C1.000
embB4248649c.2136T>G1.000
embB4248659p.Ala716Leu1.000
embB4248676c.2163C>G1.000
embB4248694c.2181G>C1.000
embB4248697c.2184A>T1.000
embB4248725p.Ser738Ala1.000
embB4248731p.Val740Leu1.000
embB4248738p.Ala742Glu1.000
embB4248742c.2229T>C1.000
embB4248744p.Val744Ala1.000
embB4248748c.2235C>G1.000
embB4248757c.2244A>C1.000
embB4248763c.2250C>A1.000
embB4248766c.2253C>T1.000
embB4248772c.2259A>G1.000
embB4248874c.2361C>A1.000
embB4248889c.2376C>G1.000
embB4248892c.2379A>G1.000
embB4248904c.2391G>C1.000
embB4248907c.2394G>C1.000
embB4248917p.Ile802Val1.000
embB4248920p.Val803Arg1.000
embB4248927p.Lys805Thr1.000
embB4249354c.2841G>C1.000
embB4249369c.2856T>C1.000
embB4249375c.2862G>C1.000
embB4249381c.2868A>G1.000
embB4249387c.2874G>A1.000
embB4249417c.2904A>G1.000
embB4249420c.2907G>C1.000
embB4249423p.Asp970Glu1.000
embB4249432c.2919A>G1.000
embB4249441c.2928A>G1.000
embB4249444c.2931T>C1.000
embB4249447c.2934G>C1.000
embB4249454p.Thr981Ser1.000
embB4249459c.2946G>A1.000
embB4249486c.2973T>G1.000
embB4249487c.2974T>C1.000
embB4249498c.2985G>C1.000
embB4249504c.2991G>A0.920
embB4249521p.Ala1003Val1.000
embB4249525c.3012T>C1.000
embB4249529p.Ile1006Val1.000
embB4249532p.Ala1007Thr1.000
embB4249537c.3024A>G1.000
embB4249543c.3030G>C1.000
embB4249558c.3045A>C1.000
embB4249573c.3060T>C1.000
embB4249580p.Leu1023Met1.000
embB4249594c.3081G>C1.000
embB4249600c.3087A>G1.000
embB4249609c.3096T>C1.000
embB4249627c.3114G>C1.000
embB4249640c.3127T>C1.000
embB4249661p.Ala1050Ser1.000
embB4249666c.3153C>G1.000
embB4249675c.3162C>T1.000
embB4249686p.Ala1058Gly1.000
embB4249690c.3177C>T1.000
embB4249693c.3180T>C1.000
embB4249699c.3186T>G1.000
embB4249702c.3189C>G1.000
embB4249726c.3213C>G1.000
embB4249727p.Asp1072Asn1.000
embB4249733p.Pro1074Glu1.000
embB4249744c.3231G>A1.000
embB4249750p.Glu1079Asp1.000
embB4249751c.3238T>C1.000
ethA4326043c.1431A>G1.000
ethA4326067c.1407C>T1.000
ethA4326847c.627G>C1.000
ethA4327396c.78A>G1.000
ethA4327420c.54G>A1.000
ethA4327423c.51G>C1.000
ethA4327426c.48A>G1.000
ethA4327435c.39T>G1.000
ethA4327438c.36A>G1.000
ethA4327453c.21A>G1.000
ethA4327468c.6G>A1.000
ethA4327476c.-3T>C1.000
ethA4327477c.-4A>C1.000
ethA4327483c.-10G>A1.000
ethR4327695c.147T>C1.000
ethR4327713c.165T>C1.000
ethR4327714p.Ile56Leu1.000
ethR4327720c.172A>C0.917
ethR4328181c.633T>C1.000
gid4407619p.Tyr195Cys1.000
gid4407654c.549C>G1.000
gid4407663c.540T>C1.000
gid4407668p.Ile179Ala1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;