TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2434fbca5fc
Sample: 5d2434fbca5fc

Download results

Summary
ID: 5d2434fbca5fc
Date: Tue Jul 9 07:35:24 2019
Strain: lineage4.4;lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage4.4Euro-AmericanS;TNone
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T0.964
gyrB6184c.945C>T0.964
gyrB6193c.954G>A0.800
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.973
gyrB6775c.1536G>C0.973
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T0.985
gyrB6841c.1602T>C0.985
gyrB6862c.1623C>G0.984
gyrB6869c.1630T>C0.980
gyrB6872c.1633T>C0.980
gyrB6878c.1639T>C0.980
gyrB6889c.1650G>A0.976
gyrB6898c.1659G>T0.974
gyrB7006c.1767T>G0.950
gyrB7010p.Leu591Met0.950
gyrB7015c.1776G>A0.950
gyrB7018c.1779G>C0.950
gyrB7024c.1785G>C0.950
gyrB7033c.1794G>C0.950
gyrB7051p.Glu604Asp0.950
gyrB7060c.1821T>C0.950
gyrB7066c.1827G>T0.950
gyrB7078c.1839A>G0.950
gyrB7081c.1842T>C0.950
gyrB7084c.1845A>G0.950
gyrB7090c.1851C>T0.950
gyrB7093c.1854T>C0.950
gyrB7100c.1861T>C0.950
gyrA7499c.198G>C0.973
gyrA7511c.210C>T0.977
gyrA7523c.222C>G0.981
gyrA7526c.225G>C0.963
gyrA7547c.246C>T0.985
gyrA7553c.252C>T0.986
gyrA7559c.258G>C0.986
gyrA7565c.264C>T0.986
gyrA7574c.273G>C0.987
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.987
gyrA7595c.294C>T0.988
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T0.977
gyrA8382c.1081C>T0.968
gyrA8571c.1270C>T0.733
gyrA8576c.1275C>G0.765
gyrA8580p.Ile427Val0.789
gyrA8603c.1302A>C0.810
gyrA8609c.1308G>C0.810
gyrA8619c.1318T>C0.850
gyrA8624c.1323G>T0.850
gyrA8633c.1332C>G0.895
gyrA8636c.1335A>C0.895
gyrA8642c.1341A>G0.895
gyrA8645c.1344C>G0.895
gyrA8649p.Arg450Lys0.895
gyrA8666c.1365G>C0.895
gyrA8672c.1371A>G0.944
gyrA8693c.1392T>C0.917
gyrA8696c.1395G>C0.909
gyrA8699c.1398A>G0.909
gyrA8786c.1485T>G1.000
gyrA8792c.1491G>C0.938
gyrA8799p.Ala500Ser0.952
gyrA8810c.1509A>G0.958
gyrA8817p.Ser506Ala0.958
gyrA8828c.1527T>C0.962
gyrA8829c.1528T>C0.962
gyrA8837c.1536C>G0.971
gyrA8846c.1545C>T0.974
gyrA8852c.1551T>C0.974
gyrA8858c.1557T>C0.935
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C0.981
gyrA8945c.1644G>C0.981
gyrA8946c.1645T>C0.981
gyrA8957c.1656C>T0.979
gyrA8967p.Ala556Lys0.976
gyrA8978c.1677C>T0.975
gyrA8987c.1686C>G0.964
gyrA8990c.1689C>G0.962
gyrA8993c.1692C>T0.960
gyrA8996c.1695T>C0.960
gyrA8998p.Leu566Trp0.960
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser0.929
rpoB760361c.555T>C0.933
rpoB760370c.564C>G0.960
rpoB760376p.Asp190Glu0.964
rpoB760382c.576G>C0.967
rpoB760388c.582C>T0.970
rpoB760400c.594G>C0.949
rpoB760406c.600G>C0.864
rpoB760407p.Ser201Gly0.951
rpoB760415c.609C>T0.962
rpoB760418c.612G>C0.962
rpoB760430c.624T>C0.966
rpoB760460c.654G>C0.974
rpoB760475c.669A>G0.988
rpoB760481c.675G>C0.987
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760567c.2702 2702del1.000
rpoC763402c.33C>T0.667
rpoC763408c.39T>C0.667
rpoC763411c.42T>C0.667
rpoC763414c.45T>G0.667
rpoC763415p.Thr16Ser0.667
rpoC763423p.Glu18Asp0.800
rpoC763430c.61A>C0.800
rpoC763433p.Gln22Asn0.800
rpoC763443p.Tyr25Phe0.818
rpoC763450c.81G>A0.955
rpoC763456c.87A>G0.959
rpoC763468c.99G>C0.981
rpoC763486c.117T>C0.984
rpoC763492c.123G>C0.985
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763888c.519G>T0.923
rpoC763891c.522G>C0.923
rpoC763894c.525A>G0.933
rpoC763900c.531G>C0.974
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T1.000
rpoC764098c.729A>G1.000
rpoC764143c.774G>C0.967
rpoC764147p.Ser260Ala0.967
rpoC764150p.Ile261Val0.967
rpoC764165p.Glu266Gln0.964
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764332c.963G>A1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G0.971
rpoC764530c.1161C>G0.985
rpoC764534c.1165C>A0.970
rpoC764539c.1170C>T0.984
rpoC764542c.1173C>T0.968
rpoC764545c.1176C>A0.984
rpoC764560c.1191T>C0.974
rpoC764575c.1206T>G0.986
rpoC764611c.1242G>T0.985
rpoC764626c.1257C>T0.986
rpoC764632c.1263T>C0.986
rpoC764650c.1281G>T0.986
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C0.984
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T0.952
rpoC765129p.Tyr587Phe0.909
rpoC765143p.Val592Ile0.889
rpoC765343c.1974G>A0.857
rpoC765352c.1983G>C0.867
rpoC765356p.Met663Val0.929
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His0.970
rpoC765408c.2040 2040del1.000
rpoC765409r.2040t>g1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser0.955
rpsL781933374G>A0.955
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a0.889
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a0.986
rrs1472251r.406g>a0.972
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.981
rrs1472734r.889c>t0.980
rrs1472741r.896g>a0.978
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c1.000
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a0.982
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a0.941
rrl1473697r.40c>a0.941
rrl1473707r.50t>a0.958
rrl1473717r.60g>a0.966
rrl1473731r.74t>a0.969
rrl1473746r.89t>c0.976
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t0.952
rrl1474061r.404t>c1.000
rrl1474074r.417c>t0.944
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.880
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474412r.755ga>g1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c0.944
rrl1474632r.975g>t0.922
rrl1474636r.979a>t0.937
rrl1474637r.980c>t0.937
rrl1474638r.981c>g0.937
rrl1474639r.982g>t0.937
rrl1474640r.983c>t0.937
rrl1474717r.1060a>g0.929
rrl1474722r.1065t>c0.932
rrl1474743r.1086t>g0.952
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c0.984
rrl1475764r.2107a>t0.983
rrl1475765r.2108a>t0.983
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a0.846
rrl1476086r.2429g>a0.846
rrl1476088r.2431a>c0.923
rrl1476099r.2442a>g0.923
rrl1476103r.2446c>g0.923
rrl1476105r.2448g>a0.923
rrl1476106r.2449a>t0.923
rrl1476110r.2453g>c0.923
rrl1476114r.2457t>c0.846
rrl1476115r.2458t>c0.923
rrl1476131r.2474c>t0.968
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t0.983
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t0.976
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T0.933
inhA1674879c.678T>C0.933
inhA1674892p.Asn231Asp0.933
inhA1674903c.702T>C0.933
inhA1674904p.Ala235Pro0.933
inhA1674909c.708G>A0.933
inhA1674912c.711G>C0.933
inhA1674915c.714C>G0.933
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
inhA1674993c.792G>T0.929
rpsA1833536c.-6A>C0.957
rpsA1833538c.-4CA>C0.957
rpsA1833541c.-1T>C0.957
rpsA1833547c.6G>A0.970
rpsA1833589c.48A>C0.982
rpsA1833595c.54T>G0.982
rpsA1833596p.Ser19Ala0.982
rpsA1833604c.63C>T0.985
rpsA1833616c.75A>T0.986
rpsA1833619c.78A>C0.987
rpsA1833625c.84A>G0.988
rpsA1833664c.123C>G0.986
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G0.964
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C0.987
rpsA1833949c.408T>C0.987
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T0.981
rpsA1834451c.910T>C0.982
rpsA1834456c.915T>G0.982
rpsA1834468c.927A>G0.983
rpsA1834477c.936C>T0.982
rpsA1834489c.948T>C0.983
rpsA1834519c.978G>C0.974
rpsA1834520p.Ala327Ser0.974
rpsA1834528c.987T>C0.975
rpsA1834534c.993C>T0.975
rpsA1834543c.1002C>G0.974
rpsA1834546c.1005T>C0.974
rpsA1834552c.1011G>T0.972
rpsA1834555c.1014T>G0.972
rpsA1834557p.Ala339Gly0.972
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834701p.Gln387Pro0.982
rpsA1834720c.1179C>G0.985
rpsA1834732c.1191T>C0.971
rpsA1834738c.1197A>G0.971
rpsA1834753c.1212T>C0.970
rpsA1834759c.1218A>C0.969
rpsA1834765p.Glu408Asp0.967
rpsA1834774c.1233C>T0.953
rpsA1834776p.Ala412Glu0.953
rpsA1834780c.1239A>G0.953
rpsA1834789c.1248T>C0.953
rpsA1834813c.1272G>T0.933
rpsA1834830p.Ala430Val0.962
kasA2518738c.624G>C0.964
kasA2518756c.642G>C0.971
kasA2518768c.654C>G0.972
kasA2518771c.657C>G0.972
kasA2518774c.660C>T0.972
kasA2518783c.669T>G0.972
kasA2518787p.Arg225Lys0.972
kasA2518792c.678C>T0.972
kasA2518795c.681C>T0.973
kasA2518798c.684G>C0.975
kasA2518822c.708C>A0.970
kasA2518825c.711T>C0.970
kasA2518846c.732G>T0.982
kasA2518849c.735G>C0.981
kasA2518853p.Leu247Val0.981
kasA2518864c.750G>C0.979
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C0.971
embB4248232c.1719G>T0.943
embB4248233p.Leu574Val0.971
embB4248236p.Met575Leu0.944
embB4248245p.Ile578Val0.959
embB4248250c.1737C>T0.962
embB4248259p.Met582Ile0.964
embB4248275p.Thr588Ala0.964
embB4248292c.1779G>A0.964

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;