TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d242579bbb2b
Sample: 5d242579bbb2b

Download results

Summary
ID: 5d242579bbb2b
Date: Tue Jul 9 06:28:59 2019
Strain: root
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.955
gyrB6115c.876A>G0.957
gyrB6121c.882C>T0.957
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C0.962
gyrB6676c.1437T>G0.963
gyrB6700c.1461T>C0.968
gyrB6703c.1464G>C0.968
gyrB6706c.1467G>A0.968
gyrB6709c.1470A>G0.938
gyrB6712c.1473G>C0.938
gyrB6727c.1488G>T0.939
gyrB6728c.1489C>T0.939
gyrB6739c.1500C>T0.950
gyrB6745c.1506T>C0.952
gyrB6754c.1515C>T0.958
gyrB6763c.1524G>C0.963
gyrB6772c.1533C>G0.966
gyrB6775c.1536G>C0.966
gyrB6793c.1554T>C0.955
gyrB6798p.Gly520Ala0.984
gyrB6808c.1569C>G0.984
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G0.980
gyrB6869c.1630T>C0.977
gyrB6872c.1633T>C0.977
gyrB6878c.1639T>C0.977
gyrB6889c.1650G>A0.950
gyrB6898c.1659G>T0.946
gyrB7006c.1767T>G0.923
gyrB7010p.Leu591Met0.923
gyrB7015c.1776G>A0.923
gyrB7018c.1779G>C0.923
gyrB7024c.1785G>C0.923
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C0.917
gyrB7066c.1827G>T1.000
gyrB7078c.1839A>G1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7496c.195C>G0.931
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C0.958
gyrA8129c.828T>C0.958
gyrA8156c.855T>C0.958
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C0.947
gyrA8267c.966G>C0.963
gyrA8283p.Ile328Leu0.969
gyrA8288c.987T>C0.970
gyrA8294c.993T>C0.976
gyrA8327c.1026C>T0.956
gyrA8330c.1029C>G0.977
gyrA8339c.1038A>G0.976
gyrA8340p.Ala347Ser0.976
gyrA8354c.1053G>C0.943
gyrA8372c.1071G>T0.935
gyrA8382c.1081C>T0.960
gyrA8576c.1275C>G0.900
gyrA8580p.Ile427Val0.909
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8799p.Ala500Ser1.000
gyrA8804c.1503C>G0.938
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C0.941
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T0.971
gyrA8852c.1551T>C0.973
gyrA8858c.1557T>C0.974
gyrA8870c.1569G>C0.977
gyrA8873c.1572A>G0.977
gyrA8897c.1596T>C0.981
gyrA8903c.1602T>C0.981
gyrA8915c.1614A>G0.981
gyrA8942c.1641G>C0.974
gyrA8945c.1644G>C0.971
gyrA8946c.1645T>C0.972
gyrA8957c.1656C>T0.971
gyrA8967p.Ala556Lys0.967
gyrA8978c.1677C>T0.964
gyrA8987c.1686C>G0.950
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.971
rpoB760274p.Glu156Asp0.964
rpoB760276p.Lys157Met0.963
rpoB760283c.477G>C0.960
rpoB760298c.492G>C1.000
rpoB760307c.501T>C0.900
rpoB760357p.Thr184Ser0.933
rpoB760361c.555T>C0.875
rpoB760370c.564C>G0.917
rpoB760376p.Asp190Glu0.960
rpoB760382c.576G>C0.962
rpoB760388c.582C>T0.963
rpoB760400c.594G>C0.969
rpoB760406c.600G>C0.970
rpoB760407p.Ser201Gly0.971
rpoB760415c.609C>T0.974
rpoB760418c.612G>C0.974
rpoB760430c.624T>C0.953
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760567c.763 764insGC1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.984
rpoC763660c.291T>G0.983
rpoC763666c.297G>C0.980
rpoC763669c.300C>G0.980
rpoC763675c.306C>G0.979
rpoC763696c.327T>C0.931
rpoC763699c.330G>T0.931
rpoC763702c.333C>G0.931
rpoC763708c.339G>C0.926
rpoC763711c.342G>C0.926
rpoC763714c.345G>C0.926
rpoC763717c.348T>C0.926
rpoC763723c.354G>C0.926
rpoC763732c.363C>A0.923
rpoC763741c.372C>T0.909
rpoC763744c.375G>C0.900
rpoC763747c.378G>A0.900
rpoC763765c.396T>C0.933
rpoC763774c.405G>C0.800
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C0.933
rpoC764029p.Glu220Asp0.875
rpoC764032p.Asp221Glu0.857
rpoC764040p.Ser224Thr0.864
rpoC764044c.675T>C0.826
rpoC764054c.685C>T0.864
rpoC764059c.690G>T0.875
rpoC764083c.714A>G0.880
rpoC764084p.Asn239Val0.880
rpoC764095c.726C>T0.880
rpoC764098c.729A>G0.880
rpoC764143c.774G>C0.882
rpoC764147p.Ser260Ala0.875
rpoC764150p.Ile261Val0.875
rpoC764165p.Glu266Gln0.867
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764332c.963G>A0.944
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T0.982
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T1.000
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T0.987
rpoC764668c.1299C>T0.986
rpoC764692c.1323C>T0.986
rpoC764713c.1344G>T0.984
rpoC764716c.1347G>C0.984
rpoC764746c.1377G>T0.982
rpoC764752c.1383G>C0.982
rpoC764758c.1389C>G0.983
rpoC764764c.1395T>C0.982
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G0.980
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln0.982
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C0.982
rpoC764968c.1599T>C0.981
rpoC765004c.1635G>C0.947
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C0.941
rpoC765011c.1642A>T0.941
rpoC765016c.1647C>G0.941
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T1.000
rpoC765129p.Tyr587Phe1.000
rpoC765143p.Val592Ile1.000
rpoC765343c.1974G>A0.818
rpoC765346c.1977C>G0.167
rpoC765349c.1980T>C0.167
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val0.846
rpoC765370c.2001G>C0.882
rpoC765379c.2010G>C0.882
rpoC765382c.2013G>T0.882
rpoC765383p.Met672Leu0.944
rpoC765403c.2034G>C0.870
rpoC765405p.Leu679His0.870
rpoC765409c.2040T>G0.952
rpoC765421c.2052C>G0.967
rpoC765449p.Ala694Ser0.914
rpoC765454c.2085C>G0.914
rpoC765469c.2100G>C0.938
rpoC765478c.2109T>G0.978
rpoC765480p.Tyr704Phe0.936
rpoC765499c.2130C>G0.975
rpoC765517c.2148C>G0.947
rpoC765533p.Tyr722His0.969
rpoC765544c.2175C>G0.957
rpoC765547c.2178C>T0.957
rpoC765548c.2179A>T0.957
rpoC765553c.2184C>T0.957
rpoC765556c.2187G>C0.957
rpoC765562c.2193G>T0.957
rpoC765826c.2457T>C0.963
rpoC765835c.2466C>T0.963
rpoC765841c.2472G>T0.941
rpoC765861p.Phe831Tyr0.944
rpoC765875p.Val836Ile0.955
rpoC765907c.2538G>T0.953
rpoC765910c.2541G>C0.953
rpoC765928c.2559C>G0.974
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G0.944
rpoC765979c.2610C>G0.944
rpoC765982c.2613C>T0.944
rpoC765994c.2625A>T0.941
rpoC766003c.2634G>C0.938
rpoC766009c.2640G>C0.923
rpoC766012c.2643C>G0.917
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T0.950
rpoC766345c.2976T>C0.950
rpoC766348c.2979A>G0.950
rpoC766351c.2982C>G0.950
rpoC766353p.Val995Ala0.950
rpoC766369c.3000C>G0.970
rpoC766375c.3006C>G0.971
rpoC766381c.3012C>T0.971
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766513c.3144C>T0.909
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G0.909
rpoC766537c.3168G>A0.909
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C0.973
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu0.973
rpoC766618c.3249G>T0.972
rpoC766624c.3255G>C0.971
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C0.969
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G0.962
rpoC766837c.3468G>C0.960
rpoC766843c.3474T>G0.962
rpoC766846c.3477C>A0.962
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C0.962
rpoC766867c.3498C>G0.962
rpoC766876c.3507C>T0.962
rpoC766931p.Ala1188Ser0.973
rpoC766942c.3573C>T0.976
rpoC766945c.3576A>C0.977
rpoC766963c.3594T>C0.980
rpoC766996c.3627C>T0.984
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767095c.3726C>T0.933
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T0.987
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C0.976
rpsL781715c.156T>G0.975
rpsL781772c.213C>T0.971
rpsL781802c.243G>C0.974
rpsL781814c.255C>T0.976
rpsL781817c.258G>T0.976
rpsL781829c.270G>C0.979
rpsL781832c.273T>C0.979
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.982
rrs1471986r.141c>t0.982
rrs1472030r.185g>a0.967
rrs1472031r.186g>c0.967
rrs1472032r.187g>a0.967
rrs1472033r.188a>c0.967
rrs1472035r.190g>t0.967
rrs1472040r.195t>g0.967
rrs1472041r.196c>t0.967
rrs1472042r.197t>g0.967
rrs1472043r.198t>a0.967
rrs1472050r.205g>c0.967
rrs1472061r.216a>t1.000
rrs1472106r.261g>a0.986
rrs1472108r.263c>t0.986
rrs1472113r.268t>c0.986
rrs1472150r.305t>a0.988
rrs1472251r.406g>a1.000
rrs1472286r.441c>g0.933
rrs1472287r.442c>t0.929
rrs1472289r.444t>g0.929
rrs1472290r.445c>g0.929
rrs1472313r.468g>a0.929
rrs1472315r.470t>g0.929
rrs1472324r.479g>c0.929
rrs1472325r.480g>c0.929
rrs1472327r.482g>a0.929
rrs1472328r.483g>c0.938
rrs1472337r.492c>g0.986
rrs1472380r.535g>c0.979
rrs1472446r.601t>a0.987
rrs1472452r.607g>a0.988
rrs1472464r.619a>g0.986
rrs1472612r.767g>t0.983
rrs1472734r.889c>t0.977
rrs1472741r.896g>a0.985
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.991
rrs1473088r.1243a>g0.991
rrs1473099r.1254t>a0.979
rrs1473104r.1259c>t0.978
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g0.978
rrs1473111r.1266a>g0.978
rrs1473121r.1276t>c0.956
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t0.983
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a0.964
rrl1473697r.40c>a0.964
rrl1473707r.50t>a0.976
rrl1473717r.60g>a0.979
rrl1473731r.74t>a0.981
rrl1473746r.89t>c0.983
rrl1473756r.99g>t0.984
rrl1473758r.101g>t0.984
rrl1473770r.113t>c0.985
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474044r.387c>t0.895
rrl1474051r.394t>c0.905
rrl1474054r.397t>c0.905
rrl1474056r.399t>c0.917
rrl1474061r.404t>c0.931
rrl1474074r.417c>t0.961
rrl1474089r.432c>t0.963
rrl1474093r.436g>a0.963
rrl1474100r.443c>t0.963
rrl1474103r.446a>c0.963
rrl1474130r.473c>t0.990
rrl1474140r.483c>t0.990
rrl1474151r.494c>t0.991
rrl1474184r.527c>a0.979
rrl1474249r.592g>t0.988
rrl1474263r.606g>a0.973
rrl1474282r.625g>a0.984
rrl1474306r.649a>c0.975
rrl1474308r.651g>t0.975
rrl1474310r.653t>g0.951
rrl1474356r.699t>c0.988
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.989
rrl1474497r.840g>c0.989
rrl1474506r.849c>g0.989
rrl1474507r.850g>c0.989
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g0.986
rrl1474722r.1065t>c0.988
rrl1474743r.1086t>g0.991
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g0.981
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t0.989
rrl1475031r.1374g>c0.943
rrl1475061r.1404ca>c0.971
rrl1475076r.1419c>a0.974
rrl1475090r.1433a>t0.977
rrl1475114r.1457c>t0.989
rrl1475120r.1463g>t0.989
rrl1475129r.1472g>a0.989
rrl1475202r.1545g>c0.985
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t0.982
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a0.979
rrl1475452r.1795c>a0.981
rrl1475475r.1818c>t0.981
rrl1475479r.1822c>t0.980
rrl1475480r.1823a>t0.980
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t0.988
rrl1475765r.2108a>t0.988
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c0.977
rrl1475993r.2336c>t0.977
rrl1475997r.2340a>t0.977
rrl1476085r.2428g>a0.967
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c0.967
rrl1476099r.2442a>g0.967
rrl1476103r.2446c>g0.967
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c0.967
rrl1476114r.2457t>c0.967
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t0.987
rrl1476160r.2503t>c0.967
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t0.989
rrl1476221r.2564t>c0.989
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c0.991
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t0.991
rrl1476299r.2642c>t0.991
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a0.992
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g0.992
rrl1476619r.2962c>t0.991
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a0.987
rrl1476666r.3009c>t0.987
rrl1476674r.3017t>c0.986
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G0.986
rpsA1833676c.135A>G0.963
rpsA1833679c.138G>T0.981
rpsA1833685c.144G>C0.980
rpsA1833691c.150G>A0.980
rpsA1833694c.153G>T0.979
rpsA1833697c.156C>T0.979
rpsA1833700c.159C>T0.980
rpsA1833709c.168C>T0.983
rpsA1833724c.183C>T0.979
rpsA1833727c.186G>C0.978
rpsA1833733c.192C>G0.956
rpsA1833734p.Ala65Ser0.956
rpsA1833742c.201A>G0.956
rpsA1833745c.204G>C0.979
rpsA1833748c.207C>G0.979
rpsA1833760c.219C>T0.983
rpsA1833787c.246C>G0.983
rpsA1833790c.249T>C0.983
rpsA1833802c.261A>G0.983
rpsA1833811c.270G>T0.982
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T0.981
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C0.960
rpsA1834520p.Ala327Ser0.960
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.960
rpsA1834543c.1002C>G0.957
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T0.955
rpsA1834555c.1014T>G0.955
rpsA1834557p.Ala339Gly0.955
rpsA1834606c.1065C>T0.958
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C0.947
rpsA1834622c.1081T>A0.947
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T0.962
rpsA1834666c.1125G>C0.964
rpsA1834667p.Ala376Ser0.966
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.976
rpsA1834705c.1164C>G0.977
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T0.975
rpsA1834776p.Ala412Glu0.975
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T0.958
rpsA1834830p.Ala430Val0.955
katG2155716c.396A>C0.941
katG2155722c.390C>T0.941
katG2155741p.Gly124Ala1.000
katG2155743c.369C>G0.188
katG2155758c.354G>T1.000
katG2155761c.351G>A1.000
katG2155766p.His116Gly1.000
katG2155769p.Ile115Val1.000
katG2155785c.327A>G1.000
katG2155794c.318C>G1.000
katG2155803c.309G>A1.000
katG2155806c.306A>G1.000
katG2155811p.Leu101Met1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
embC4240729c.867C>G0.980
embC4240735c.873C>G0.980
embC4240741c.879C>T0.980
embC4240756c.894G>C0.981
embC4240771c.909G>C0.978
embC4240772p.Ser304Ala0.978
embC4240778p.His306Gly0.977
embC4240781p.Ala307Ser0.977
embC4240789c.927T>C0.983
embC4240819c.957A>C0.966
embC4240826p.Ala322Ser0.965
embC4240831c.969T>G0.964
embC4240856p.Ala332Thr0.967
embC4240859p.Leu333Ile0.967
embC4240876c.1014C>T0.963
embC4240879c.1017G>T0.963
embC4240885c.1023T>C0.963
embC4240886p.Ile342Val0.963
embC4240897c.1035C>G0.958
embC4240900c.1038A>G0.957
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;