TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d25791cc92a7
Sample: 5d25791cc92a7

Download results

Summary
ID: 5d25791cc92a7
Date: Wed Jul 10 06:38:16 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.929
gyrB6115c.876A>G0.935
gyrB6121c.882C>T0.935
gyrB6127c.888G>C0.935
gyrB6133c.894G>C0.935
gyrB6136c.897G>A0.967
gyrB6151c.912C>T0.967
gyrB6172c.933C>T0.967
gyrB6184c.945C>T0.967
gyrB6193c.954G>A0.941
gyrB6196c.957C>T0.929
gyrB6202c.963C>T0.900
gyrB6203p.Ser322Ala0.900
gyrB6214c.975G>C0.900
gyrB6223c.984G>C0.900
gyrB6655c.1416T>C0.938
gyrB6664c.1425C>T0.955
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C0.981
gyrB6775c.1536G>C0.983
gyrB6793c.1554T>C0.983
gyrB6798p.Gly520Ala0.983
gyrB6808c.1569C>G0.981
gyrB6824c.1585C>T0.957
gyrB6838c.1599C>T0.952
gyrB6841c.1602T>C0.952
gyrB6862c.1623C>G0.951
gyrB6869c.1630T>C0.943
gyrB6872c.1633T>C0.938
gyrB6878c.1639T>C0.938
gyrB6889c.1650G>A0.931
gyrB6898c.1659G>C0.875
gyrB6988c.1749C>G0.900
gyrB7006c.1767T>G0.941
gyrB7010p.Leu591Met0.944
gyrB7015c.1776G>A0.950
gyrB7018c.1779G>C0.952
gyrB7024c.1785G>A0.958
gyrB7033c.1794G>C0.963
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7343c.42G>C1.000
gyrA7355c.54T>A1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7412c.111C>G1.000
gyrA7421c.120G>C1.000
gyrA7424c.123G>C1.000
gyrA7427c.126G>C1.000
gyrA7433c.132G>C1.000
gyrA7439c.138C>T0.957
gyrA7442c.141G>C0.955
gyrA7451c.150C>A0.941
gyrA7457c.156T>C0.917
gyrA7499c.198G>C0.976
gyrA7511c.210C>T0.977
gyrA7523c.222C>G0.980
gyrA7526c.225G>C0.981
gyrA7547c.246C>T0.984
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C0.952
gyrA8129c.828T>C0.952
gyrA8156c.855T>C0.952
gyrA8168c.867A>G0.952
gyrA8174c.873C>G0.952
gyrA8177c.876A>C0.952
gyrA8187p.Leu296Ile0.917
gyrA8192c.891C>G0.917
gyrA8198c.897T>C0.909
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G0.974
gyrA8340p.Ala347Ser0.974
gyrA8354c.1053G>C1.000
gyrA8366c.1065G>A1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>T1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G0.929
gyrA8817p.Ser506Ala0.929
gyrA8828c.1527T>C0.938
gyrA8829c.1528T>C0.938
gyrA8837c.1536C>G0.944
gyrA8840c.1539C>T0.950
gyrA8846c.1545C>T0.969
gyrA8852c.1551T>C0.970
gyrA8858c.1557T>C0.972
gyrA8870c.1569G>C0.958
gyrA8873c.1572A>G0.979
gyrA8897c.1596T>C0.984
gyrA8903c.1602T>C0.984
gyrA8915c.1614A>G0.986
gyrA8924c.1623C>T0.986
gyrA8942c.1641G>C0.983
gyrA8945c.1644G>C0.983
gyrA8946c.1645T>C0.983
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
gyrA9023c.1722A>C1.000
gyrA9026c.1725G>C1.000
gyrA9029c.1728T>C1.000
gyrA9032c.1731T>C1.000
gyrA9035c.1734G>C1.000
gyrA9044c.1743C>G1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760142c.336C>T1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.952
rpoB760406r.600ga>g0.976
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>T1.000
rpoB760484c.678A>G1.000
rpoB760499c.693G>A0.982
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760553c.747C>G0.975
rpoB760561c.756 757del1.000
rpoC763435p.Gln22His1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C0.986
rpoC763492c.123G>C0.986
rpoC763528c.159G>A0.974
rpoC763531c.162G>T0.974
rpoC763546c.177A>G0.962
rpoC763570c.201G>C0.948
rpoC763594c.225C>T0.944
rpoC763609c.240C>T0.946
rpoC763621c.252C>T0.946
rpoC763633c.264T>C0.955
rpoC763657c.288G>A0.940
rpoC763660c.291T>G0.939
rpoC763666c.297G>C0.939
rpoC763669c.300C>G0.939
rpoC763675c.306C>G0.939
rpoC763696c.327T>C0.941
rpoC763699c.330G>T0.941
rpoC763702c.333C>G0.938
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>G1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763879c.510A>G1.000
rpoC763888c.519G>T1.000
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764098c.729A>G1.000
rpoC764110c.741C>T1.000
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G0.950
rpoC764317c.948C>G0.950
rpoC764320c.951C>G0.960
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764362c.993C>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>T1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G0.979
rpoC764435c.1066A>C0.979
rpoC764452c.1083T>C0.984
rpoC764458c.1089G>C0.984
rpoC764461c.1092A>G0.983
rpoC764497c.1128A>G0.981
rpoC764509c.1140G>A0.979
rpoC764510c.1141C>T0.979
rpoC764521c.1152T>C0.978
rpoC764527c.1158C>T0.974
rpoC764530c.1161C>T0.974
rpoC764533c.1164C>A0.973
rpoC764536c.1167G>T0.973
rpoC764539c.1170C>G0.973
rpoC764545c.1176C>A0.983
rpoC764575c.1206T>G0.982
rpoC764593c.1224C>T0.984
rpoC764611c.1242G>T0.982
rpoC764626c.1257C>T0.984
rpoC764632c.1263T>C0.984
rpoC764650c.1281G>T0.986
rpoC764668c.1299C>T1.000
rpoC764683c.1314G>A0.985
rpoC764692c.1323C>T0.986
rpoC764713c.1344G>T0.986
rpoC764716c.1347G>C0.986
rpoC764746c.1377G>T0.987
rpoC764752c.1383G>C0.987
rpoC764758c.1389C>G0.987
rpoC764764c.1395T>C0.987
rpoC764791c.1422C>G0.986
rpoC764803c.1434C>T0.985
rpoC764809c.1440C>T0.982
rpoC764810p.Pro481Ala0.983
rpoC764815c.1446A>G0.983
rpoC764824c.1455T>C0.983
rpoC764827c.1458G>C0.983
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.983
rpoC764875c.1506C>A0.983
rpoC764887c.1518G>C0.982
rpoC764888c.1519T>C0.982
rpoC764911c.1542A>G0.983
rpoC764912p.Met515Gln0.983
rpoC764932c.1563C>A0.973
rpoC764948c.1579T>C0.971
rpoC764968c.1599T>C0.968
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>A1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765529c.2160C>T1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765895c.2526G>A0.979
rpoC765907c.2538G>T0.979
rpoC765910c.2541G>C0.978
rpoC765928c.2559C>G0.976
rpoC765940c.2571A>T0.975
rpoC765947c.2578T>C0.971
rpoC765962c.2593T>C0.957
rpoC765967c.2598C>T0.952
rpoC765973c.2604C>G0.952
rpoC765979c.2610C>G0.952
rpoC765982c.2613C>T0.952
rpoC765994c.2625A>T0.947
rpoC766003c.2634G>C0.938
rpoC766009c.2640G>C0.917
rpoC766012c.2643C>G0.917
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G0.979
rpoC766375c.3006C>G0.979
rpoC766381c.3012C>T0.980
rpoC766384c.3015A>G0.980
rpoC766390c.3021C>T0.981
rpoC766393c.3024C>T0.981
rpoC766408c.3039C>T0.984
rpoC766435p.Glu1022Asp0.984
rpoC766501c.3132G>C0.944
rpoC766507c.3138C>T0.944
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766975c.3606C>T1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767180p.Ala1271Ser0.981
rpoC767191c.3822C>G0.980
rpoC767197c.3828G>A0.980
rpoC767203c.3834C>G0.976
rpoC767206c.3837C>G0.974
rpoC767209c.3840T>C0.974
rpoC767212c.3843G>C0.975
rpoC767221c.3852C>G0.979
rpoC767230c.3861G>C0.977
rpoC767233c.3864T>C0.979
rpoC767254c.3885G>C0.976
rpoC767264p.Ala1299Ser0.971
rpoC767267p.Ala1300Asn0.970
rpoC767281c.3912C>G0.969
rpoC767284c.3915C>G0.969
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C0.982
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472286r.441c>g0.900
rrs1472337r.492c>g0.970
rrs1472380r.535g>c0.979
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t0.974
rrs1472847r.1002g>a1.000
rrs1472860r.1015c>t0.970
rrs1472861r.1016g>a0.941
rrs1472956r.1111t>c0.963
rrs1472957r.1112c>t0.963
rrs1472969r.1124a>g0.955
rrs1472970r.1125c>g0.955
rrs1472977r.1132g>c0.955
rrs1472978r.1133t>c0.955
rrs1472989r.1144g>a0.962
rrs1472990r.1145a>g0.963
rrs1473082r.1237g>a0.951
rrs1473088r.1243a>g0.950
rrs1473099r.1254t>a0.944
rrs1473104r.1259c>t0.968
rrs1473105r.1260g>a0.968
rrs1473110r.1265t>g0.968
rrs1473111r.1266a>g0.968
rrs1473121r.1276t>c0.947
rrs1473123r.1278a>t0.974
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.872
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a0.968
rrl1474291r.634tttcctctccggagga>t1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t0.971
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g1.000
rrl1474497r.840g>c0.971
rrl1474506r.849c>g0.971
rrl1474507r.850g>c0.971
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t0.917
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a0.970
rrl1474830r.1173a>g0.974
rrl1474913r.1256t>c0.931
rrl1474932r.1275c>t0.955
rrl1475031r.1374g>c0.895
rrl1475061r.1404ca>c0.955
rrl1475076r.1419c>a0.958
rrl1475090r.1433a>t0.966
rrl1475114r.1457c>t0.966
rrl1475120r.1463g>t0.966
rrl1475129r.1472g>a0.964
rrl1475202r.1545g>c0.962
rrl1475209r.1552g>a0.957
rrl1475213r.1556c>t0.957
rrl1475220r.1563g>t0.957
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t0.941
rrl1476594r.2937c>t0.943
rrl1476597r.2940g>a0.946
rrl1476603r.2946g>a0.951
rrl1476608r.2951c>g0.952
rrl1476619r.2962c>t0.974
rrl1476628r.2971t>a0.973
rrl1476665r.3008t>a0.950
rrl1476666r.3009c>t0.950
rrl1476674r.3017t>c0.947
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A0.962
rpsA1833589c.48A>C0.977
rpsA1833595c.54T>G0.977
rpsA1833596p.Ser19Ala0.977
rpsA1833604c.63C>T0.983
rpsA1833616c.75A>T0.984
rpsA1833619c.78A>C0.984
rpsA1833625c.84A>G0.985
rpsA1833664c.123C>G0.985
rpsA1833676c.135A>G0.984
rpsA1833679c.138G>T0.984
rpsA1833685c.144G>C0.983
rpsA1833691c.150G>A0.982
rpsA1833694c.153G>T0.982
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.980
rpsA1833734p.Ala65Ser0.980
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833835c.294C>T0.956
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G0.981
rpsA1833862c.321G>T0.985
rpsA1833874c.333T>G0.985
rpsA1833877c.336C>G0.955
rpsA1833886c.345C>G0.973
rpsA1833894p.Ala118Glu0.972
rpsA1833928c.387G>C0.971
rpsA1833949c.408T>C0.972
rpsA1833958c.417C>T0.956
rpsA1833961c.420C>G0.971
rpsA1833970c.429G>T0.971
rpsA1833979c.438T>C0.970
rpsA1833991c.450C>G0.945
rpsA1834000c.459G>C0.986
rpsA1834009c.468C>T0.983
rpsA1834012c.471G>C0.981
rpsA1834015c.474G>C0.981
rpsA1834021c.480C>T0.981
rpsA1834030c.489C>G0.981
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C0.960
rpsA1834327c.786G>T1.000
rpsA1834348c.807T>C1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>T1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C0.988
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834516c.975G>A0.985
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C0.975
rpsA1834738c.1197A>G0.988
rpsA1834747c.1206A>G0.988
rpsA1834759c.1218A>C0.987
rpsA1834765p.Glu408Asp0.986
rpsA1834774c.1233C>T0.985
rpsA1834776p.Ala412Glu0.984
rpsA1834780c.1239A>G0.984
rpsA1834789c.1248T>C0.984
rpsA1834813c.1272G>T0.981
rpsA1834830p.Ala430Val0.979
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044150c.132T>G1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044240c.42C>G1.000
panD4044249c.33G>A1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;