TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d245ee66b576
Sample: 5d245ee66b576

Download results

Summary
ID: 5d245ee66b576
Date: Tue Jul 9 10:34:11 2019
Strain: lineage4;lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.957
gyrB6115c.876A>G0.960
gyrB6121c.882C>T0.960
gyrB6127c.888G>C0.960
gyrB6133c.894G>C0.960
gyrB6136c.897G>A0.958
gyrB6151c.912C>T0.960
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.985
gyrB6775c.1536G>C0.984
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6865c.1626G>A1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T0.976
gyrA7523c.222C>G0.980
gyrA7526c.225G>C0.980
gyrA7547c.246C>T0.985
gyrA7553c.252C>T0.985
gyrA7559c.258G>C0.986
gyrA7565c.264C>T0.987
gyrA7574c.273G>C0.988
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.989
gyrA7595c.294C>T0.988
gyrA7607c.306C>T0.988
gyrA7637c.336C>A0.984
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T0.974
gyrA8382c.1081C>T0.968
gyrA8799p.Ala500Ser0.923
gyrA8810c.1509A>G0.938
gyrA8817p.Ser506Ala0.938
gyrA8828c.1527T>C0.950
gyrA8829c.1528T>C0.950
gyrA8837c.1536C>G0.952
gyrA8840c.1539C>T0.952
gyrA8846c.1545C>T0.971
gyrA8852c.1551T>C0.976
gyrA8858c.1557T>C0.977
gyrA8870c.1569G>C0.981
gyrA8873c.1572A>G0.981
gyrA8897c.1596T>C0.985
gyrA8903c.1602T>C0.985
gyrA8915c.1614A>G0.986
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A0.962
rpoB760091c.285G>C0.969
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C0.958
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.977
rpoB760406r.600ga>g1.000
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760793c.987A>G0.909
rpoB760805c.999G>C0.941
rpoB760817c.1011A>G0.962
rpoB760820c.1014T>C0.962
rpoB760826c.1020C>G0.939
rpoB760830c.1024T>C0.970
rpoB760841c.1035T>C0.976
rpoB760858p.Val351Ala0.958
rpoB760862c.1056G>C0.958
rpoB760865c.1059C>T0.958
rpoB760886p.Glu360Asp0.982
rpoB760887p.Thr361Val0.964
rpoB760910c.1104C>T0.984
rpoB760916c.1110C>T0.984
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C0.985
rpoB761171c.1365C>T0.984
rpoB761178p.Ser458Thr0.982
rpoB761186p.Glu460Asp0.967
rpoB761189c.1383T>C0.983
rpoB761195c.1389G>C0.966
rpoB761198c.1392G>C0.967
rpoB761219c.1413G>C0.973
rpoB761234c.1428G>C0.972
rpoB761249c.1443A>G0.974
rpoB761255c.1449T>G0.971
rpoB761258c.1452G>A0.970
rpoB761261c.1455G>C0.955
rpoB761264c.1458C>G0.956
rpoB761273c.1467T>C0.987
rpoB761318c.1512G>T0.985
rpoB761327c.1521A>G0.983
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.956
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T0.977
rpoB761666c.1860G>C0.962
rpoB761669c.1863C>T0.958
rpoB761675c.1869G>T0.958
rpoB761681c.1875G>A0.952
rpoB761682c.1876C>T0.952
rpoB761687c.1881C>T0.950
rpoB761690c.1884G>C0.950
rpoB761693c.1887G>C0.950
rpoB761705c.1899C>A0.941
rpoB761891c.2085G>C1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762507c.2702 2702del1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G0.944
rpoC763708c.339G>C0.944
rpoC763711c.342G>C0.944
rpoC763714c.345G>C0.944
rpoC763717c.348T>C0.944
rpoC763723c.354G>C0.944
rpoC763732c.363C>A0.941
rpoC763741c.372C>T0.938
rpoC763744c.375G>C0.938
rpoC763747c.378G>A0.929
rpoC763765c.396T>C0.917
rpoC763888c.519G>T1.000
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T0.964
rpoC764059c.690G>T0.964
rpoC764083c.714A>G0.964
rpoC764084p.Asn239Val0.964
rpoC764095c.726C>T0.964
rpoC764098c.729A>G0.964
rpoC764143c.774G>C0.947
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val0.929
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G0.900
rpoC764317c.948C>G0.917
rpoC764320c.951C>G0.938
rpoC764332c.963G>A0.960
rpoC764338c.969G>A0.962
rpoC764353c.984G>T0.970
rpoC764365c.996C>T0.970
rpoC764371c.1002G>C0.973
rpoC764377c.1008C>G0.973
rpoC764380c.1011G>C0.974
rpoC764387c.1018T>C0.952
rpoC764405c.1036A>C0.960
rpoC764428c.1059G>C0.980
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T1.000
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C0.988
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T0.986
rpoC764692c.1323C>T0.985
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.982
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764896c.1527C>T1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C0.979
rpoC765004c.1635G>C0.960
rpoC765007c.1638T>G0.958
rpoC765008c.1639T>C0.958
rpoC765011c.1642A>T0.958
rpoC765016c.1647C>G0.960
rpoC765019c.1650A>G0.960
rpoC765040c.1671T>C0.970
rpoC765041c.1672T>C0.970
rpoC765047c.1678T>C0.970
rpoC765055c.1686C>G0.969
rpoC765073c.1704G>C0.941
rpoC765076c.1707A>G0.938
rpoC765079c.1710T>G0.923
rpoC765082c.1713G>C0.923
rpoC765085c.1716T>C0.923
rpoC765089c.1720T>C0.923
rpoC765100c.1731G>C0.923
rpoC765103c.1734G>T0.923
rpoC765121c.1752G>T1.000
rpoC765129p.Tyr587Phe1.000
rpoC765343c.1974G>A0.833
rpoC765352c.1983G>C0.857
rpoC765356p.Met663Val0.923
rpoC765370c.2001G>C0.944
rpoC765379c.2010G>C0.947
rpoC765382c.2013G>T0.947
rpoC765383p.Met672Leu0.947
rpoC765403c.2034G>C0.971
rpoC765405p.Leu679His0.971
rpoC765409c.2040T>G0.971
rpoC765421c.2052C>G0.976
rpoC765449p.Ala694Ser0.979
rpoC765454c.2085C>G0.979
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G0.983
rpoC765517c.2148C>G0.981
rpoC765533p.Tyr722His0.978
rpoC765544c.2175C>G0.964
rpoC765547c.2178C>T0.931
rpoC765548c.2179A>T0.931
rpoC765553c.2184C>T0.931
rpoC765556c.2187G>C0.931
rpoC765562c.2193G>T0.931
rpoC765826c.2457T>C0.975
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765886c.2517C>T1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C0.972
rpoC766570c.3201T>C0.973
rpoC766573c.3204T>G0.973
rpoC766594c.3225G>T0.973
rpoC766607p.Ile1080Leu0.973
rpoC766618c.3249G>T0.972
rpoC766624c.3255G>C0.970
rpoC766630c.3261G>C0.963
rpoC766633c.3264G>C0.962
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser0.976
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C0.985
rpoC766996c.3627C>T0.988
rpoC767002c.3633G>C0.988
rpoC767008c.3639G>A0.989
rpoC767023c.3654C>T0.987
rpoC767044c.3675G>C0.987
rpoC767080c.3711G>C0.985
rpoC767098c.3729T>C0.984
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn0.980
rpsL781586c.27C>T0.984
rpsL781595c.36T>C0.986
rpsL781608p.Ser17Ala0.986
rpsL781616c.57C>G0.988
rpsL781628c.69T>C0.977
rpsL781649c.90T>C0.990
rpsL781655c.96T>C0.989
rpsL781658c.99A>C0.989
rpsL781670c.111G>C0.988
rpsL781706c.147T>C0.981
rpsL781715c.156T>G1.000
rpsL781772c.213C>T0.974
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a0.964
rrs1472031r.186g>c0.964
rrs1472032r.187g>a0.964
rrs1472033r.188a>c0.964
rrs1472035r.190g>t0.964
rrs1472040r.195t>g0.964
rrs1472041r.196c>t0.964
rrs1472042r.197t>g0.964
rrs1472043r.198t>a0.964
rrs1472050r.205g>c0.964
rrs1472061r.216a>t0.980
rrs1472106r.261g>a0.964
rrs1472108r.263c>t0.963
rrs1472113r.268t>c0.964
rrs1472150r.305t>a0.974
rrs1472251r.406g>a1.000
rrs1472337r.492c>g0.979
rrs1472380r.535g>c0.985
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.966
rrs1472734r.889c>t0.988
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.976
rrs1473088r.1243a>g0.975
rrs1473099r.1254t>a0.971
rrs1473104r.1259c>t0.970
rrs1473105r.1260g>a0.970
rrs1473110r.1265t>g0.970
rrs1473111r.1266a>g0.971
rrs1473121r.1276t>c0.885
rrs1473123r.1278a>t0.979
rrs1473129r.1284c>t0.982
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473697r.40c>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a0.983
rrl1473876r.219g>a0.963
rrl1473887r.230t>c0.977
rrl1473888r.231t>c0.977
rrl1473898r.241c>t0.975
rrl1473899r.242a>g0.950
rrl1473916r.259c>a0.947
rrl1473923r.266c>g0.933
rrl1473937r.280c>t0.920
rrl1473943r.286g>t0.913
rrl1473945r.288t>a0.913
rrl1473946r.289a>t0.913
rrl1473950r.293g>t0.913
rrl1474044r.387c>t0.909
rrl1474051r.394t>c0.917
rrl1474054r.397t>c0.917
rrl1474056r.399t>c0.933
rrl1474061r.404t>c0.944
rrl1474074r.417c>t0.964
rrl1474089r.432c>t0.967
rrl1474093r.436g>a0.967
rrl1474100r.443c>t0.967
rrl1474103r.446a>c0.967
rrl1474130r.473c>t0.981
rrl1474140r.483c>t0.984
rrl1474151r.494c>t0.985
rrl1474181r.524c>ct0.871
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t0.969
rrl1474263r.606g>a0.970
rrl1474282r.625g>a0.963
rrl1474291r.634t>c0.974
rrl1474292r.635t>g0.973
rrl1474310r.653t>g0.974
rrl1474356r.699t>c0.966
rrl1474362r.705a>g0.981
rrl1474387r.730c>t0.978
rrl1474412r.755ga>g0.974
rrl1474413r.756a>c0.963
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.964
rrl1474496r.839c>g0.983
rrl1474497r.840g>c0.982
rrl1474506r.849c>g0.983
rrl1474507r.850g>c0.983
rrl1474626r.969t>c0.979
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g0.986
rrl1474913r.1256t>c0.984
rrl1474932r.1275c>t0.982
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t0.972
rrl1475479r.1822c>t0.971
rrl1475480r.1823a>t0.971
rrl1475505r.1848g>a0.964
rrl1475526r.1869c>a0.968
rrl1475531r.1874c>t0.967
rrl1475573r.1916g>a0.938
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c0.985
rrl1475764r.2107a>t0.983
rrl1475765r.2108a>t0.983
rrl1475975r.2318c>t0.971
rrl1475977r.2320a>g0.971
rrl1475988r.2331a>g0.963
rrl1475989r.2332t>c0.963
rrl1475993r.2336c>t0.963
rrl1475997r.2340a>t0.963
rrl1476085r.2428g>a0.917
rrl1476086r.2429g>a0.917
rrl1476088r.2431a>c0.917
rrl1476099r.2442a>g0.917
rrl1476103r.2446c>g0.917
rrl1476105r.2448g>a0.917
rrl1476106r.2449a>t0.917
rrl1476110r.2453g>c0.917
rrl1476114r.2457t>c0.917
rrl1476115r.2458t>c0.885
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c0.982
rrl1476214r.2557g>t0.964
rrl1476215r.2558c>t0.964
rrl1476221r.2564t>c0.963
rrl1476224r.2567a>g0.964
rrl1476251r.2594t>c0.969
rrl1476281r.2624t>c0.986
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674855c.654C>G1.000
inhA1674858c.657G>A1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G0.984
rpsA1833676c.135A>G0.981
rpsA1833679c.138G>T0.980
rpsA1833685c.144G>C0.979
rpsA1833691c.150G>A0.978
rpsA1833694c.153G>T0.978
rpsA1833697c.156C>T0.978
rpsA1833700c.159C>T0.980
rpsA1833709c.168C>T0.987
rpsA1833724c.183C>T0.986
rpsA1833727c.186G>C0.986
rpsA1833733c.192C>G0.986
rpsA1833734p.Ala65Ser0.986
rpsA1833742c.201A>G0.986
rpsA1833745c.204G>C0.986
rpsA1833748c.207C>G0.986
rpsA1833760c.219C>T0.988
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.989
rpsA1833832c.291G>A0.988
rpsA1833838c.297G>C0.986
rpsA1833841c.300C>G0.986
rpsA1833847c.306C>G0.986
rpsA1833856c.315A>G0.985
rpsA1833862c.321G>T0.985
rpsA1833874c.333T>G0.986
rpsA1833886c.345C>G0.957
rpsA1833894p.Ala118Glu0.957
rpsA1833928c.387G>C0.958
rpsA1833949c.408T>C0.952
rpsA1833961c.420C>G0.954
rpsA1833970c.429G>T0.967
rpsA1833979c.438T>C0.968
rpsA1833991c.450C>G0.969
rpsA1834000c.459G>C0.968
rpsA1834009c.468C>T0.983
rpsA1834012c.471G>C0.982
rpsA1834015c.474G>C0.983
rpsA1834021c.480C>T0.983
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C0.985
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.983
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C0.969
kasA2518768c.654C>G0.971
kasA2518771c.657C>A0.971
kasA2518774c.660C>T0.971
kasA2518783c.669T>G0.971
kasA2518787p.Arg225Lys0.971
kasA2518792c.678C>T0.971
kasA2518795c.681C>T0.971
kasA2518798c.684G>C0.971
kasA2518822c.708C>A0.982
kasA2518825c.711T>C0.982
kasA2518846c.732G>T0.961
kasA2518849c.735G>C0.961
kasA2518853p.Leu247Val0.961
kasA2518864c.750G>C0.957
panD4044138c.144A>G0.944
panD4044150c.132T>G0.947
panD4044156c.126T>C0.947
panD4044167c.115G>A0.947
panD4044171c.111G>A0.947
panD4044174c.108G>A0.947
panD4044180p.Asp34Glu0.947
panD4044188c.94C>G0.947
panD4044189c.93G>A0.947
panD4044194p.Ala30Pro0.947
panD4044195c.87A>G0.955
panD4044233p.Cys17His0.974
panD4044234c.48G>C0.974
panD4044249c.33G>A0.974
panD4044266p.Leu6Met0.971
panD4044273c.9C>G0.967
panD4044276p.Leu2Phe0.964
embC4240729c.867C>G0.983
embC4240735c.873C>G0.983
embC4240741c.879C>T0.983
embC4240756c.894G>C0.985
embC4240771c.909G>C0.982
embC4240772p.Ser304Ala0.982
embC4240778p.His306Gly0.980
embC4240781p.Ala307Ser0.981
embC4240789c.927T>C0.986
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;