TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d1231f0630c1
Sample: 5d1231f0630c1

Download results

Summary
ID: 5d1231f0630c1
Date: Tue Jun 25 15:42:03 2019
Strain: root
Drug-resistance: Drug-resistant

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
RifampicinRrpoB p.His445Tyr (0.23), rpoB p.Leu464Met (1.00)
Ethambutol
Pyrazinamide
StreptomycinRrrs r.888g>a (0.62)
Ethionamide
Fluoroquinolones
AmikacinRrrs r.1484g>t (0.33)
CapreomycinRrrs r.1484g>t (0.33)
KanamycinRrrs r.1484g>t (0.33)

Lineage2FamilyMain SpoligotypeRDS

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6170p.His311Thr1.000
gyrB6175c.936G>A1.000
gyrB6183p.Thr315Met1.000
gyrB6190c.951A>G1.000
gyrA7832c.531G>A1.000
gyrA7835c.534A>C1.000
gyrA7837p.Gly179Glu1.000
gyrA7847c.546G>C1.000
gyrA7859c.558A>C0.500
gyrA7862c.561C>G0.833
gyrA7863p.Asn188Arg1.000
rpoB760607c.801G>T1.000
rpoB760611c.805T>C1.000
rpoB760643c.837G>A0.818
rpoB760997c.1191G>C1.000
rpoB761015c.1209G>C0.988
rpoB761021c.1215G>C0.953
rpoB761027c.1221A>G1.000
rpoB761031p.Gln409Asn0.952
rpoB761036c.1230G>C0.207
rpoB761037c.1231T>C1.000
rpoB761054c.1248G>C0.195
rpoB761058p.Val418Thr0.961
rpoB761088c.1282A>T1.000
rpoB761102c.1296A>G1.000
rpoB761127p.Ser441Ala0.993
rpoB761132c.1326G>T1.000
rpoB761133c.1327T>C1.000
rpoB761154c.1348T>A0.955
rpoB761159c.1353G>C1.000
rpoB761165c.1359G>C1.000
rpoB761180c.1374A>C1.000
rpoB761189c.1383T>C1.000
rpoB761193p.Gly463Ser1.000
rpoB761213c.1407G>C1.000
rpoB761217p.Pro471Thr0.980
rpoB761231c.1425C>G1.000
rpoB761234c.1428G>C1.000
rpoB761243c.1437G>C0.979
rpoB761249c.1443A>G0.971
rpoB761250p.Thr482Ser1.000
rpoB761261c.1455G>C1.000
rpoB761273c.1467T>C0.967
rpoB761276c.1470G>C0.967
rpoB761534c.1728G>C1.000
rpoB761537c.1731C>G0.958
rpoB761557p.Ala584Gly0.947
rpoB761562p.Ala586Ser0.947
rpoB761565p.Met587Leu1.000
rpoB761570c.1764T>C0.952
rpoB761573c.1767C>G0.894
rpoB761579c.1773G>C1.000
rpoB761600c.1794T>C0.894
rpoB761612c.1806G>C1.000
rpoB761615c.1809A>C1.000
rpoB761633c.1827G>C1.000
rpoB761642c.1836G>C0.921
rpoB761643p.Val613Ile1.000
rpoB761648c.1842T>C1.000
rpoB761649p.Ser615Pro1.000
rpoB761654p.Glu616Asp1.000
rpoB761672c.1866C>G1.000
rpoB761675c.1869G>C1.000
rpoB761933c.2127G>C0.174
rpoB761937p.Lys711Gln0.840
rpoB761945c.2139G>C0.840
rpoB761948c.2142G>C0.160
rpoB761951c.2145G>C0.960
rpoB761955p.Ile717Tyr1.000
rpoB761961p.Pro719Thr1.000
rpoB761974p.His723Leu1.000
rpoB761990c.2184G>C1.000
rpoB761997p.Leu731Val0.869
rpoB762003p.Asn733Gln0.971
rpoB762009p.Leu735Val0.912
rpoB762016p.Glu737Ala0.800
rpoB762024p.Val740Met0.977
rpoB762053c.2247T>C1.000
rpoB762057p.Ile751Val0.995
rpoB762062c.2256T>C1.000
rpoB762065c.2259T>C1.000
rpoB762083c.2277T>C0.836
rpoB762086c.2280G>C0.871
rpoB762110c.2304G>C1.000
rpoB762114p.Ile770Val1.000
rpoB762122p.Asp772Glu1.000
rpoB762125c.2319G>A1.000
rpoB762126p.Val774Ser1.000
rpoB762134c.2328C>T0.225
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>C1.000
rpoB762156p.Val784Ile1.000
rpoB762167c.2361T>C0.629
rpoB762173c.2367G>A0.371
rpoB762176c.2370T>C1.000
rpoB762177p.Arg791Thr0.686
rpoB762180p.Asp792Thr0.297
rpoB762185c.2379G>C1.000
rpoB762188c.2382C>T0.189
rpoB762194c.2388G>C0.964
rpoB762197c.2391C>G0.220
rpoB762200c.2394C>T0.388
rpoB762206c.2400C>G0.472
rpoB762209c.2403C>G0.207
rpoB762212c.2406G>C0.298
rpoB762218c.2412T>C0.921
rpoB762233c.2427G>C0.511
rpoB762234p.Pro810Ser0.484
rpoB762239c.2433G>A0.263
rpoB762245c.2439G>C0.813
rpoB762248c.2442G>C0.470
rpoB762254c.2448T>C1.000
rpoB762266c.2460T>C0.176
rpoB762284c.2478G>C0.515
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C0.273
rpoB762299c.2493G>C0.190
rpoB762441p.Leu879Met0.927
rpoB762452c.2646G>C0.226
rpoB762458c.2652C>T0.274
rpoB762470c.2664G>C1.000
rpoB762471p.Ile889Val0.565
rpoB762474p.Gly890Ser1.000
rpoB762485c.2679G>C0.625
rpoB762488c.2682G>C0.792
rpoB762491c.2685T>C0.333
rpoB762503c.2697G>C1.000
rpoB762509c.2703T>C0.348
rpoB762842c.3036G>C0.222
rpoB762854c.3048G>C0.270
rpoB762855p.Val1017Ile0.937
rpoB762858p.Thr1018Ser1.000
rpoB762863c.3057T>G1.000
rpoB762871p.Met1022Thr0.200
rpoB762879p.Met1025Leu1.000
rpoB762887c.3081G>C0.957
rpoB762896c.3090G>C0.448
rpoB762899c.3093G>C0.290
rpoB762920c.3114C>T0.240
rpoB762926c.3120C>G0.743
rpoB762929c.3123G>T0.995
rpoB762932c.3126G>C0.495
rpoB762938c.3132G>C0.634
rpoB762944c.3138C>T0.276
rpoB762947c.3141C>G0.708
rpoB762962c.3156C>T0.679
rpoB762971c.3165G>C0.945
rpoB762980c.3174T>C0.494
rpoB762983c.3177C>T0.490
rpoB762989c.3183G>C1.000
rpoB762995c.3189G>C0.373
rpoB763005p.Cys1067Val1.000
rpoB763014p.Met1070Leu0.833
rpoB763017p.Gln1071Glu0.925
rpoB763022c.3216C>T0.385
rpoB763028c.3222T>C0.623
rpoB763031c.3225T>C1.000
rpoB763038p.Thr1078Ala0.958
rpoB763043c.3237G>C0.958
rpoB763049c.3243G>A0.155
rpoB763053c.3247T>C1.000
rpoB763067c.3261C>G0.427
rpoB763070c.3264T>C0.975
rpoB763077p.Val1091Thr0.975
rpoB763082c.3276C>T0.167
rpoB763103c.3297G>C1.000
rpoB763109c.3303C>T0.389
rpoB763115c.3309T>C1.000
rpoB763119p.Asn1105Asp0.986
rpoB763127c.3321G>C1.000
rpoB763133c.3327G>C0.984
rpoB763148c.3342G>C1.000
rpoC763456c.87A>G1.000
rpoC763462c.93G>C0.959
rpoC763468c.99G>C1.000
rpoC763483c.114G>C0.966
rpoC763486c.117T>C1.000
rpoC763492c.123G>C0.885
rpoC763507c.138G>C0.158
rpoC763528c.159G>C0.125
rpoC763531c.162G>C1.000
rpoC763534c.165T>C1.000
rpoC763537c.168C>G0.860
rpoC763546c.177A>G0.991
rpoC763550p.Tyr61Ala1.000
rpoC763558c.189C>T0.847
rpoC763570c.201G>C1.000
rpoC763578p.Phe70Tyr1.000
rpoC763589p.Ile74Val0.885
rpoC763606c.237C>G1.000
rpoC763615c.246G>C0.919
rpoC763618c.249C>T1.000
rpoC763622p.Ala85Ser1.000
rpoC763636c.267T>C0.907
rpoC763642c.273G>C1.000
rpoC763647p.Gly93Ala0.868
rpoC763655p.Glu96Lys1.000
rpoC763660c.291T>C0.978
rpoC763666c.297G>T0.966
rpoC763669c.300C>G1.000
rpoC763696c.327T>C0.933
rpoC763699c.330G>C0.818
rpoC763705c.336G>A0.750
rpoC763708c.339G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C0.957
rpoC763724p.Asp119Asn0.957
rpoC763729c.360G>C0.957
rpoC763732c.363C>G1.000
rpoC763735c.366G>T0.174
rpoC763744c.375G>C0.190
rpoC763751p.Ile128Val1.000
rpoC763762c.393C>T0.160
rpoC763765c.396T>G0.800
rpoC763772p.Val135Met1.000
rpoC763775p.Ile136Val0.706
rpoC763781p.Ser138Glu1.000
rpoC764485c.1116G>C1.000
rpoC764491c.1122G>T1.000
rpoC764497c.1128A>G0.350
rpoC764498p.Ser377Ala0.297
rpoC764503c.1134G>T0.297
rpoC764509c.1140G>C0.980
rpoC764512c.1143G>C0.529
rpoC764521c.1152T>C1.000
rpoC764524c.1155C>T0.537
rpoC764527c.1158C>T0.291
rpoC764530c.1161C>T0.564
rpoC764536c.1167G>C1.000
rpoC764539c.1170C>G0.375
rpoC764543p.Thr392Ala0.593
rpoC764548c.1179G>T0.390
rpoC764549p.Pro394Val0.348
rpoC764560c.1191T>C0.326
rpoC764566c.1197C>G1.000
rpoC764572c.1203G>C0.407
rpoC764573p.Leu402Ile0.475
rpoC764578c.1209C>G0.469
rpoC764581c.1212T>C0.914
rpoC764582p.Leu405Met0.923
rpoC764602c.1233C>T0.394
rpoC764605c.1236G>C0.394
rpoC764611c.1242G>C0.468
rpoC764620c.1251G>C0.555
rpoC764623c.1254C>G0.546
rpoC764632c.1263T>C0.980
rpoC764635c.1266C>G0.543
rpoC764647c.1278C>T0.394
rpoC764650c.1281G>T0.485
rpoC764651c.1282T>A0.514
rpoC764656c.1287C>T0.263
rpoC764662c.1293G>C0.992
rpoC764671c.1302G>C0.574
rpoC764677c.1308C>G0.404
rpoC764678p.Lys437Gln0.339
rpoC764695c.1326T>C0.545
rpoC764701c.1332C>G0.160
rpoC764703p.Lys445Ser0.544
rpoC764706p.Leu446Gln1.000
rpoC764713c.1344G>C0.973
rpoC764731c.1362G>C0.944
rpoC764737c.1368G>C0.925
rpoC764746c.1377G>C0.375
rpoC764749c.1380G>C0.250
rpoC764752c.1383G>C0.467
rpoC764755p.Asp462Glu0.529
rpoC764756p.Leu463Lys0.471
rpoC764762p.His465Tyr0.500
rpoC764774p.Ile469Val0.600
rpoC764780p.Ser471Ala0.400
rpoC764793p.Met475Lys0.550
rpoC764797c.1428G>C0.286
rpoC764804p.Gln479Tyr0.250
rpoC764809c.1440C>T0.250
rpoC765903p.Thr845Ser1.000
rpoC765907c.2538G>C1.000
rpoC765923p.Asn852Ala1.000
rpoC765937c.2568T>C1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765958c.2589C>G1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765988c.2619G>C1.000
rpoC765991c.2622C>G1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766009c.2640G>C1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766807c.3438T>C1.000
rpoC766811p.Ser1148Asp1.000
rpoC766820p.Asp1151Ser1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766861c.3492G>C1.000
rpsL781643c.84G>C0.500
rpsL781649c.90T>C0.308
rpsL781652c.93T>C0.312
rpsL781655c.96T>C0.938
rpsL781658c.99A>G1.000
rpsL781667c.108C>T0.323
rpsL781682c.123T>G0.141
rpsL781745c.186G>A0.200
rpsL781751c.192G>C0.958
rpsL781760c.201T>C1.000
rpsL781766c.207C>T0.964
rpsL781796p.Met79Ile1.000
rpsL781802c.243G>C1.000
rpsL781805c.246G>T0.197
rpsL781811c.252C>T0.964
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781832c.273T>C1.000
rpsL781835c.276T>C0.987
rpsL781841c.282C>T0.928
rpsL781845p.Lys96Arg0.969
rpsL781851p.Ile98Val1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781916c.357T>G0.950
rrs1471843c.-3G>T0.439
rrs1472023r.178g>c0.995
rrs1472063r.218c>t0.494
rrs1472068r.223t>g0.934
rrs1472075r.230a>g0.996
rrs1472078r.233c>t0.813
rrs1472108r.263c>t0.805
rrs1472122r.277g>t0.841
rrs1472123r.278a>t0.852
rrs1472124r.279c>t0.969
rrs1472150r.305t>a0.996
rrs1472155r.310c>t0.816
rrs1472160r.315c>t0.794
rrs1472172r.327t>c0.249
rrs1472225r.380c>a0.329
rrs1472251r.406g>a1.000
rrs1472258r.413a>g0.341
rrs1472259r.414c>a0.687
rrs1472274r.429a>g0.174
rrs1472314r.469a>g0.982
rrs1472325r.480g>c1.000
rrs1472330r.485g>t0.973
rrs1472338r.493a>g0.989
rrs1472344r.499c>t1.000
rrs1472379r.534t>c0.983
rrs1472400r.555c>t0.973
rrs1472422r.577t>c0.875
rrs1472427r.582t>g0.560
rrs1472476r.631a>g1.000
rrs1472489r.644a>t0.258
rrs1472494r.649a>g0.866
rrs1472496r.651t>g0.261
rrs1472498r.653c>t1.000
rrs1472513r.668t>c0.259
rrs1472549r.704g>a0.309
rrs1472558r.713g>a0.536
rrs1472569r.724g>a0.457
rrs1472581r.736a>c0.309
rrs1472584r.739a>t0.309
rrs1472597r.752g>a0.297
rrs1472598r.753a>c0.400
rrs1472599r.754g>t0.352
rrs1472607r.762g>a0.200
rrs1472616r.771g>a0.464
rrs1472655r.810g>t0.392
rrs1472658r.813g>a0.590
rrs1472660r.815t>c0.397
rrs1472661r.816a>g0.581
rrs1472670r.825g>t0.423
rrs1472673r.828t>a0.719
rrs1472675r.830t>c0.549
rrs1472677r.832c>t0.487
rrs1472680r.835c>t0.246
rrs1472682r.837t>c0.617
rrs1472683r.838t>g0.590
rrs1472687r.842a>t0.423
rrs1472690r.845c>a0.685
rrs1472692r.847t>c0.209
rrs1472697r.852t>c0.656
rrs1472713r.868t>c0.586
rrs1472714r.869a>g0.342
rrs1472716r.871c>t0.667
rrs1472742r.897c>t0.616
rrs1472744r.899a>g0.656
rrs1472767r.922g>a0.287
rrs1472781r.936c>t0.648
rrs1472790r.945t>c0.232
rrs1472793r.948a>t0.758
rrs1472803r.958t>a0.725
rrs1472824r.979t>a0.933
rrs1472825r.980g>a0.644
rrs1472828r.983t>c1.000
rrs1472874r.1029c>t0.167
rrs1472875r.1030t>c0.345
rrs1472895r.1050c>t1.000
rrs1472954r.1109t>c0.798
rrs1472956r.1111t>c0.835
rrs1472957r.1112c>t0.751
rrs1472958r.1113a>g0.253
rrs1472973r.1128a>g0.328
rrs1472974r.1129a>g0.255
rrs1472988r.1143t>c0.279
rrs1472990r.1145a>g0.971
rrs1472992r.1147a>g0.570
rrs1473005r.1160c>t0.570
rrs1473035r.1190g>a0.937
rrs1473053r.1208t>a0.287
rrs1473055r.1210c>t0.705
rrs1473056r.1211a>t0.992
rrs1473062r.1217t>a0.299
rrs1473066r.1221a>g0.698
rrs1473068r.1223a>g0.300
rrs1473081r.1236c>t0.458
rrs1473088r.1243a>g0.787
rrs1473093r.1248c>t0.361
rrs1473100r.1255g>a0.995
rrs1473102r.1257c>t0.237
rrs1473104r.1259c>t0.950
rrs1473110r.1265t>g0.940
rrs1473111r.1266a>g0.964
rrs1473121r.1276t>c0.988
rrs1473123r.1278a>t0.821
rrs1473145r.1300c>t0.362
rrs1473148r.1303g>t0.731
rrs1473163r.1318c>a0.718
rrs1473166r.1321g>a0.362
rrs1473173r.1328c>t0.789
rrs1473221r.1376c>t0.718
rrs1473252r.1407t>c0.769
rrs1473259r.1414c>t0.781
rrs1473262r.1417t>c0.226
rrs1473270r.1425g>a0.266
rrs1473276r.1431a>g0.300
rrs1473277r.1432g>a0.478
rrs1473288r.1443c>g0.398
rrs1473290r.1445c>t0.426
rrs1473294r.1449a>g0.387
rrs1473300r.1455c>t0.434
rrs1473301r.1456t>c0.412
rrs1473305r.1460g>t0.345
rrs1473316r.1471c>t1.000
rrs1473319r.1474c>t0.204
rrl1473384c.-274A>G0.214
rrl1473676r.19g>a0.427
rrl1473679r.22t>c0.977
rrl1473697r.40c>a0.164
rrl1473698r.41g>a0.839
rrl1473718r.61g>t0.911
rrl1473721r.64g>a0.921
rrl1473722r.65g>t0.939
rrl1473731r.74t>a0.916
rrl1473744r.87t>c0.783
rrl1473746r.89t>a0.898
rrl1473747r.90c>t0.846
rrl1473751r.94c>t0.865
rrl1473753r.96a>g0.904
rrl1473756r.99g>t0.979
rrl1473757r.100t>g0.917
rrl1473758r.101g>t1.000
rrl1473782r.125a>g0.179
rrl1473788r.131a>g0.763
rrl1473797r.140g>t1.000
rrl1473806r.149c>t1.000
rrl1473807r.150t>c1.000
rrl1473811r.154c>t1.000
rrl1473822r.165a>g1.000
rrl1473832r.175c>t1.000
rrl1473836r.179a>g0.722
rrl1473862r.205c>t0.369
rrl1473871r.214t>c0.276
rrl1473876r.219g>a0.328
rrl1473887r.230t>a0.533
rrl1473888r.231t>a1.000
rrl1473898r.241c>t0.242
rrl1473899r.242a>t0.242
rrl1473916r.259c>a0.283
rrl1473922r.265a>g0.615
rrl1473923r.266c>g1.000
rrl1473926r.269g>a0.385
rrl1473962r.305t>c1.000
rrl1474124r.467g>c1.000
rrl1474125r.468c>g1.000
rrl1474130r.473c>t0.917
rrl1474140r.483c>t0.933
rrl1474141r.484g>c1.000
rrl1474142r.485c>g1.000
rrl1474151r.494c>t0.992
rrl1474155r.498g>a0.988
rrl1474164r.507c>t0.992
rrl1474171r.514c>t0.712
rrl1474181r.524c>a0.296
rrl1474184r.527c>t1.000
rrl1474185r.528g>a0.835
rrl1474197r.540c>t0.979
rrl1474199r.542g>c0.292
rrl1474202r.545t>c0.658
rrl1474249r.592g>t0.959
rrl1474269r.612c>t0.589
rrl1474271r.614a>g0.339
rrl1474272r.615c>t0.341
rrl1474275r.618t>g0.987
rrl1474306r.649a>t0.619
rrl1474308r.651g>t0.215
rrl1474310r.653t>g0.787
rrl1474315r.658a>g0.200
rrl1474348r.691c>t0.676
rrl1474351r.694g>t1.000
rrl1474353r.696a>g0.498
rrl1474354r.697c>t0.515
rrl1474355r.698a>g0.496
rrl1474356r.699t>c0.434
rrl1474359r.702c>g0.445
rrl1474362r.705a>g1.000
rrl1474363r.706a>t0.436
rrl1474365r.708g>c0.436
rrl1474383r.726g>t0.625
rrl1474384r.727c>g0.441
rrl1474387r.730c>t0.992
rrl1474393r.736a>g0.352
rrl1474402r.745t>c0.360
rrl1474406r.749t>c0.592
rrl1474413r.756acccacacgcgcatacgcgcgt>a1.000
rrl1474435r.778g>t0.152
rrl1474437r.780gaa>g1.000
rrl1474448r.791t>c0.984
rrl1474467r.810a>g0.996
rrl1474488r.831g>t0.996
rrl1474495r.838g>a0.954
rrl1474498r.841g>t0.893
rrl1474505r.848c>g0.886
rrl1474508r.851c>t0.942
rrl1474516r.859c>a0.996
rrl1474527r.870t>c0.822
rrl1474537r.880g>a1.000
rrl1474542r.885a>g0.794
rrl1474626r.969t>c0.500
rrl1474632r.975g>t0.294
rrl1474634r.977t>g0.444
rrl1474636r.979a>c1.000
rrl1474637r.980c>t0.580
rrl1474638r.981c>g1.000
rrl1474640r.983c>t0.396
rrl1474658r.1001a>g0.390
rrl1474663r.1006c>t0.561
rrl1474673r.1016t>c0.355
rrl1474675r.1018c>g0.367
rrl1474676r.1019t>a0.432
rrl1474677r.1020a>g0.992
rrl1474692r.1035g>a0.377
rrl1474709r.1052g>a0.587
rrl1474717r.1060a>t0.957
rrl1474722r.1065t>c0.221
rrl1474734r.1077g>a0.261
rrl1474749r.1092c>t0.531
rrl1474754r.1097c>t0.483
rrl1474760r.1103a>g0.996
rrl1474779r.1122g>a0.518
rrl1474780r.1123c>t0.512
rrl1474782r.1125g>a0.525
rrl1474794r.1137c>t1.000
rrl1474801r.1144g>a0.258
rrl1474802r.1145t>c0.595
rrl1474823r.1166c>g0.598
rrl1474824r.1167a>g0.410
rrl1474830r.1173a>g0.904
rrl1474831r.1174a>t0.471
rrl1474832r.1175a>t0.720
rrl1474863r.1206a>at0.130
rrl1474864r.1207c>t0.980
rrl1474901r.1244a>g0.332
rrl1474903r.1246t>c0.575
rrl1474904r.1247g>c0.465
rrl1474913r.1256t>c0.941
rrl1474933r.1276a>g0.284
rrl1474934r.1277c>t0.278
rrl1475016r.1359c>t1.000
rrl1475018r.1361g>c1.000
rrl1475026r.1369g>c1.000
rrl1475031r.1374g>c1.000
rrl1475062r.1405a>t1.000
rrl1475079r.1422t>a1.000
rrl1475082r.1425c>g0.824
rrl1475090r.1433a>t0.981
rrl1475104r.1447t>a0.985
rrl1475114r.1457c>t1.000
rrl1475124r.1467a>t0.993
rrl1475171r.1514c>t0.667
rrl1475172r.1515a>g0.533
rrl1475175r.1518g>a0.250
rrl1475452r.1795c>a1.000
rrl1475460r.1803a>g0.316
rrl1475499r.1842c>t0.761
rrl1475508r.1851a>t0.333
rrl1475518r.1861a>g0.401
rrl1475521r.1864t>c0.305
rrl1475526r.1869c>t0.876
rrl1475529r.1872a>g0.303
rrl1475532r.1875a>t0.541
rrl1475538r.1881t>c0.453
rrl1475539r.1882a>t0.629
rrl1475544r.1887a>t0.526
rrl1475545r.1888t>g0.808
rrl1475548r.1891c>t0.828
rrl1475549r.1892t>c0.828
rrl1475573r.1916g>t0.453
rrl1475576r.1919c>t0.350
rrl1475591r.1934g>t0.343
rrl1475596r.1939g>a0.366
rrl1475639r.1982c>g1.000
rrl1475649r.1992a>g1.000
rrl1475655r.1998t>g1.000
rrl1475659r.2002g>a1.000
rrl1475686r.2029c>g0.884
rrl1475696r.2039t>c0.920
rrl1475699r.2042c>t0.993
rrl1475703r.2046a>g0.919
rrl1475715r.2058g>t0.839
rrl1475751r.2094c>a1.000
rrl1475753r.2096c>g0.154
rrl1475754r.2097g>a0.319
rrl1475756r.2099t>c0.625
rrl1475760r.2103c>t0.255
rrl1475762r.2105g>t0.696
rrl1475764r.2107a>t0.343
rrl1475765r.2108a>g0.705
rrl1475774r.2117c>t0.685
rrl1475777r.2120a>t0.969
rrl1475881r.2224t>c0.682
rrl1475883r.2226a>t0.321
rrl1475884r.2227a>g0.664
rrl1475898r.2241a>g0.968
rrl1475899r.2242g>a0.969
rrl1475900r.2243a>g0.404
rrl1475906r.2249c>t0.280
rrl1475916r.2259c>t0.328
rrl1475937r.2280a>t0.649
rrl1475943r.2286g>a1.000
rrl1475945r.2288c>a0.894
rrl1475952r.2295a>g1.000
rrl1475970r.2313c>t0.987
rrl1475975r.2318c>t0.807
rrl1475977r.2320a>g0.995
rrl1475988r.2331a>g1.000
rrl1475991r.2334t>c0.294
rrl1475992r.2335t>g0.277
rrl1475995r.2338g>t0.317
rrl1475997r.2340a>t0.647
rrl1475998r.2341c>t0.468
rrl1475999r.2342g>a0.364
rrl1476000r.2343g>a0.479
rrl1476001r.2344t>c1.000
rrl1476007r.2350t>c0.240
rrl1476030r.2373a>g0.889
rrl1476032r.2375c>a0.164
rrl1476033r.2376t>g0.855
rrl1476034r.2377c>t0.373
rrl1476035r.2378g>t0.817
rrl1476040r.2383c>t0.145
rrl1476044r.2387t>g0.853
rrl1476045r.2388g>t0.145
rrl1476046r.2389g>t0.787
rrl1476047r.2390g>t0.164
rrl1476049r.2392c>t1.000
rrl1476058r.2401t>c0.596
rrl1476059r.2402g>c0.505
rrl1476080r.2423t>g1.000
rrl1476085r.2428g>a1.000
rrl1476097r.2440c>t1.000
rrl1476099r.2442a>g1.000
rrl1476100r.2443a>c1.000
rrl1476103r.2446c>a1.000
rrl1476110r.2453g>t0.391
rrl1476112r.2455gt>g0.856
rrl1476113r.2456t>g0.953
rrl1476131r.2474c>t0.963
rrl1476164r.2507a>g0.810
rrl1476179r.2522c>t0.833
rrl1476194r.2537a>g1.000
rrl1476200r.2543a>t0.996
rrl1476201r.2544c>t0.211
rrl1476204r.2547c>t0.785
rrl1476207r.2550t>c0.774
rrl1476214r.2557g>t0.902
rrl1476215r.2558c>t0.905
rrl1476221r.2564t>c0.810
rrl1476224r.2567a>g0.891
rrl1476245r.2588c>t0.799
rrl1476251r.2594t>c0.600
rrl1476257r.2600g>c0.744
rrl1476260r.2603a>g1.000
rrl1476280r.2623a>c0.909
rrl1476293r.2636c>t0.805
rrl1476294r.2637a>g0.984
rrl1476295r.2638c>g0.991
rrl1476296r.2639c>t0.984
rrl1476297r.2640c>g0.245
rrl1476301r.2644a>t0.429
rrl1476302r.2645g>a0.524
rrl1476311r.2654g>t0.202
rrl1476312r.2655t>c0.989
rrl1476313r.2656g>a0.742
rrl1476332r.2675g>c0.897
rrl1476338r.2681c>t0.832
rrl1476353r.2696g>a0.506
rrl1476357r.2700t>c0.235
rrl1476358r.2701t>c0.799
rrl1476359r.2702c>a0.152
rrl1476369r.2712c>t0.529
rrl1476372r.2715t>c0.507
rrl1476382r.2725a>g0.776
rrl1476383r.2726t>g0.219
rrl1476408r.2751g>a0.550
rrl1476411r.2754g>a0.383
rrl1476425r.2768g>a0.421
rrl1476428r.2771c>a0.287
rrl1476429r.2772a>c0.350
rrl1476443r.2786g>c0.206
rrl1476481r.2824t>c0.879
rrl1476506r.2849t>c0.949
rrl1476514r.2857c>t0.164
rrl1476515r.2858c>t0.850
rrl1476517r.2860c>t0.190
rrl1476519r.2862c>g0.143
rrl1476523r.2866t>c0.339
rrl1476524r.2867c>a0.418
rrl1476525r.2868a>g0.982
rrl1476528r.2871a>g0.218
rrl1476530r.2873c>t0.393
rrl1476536r.2879g>a0.929
rrl1476538r.2881a>g0.838
rrl1476539r.2882a>g0.292
rrl1476540r.2883c>g0.287
rrl1476547r.2890c>t0.725
rrl1476567r.2910c>t0.701
rrl1476572r.2915g>a0.629
rrl1476581r.2924g>a0.506
rrl1476584r.2927c>t0.996
rrl1476585r.2928a>g0.323
rrl1476595r.2938c>a0.588
rrl1476600r.2943a>c0.207
rrl1476602r.2945g>t0.592
rrl1476608r.2951c>g0.427
rrl1476614r.2957a>t0.432
rrl1476616r.2959a>g0.332
rrl1476618r.2961c>t0.545
rrl1476619r.2962c>t0.444
rrl1476625r.2968c>t0.460
rrl1476628r.2971t>g0.413
rrl1476629r.2972c>a0.884
rrl1476630r.2973a>t0.522
rrl1476631r.2974g>a0.405
rrl1476633r.2976a>g0.335
rrl1476664r.3007t>a0.491
rrl1476665r.3008t>g0.509
rrl1476668r.3011c>t0.564
rrl1476675r.3018c>g1.000
rpsA1833641p.Asn34Asp0.625
rpsA1833646c.105T>C0.232
rpsA1833652c.111C>T0.228
rpsA1833658c.117C>T0.379
rpsA1833661c.120A>G0.627
rpsA1833667c.126C>T0.607
rpsA1833668p.Ile43Val1.000
rpsA1833673c.132C>T0.393
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>C0.464
rpsA1833684p.Arg48His0.316
rpsA1833688c.147C>T0.281
rpsA1833694c.153G>C1.000
rpsA1833700c.159C>T0.328
rpsA1833703c.162C>T0.278
rpsA1833727c.186G>C1.000
rpsA1833732p.Pro64Leu1.000
rpsA1833736c.195C>T1.000
rpsA1833742c.201A>G1.000
rpsA1833770p.Asn77Asp1.000
rpsA1833776p.Val79Ile0.979
rpsA1833781c.240T>C0.987
rpsA1833790c.249T>C0.995
rpsA1833797p.Val86Ile1.000
rpsA1833802c.261A>G0.917
rpsA1833856c.315A>G1.000
rpsA1833859c.318C>T0.227
rpsA1833862c.321G>T0.172
rpsA1833874c.333T>C0.849
rpsA1833877c.336C>G0.151
rpsA1833893p.Ala118Lys0.364
rpsA1833896p.Leu119Val0.556
rpsA1833904c.363G>A0.360
rpsA1833905p.Lys122Glu1.000
rpsA1833912p.Glu124Gly1.000
rpsA1833915p.Ala125Val1.000
rpsA1833921p.Lys127Thr1.000
rpsA1833926p.Thr129Ser0.244
rpsA1833940c.399C>G0.544
rpsA1833949c.408T>C0.894
rpsA1833955c.414G>C0.718
rpsA1833961c.420C>G0.606
rpsA1833970c.429G>C1.000
rpsA1833976c.435C>T0.172
rpsA1833979c.438T>C1.000
rpsA1833985c.444G>T0.691
rpsA1833994c.453G>C0.995
rpsA1834009c.468C>T0.965
rpsA1834012c.471G>C1.000
rpsA1834024c.483G>T0.992
rpsA1834034p.Ile165Val0.978
rpsA1834040p.Lys167Arg0.996
rpsA1834046p.Ile169Leu0.877
rpsA1834054c.513C>G0.930
rpsA1834093c.552G>C1.000
rpsA1834096c.555G>C0.650
rpsA1834102c.561T>C0.950
rpsA1834108c.567C>A0.285
rpsA1834114c.573G>C0.895
rpsA1834129c.588C>G0.533
rpsA1834135c.594G>C0.889
rpsA1834183c.642T>C0.364
rpsA1834189c.648G>T0.977
rpsA1834195c.654G>C1.000
rpsA1834213c.672G>C0.205
rpsA1834228c.687C>T0.674
rpsA1834234c.693G>C1.000
rpsA1834240c.699T>C0.930
rpsA1834246c.705G>T0.833
rpsA1834249c.708T>C1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834294c.753G>C1.000
rpsA1834298p.Gln253Glu1.000
rpsA1834306c.765T>C1.000
rpsA1834307p.Asp256Gln0.230
rpsA1834312c.771G>A0.770
rpsA1834318c.777C>G0.176
rpsA1834327c.786G>T0.178
rpsA1834330c.789C>G0.183
rpsA1834345c.804C>T0.848
rpsA1834348c.807T>C1.000
rpsA1834354c.813G>C1.000
rpsA1834357c.816T>C1.000
rpsA1834360c.819G>C1.000
rpsA1834361c.820T>C1.000
rpsA1834366c.825A>G0.377
rpsA1834375c.834G>C0.821
rpsA1834378c.837T>C1.000
rpsA1834384c.843A>G0.150
rpsA1834387c.846C>T0.687
rpsA1834395p.Arg285Gln0.827
rpsA1834397p.His286Ala0.800
rpsA1834411c.870T>C1.000
rpsA1834417c.876G>C0.342
rpsA1834423c.882G>C1.000
rpsA1834427p.Ile296Val0.933
rpsA1834432c.891G>T0.357
rpsA1834435c.894G>C1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>C0.586
rpsA1834459c.918G>C0.989
rpsA1834465c.924T>C0.724
rpsA1834468c.927A>C0.510
rpsA1834474c.933C>A0.284
rpsA1834477c.936C>T0.568
rpsA1834486p.Glu315Asp1.000
rpsA1834489c.948T>C0.759
rpsA1834498c.957C>T0.236
rpsA1834504c.963G>C0.226
rpsA1834523p.Glu328Gln1.000
rpsA1834528c.987T>C0.800
rpsA1834546p.Asp335Glu1.000
rpsA1834564c.1023C>T0.905
rpsA1834570p.Asp343Glu1.000
rpsA1834572p.Ala344Val1.000
rpsA1834574p.Met345Phe1.000
rpsA1834612c.1071G>T1.000
rpsA1834618c.1077G>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834627c.1086C>G0.955
rpsA1834633c.1092A>G0.922
rpsA1834713p.Ile391Lys1.000
rpsA1834716p.Phe392Tyr1.000
pncA2289085p.Asp53Tyr1.000
ahpC2726693c.501C>G0.500
ahpC2726717c.525A>C0.600
ald3087617c.798T>C1.000
ald3087620c.801A>C1.000
ald3087641c.822T>C1.000
alr3841674c.-254C>G1.000
embA4244220c.988C>T1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;