TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d25877252889
Sample: 5d25877252889

Download results

Summary
ID: 5d25877252889
Date: Wed Jul 10 07:39:27 2019
Strain: lineage2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.944
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6655c.1416T>C0.889
gyrB6673c.1434A>C0.933
gyrB6676c.1437T>G0.935
gyrB6700c.1461T>C0.938
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T0.973
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.978
gyrB6775c.1536G>C0.917
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7006c.1767T>G0.909
gyrB7010p.Leu591Met0.909
gyrB7015c.1776G>A0.909
gyrB7018c.1779G>C0.909
gyrB7024c.1785G>C0.909
gyrB7033c.1794G>C0.909
gyrB7051p.Glu604Asp0.909
gyrB7060c.1821T>C0.909
gyrB7066c.1827G>T0.909
gyrB7078c.1839A>G0.909
gyrB7081c.1842T>C0.909
gyrB7084c.1845A>G0.909
gyrB7090c.1851C>T0.909
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>A1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T0.984
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T0.987
gyrA7637c.336C>A1.000
gyrA8156c.855T>C0.800
gyrA8159c.858G>C0.800
gyrA8168c.867A>G0.800
gyrA8174c.873C>G0.800
gyrA8177c.876A>C0.800
gyrA8187p.Leu296Ile0.800
gyrA8192c.891C>G0.800
gyrA8198c.897T>C0.800
gyrA8207c.906T>C0.800
gyrA8267c.966G>C0.968
gyrA8283p.Ile328Leu0.971
gyrA8288c.987T>C0.971
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T0.981
gyrA8330c.1029C>G0.981
gyrA8339c.1038A>G0.981
gyrA8340p.Ala347Ser0.981
gyrA8354c.1053G>C0.981
gyrA8382c.1081C>T0.975
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C0.909
gyrA8672c.1371A>G0.909
gyrA8783c.1482G>C0.909
gyrA8786c.1485T>G0.917
gyrA8792c.1491G>C0.941
gyrA8799p.Ala500Ser0.955
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C0.981
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.935
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala0.966
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760793c.987A>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C0.967
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G0.952
rpoB760991c.1185G>T0.952
rpoB760997c.1191G>C0.967
rpoB761006c.1200C>G0.970
rpoB761015c.1209G>C0.974
rpoB761027c.1221A>C0.972
rpoB761036c.1230G>C0.971
rpoB761037c.1231T>C0.971
rpoB761051c.1245G>T0.971
rpoB761054c.1248G>C0.971
rpoB761057c.1251G>C0.971
rpoB761060c.1254C>G0.971
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761219c.1413G>C1.000
rpoB761234c.1428G>C1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C1.000
rpoB761264c.1458C>G0.983
rpoB761273c.1467T>C1.000
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G0.979
rpoB761333c.1527G>T0.978
rpoB761339c.1533C>G0.976
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.982
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T0.985
rpoB761615c.1809A>C0.985
rpoB761636c.1830G>T0.984
rpoB761645c.1839C>G0.967
rpoB761657c.1851C>T0.964
rpoB761666c.1860G>C0.941
rpoB761669c.1863C>T0.939
rpoB761675c.1869G>T0.929
rpoB761681c.1875G>A0.926
rpoB761682c.1876C>T0.926
rpoB761687c.1881C>T0.926
rpoB761690c.1884G>C0.926
rpoB761693c.1887G>C0.926
rpoB761705c.1899C>A0.913
rpoB761891c.2085G>C1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C0.974
rpoB761936c.2130C>T0.975
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val0.981
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C0.986
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T0.982
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A0.980
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C0.985
rpoB762236c.2430G>C0.985
rpoB762245c.2439G>C0.986
rpoB762275c.2469C>T0.983
rpoB762284c.2478G>C0.982
rpoB762293c.2487T>C0.978
rpoB762296c.2490G>C0.978
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G0.895
rpoB762510p.Ala902Pro0.895
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762557c.2751G>A1.000
rpoB762560c.2754A>C1.000
rpoB762563c.2757G>T1.000
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T0.970
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G0.985
rpoB763034c.3228C>G0.970
rpoB763040c.3234C>G0.970
rpoB763070c.3264T>C0.968
rpoB763082c.3276C>T0.965
rpoB763088c.3282C>G0.966
rpoB763094c.3288G>C0.966
rpoB763115c.3309T>C0.962
rpoB763127c.3321G>C0.961
rpoB763136c.3330C>T0.977
rpoB763145c.3339G>A0.977
rpoB763157c.3351G>T0.972
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763193c.3387C>G1.000
rpoC763402c.33C>T0.933
rpoC763408c.39T>C0.933
rpoC763411c.42T>C0.933
rpoC763414c.45T>G0.933
rpoC763415p.Thr16Ser0.933
rpoC763423p.Glu18Asp0.933
rpoC763430c.61A>C0.933
rpoC763433p.Gln22Asn0.933
rpoC763443p.Tyr25Phe0.941
rpoC763450c.81G>A0.976
rpoC763456c.87A>G0.977
rpoC763468c.99G>C0.979
rpoC763486c.117T>C0.981
rpoC763492c.123G>C0.983
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C0.973
rpoC763669c.300C>G0.972
rpoC763675c.306C>G0.973
rpoC763696c.327T>C0.944
rpoC763699c.330G>T0.941
rpoC763702c.333C>G0.941
rpoC763708c.339G>C0.938
rpoC763711c.342G>C0.938
rpoC763714c.345G>C0.938
rpoC763717c.348T>C0.938
rpoC763723c.354G>C0.938
rpoC763732c.363C>A0.933
rpoC763741c.372C>T0.933
rpoC763744c.375G>C0.933
rpoC763747c.378G>A0.933
rpoC763765c.396T>C0.917
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu0.933
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T0.975
rpoC764083c.714A>G0.976
rpoC764084p.Asn239Val0.976
rpoC764095c.726C>T0.976
rpoC764098c.729A>G0.976
rpoC764143c.774G>C0.913
rpoC764147p.Ser260Ala0.913
rpoC764150p.Ile261Val0.913
rpoC764165p.Glu266Gln0.909
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764332c.963G>A1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C0.979
rpoC764428c.1059G>C0.982
rpoC764431c.1062G>C0.982
rpoC764434c.1065A>G0.982
rpoC764435c.1066A>C0.982
rpoC764458c.1089G>C0.973
rpoC764461c.1092A>G0.973
rpoC764497c.1128A>G0.963
rpoC764510c.1141C>T0.953
rpoC764524c.1155C>G0.961
rpoC764530c.1161C>G0.955
rpoC764534c.1165C>A0.954
rpoC764539c.1170C>T0.954
rpoC764542c.1173C>T0.937
rpoC764545c.1176C>A0.937
rpoC764560c.1191T>C0.947
rpoC764575c.1206T>G0.955
rpoC764611c.1242G>T0.972
rpoC764626c.1257C>T0.985
rpoC764632c.1263T>C0.984
rpoC764650c.1281G>T0.983
rpoC764668c.1299C>T0.965
rpoC764692c.1323C>T0.983
rpoC764713c.1344G>T0.980
rpoC764716c.1347G>C0.981
rpoC764746c.1377G>T0.981
rpoC764752c.1383G>C0.982
rpoC764758c.1389C>G0.983
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G0.981
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C0.968
rpoC765076c.1707A>G0.964
rpoC765079c.1710T>G0.962
rpoC765082c.1713G>C0.962
rpoC765085c.1716T>C0.962
rpoC765089c.1720T>C0.960
rpoC765100c.1731G>C0.920
rpoC765103c.1734G>T0.920
rpoC765121c.1752G>T0.909
rpoC765129p.Tyr587Phe0.909
rpoC765143p.Val592Ile0.947
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T1.000
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766321c.2952C>G0.955
rpoC766333c.2964G>T0.967
rpoC766345c.2976T>C0.968
rpoC766348c.2979A>G0.968
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala0.968
rpoC766369c.3000C>G0.980
rpoC766375c.3006C>G0.980
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp0.986
rpoC766540p.Asp1057Glu0.900
rpoC766549c.3180G>C0.967
rpoC766570c.3201T>C0.968
rpoC766573c.3204T>G0.968
rpoC766594c.3225G>T0.968
rpoC766607p.Ile1080Leu0.968
rpoC766618c.3249G>T0.967
rpoC766624c.3255G>C0.967
rpoC766630c.3261G>C0.964
rpoC766633c.3264G>C0.964
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C0.985
rpsL781832c.273T>C0.971
rpsL781859c.300T>C0.956
rpsL781868c.309T>C0.949
rpsL781871c.312G>C0.945
rpsL781877c.318T>A0.940
rpsL781892c.333A>G0.930
rpsL781898c.339A>T0.929
rpsL781907c.348T>C0.923
rpsL781916c.357T>C0.919
rpsL781929p.Gly124Ser0.929
rpsL781933374G>A0.926
rrs1471922r.77gt>g0.917
rrs1471925r.80t>c0.909
rrs1471931r.86ga>g0.909
rrs1471934r.89a>g0.913
rrs1471985r.140t>c0.958
rrs1471986r.141c>t0.958
rrs1472030r.185g>a0.923
rrs1472031r.186g>c0.923
rrs1472032r.187g>a0.923
rrs1472033r.188a>c0.923
rrs1472035r.190g>t0.923
rrs1472040r.195t>g0.923
rrs1472041r.196c>t0.923
rrs1472042r.197t>g0.923
rrs1472043r.198t>a0.923
rrs1472050r.205g>c0.923
rrs1472061r.216a>t0.957
rrs1472106r.261g>a0.957
rrs1472108r.263c>t0.957
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.875
rrs1473088r.1243a>g0.882
rrs1473099r.1254t>a0.846
rrs1473104r.1259c>t0.818
rrs1473105r.1260g>a0.818
rrs1473110r.1265t>g0.800
rrs1473111r.1266a>g0.800
rrs1473121r.1276t>c0.867
rrs1473123r.1278a>t0.867
rrs1473129r.1284c>t0.875
rrs1473145r.1300c>t0.867
rrs1473166r.1321g>a0.857
rrs1473288r.1443c>t0.947
rrs1473290r.1445c>t0.947
rrs1473291r.1446g>t0.947
rrl1473746r.89t>c0.917
rrl1473756r.99g>t0.917
rrl1473758r.101g>t0.917
rrl1473770r.113t>c0.923
rrl1473806r.149c>t0.929
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t0.900
rrl1473832r.175c>t1.000
rrl1473839r.182g>a0.900
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.923
rrl1474184r.527c>a0.923
rrl1474185r.528ga>g0.923
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474356r.699t>c0.923
rrl1474362r.705a>g0.926
rrl1474387r.730c>t0.917
rrl1474413r.756a>c0.947
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.947
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c0.909
rrl1475061r.1404ca>c0.941
rrl1475076r.1419c>a0.947
rrl1475090r.1433a>t0.905
rrl1475114r.1457c>t0.941
rrl1475120r.1463g>t0.941
rrl1475129r.1472g>a0.941
rrl1475202r.1545g>c0.923
rrl1475209r.1552g>a0.909
rrl1475213r.1556c>t0.833
rrl1475220r.1563g>t0.833
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t0.938
rrl1475573r.1916g>a1.000
rrl1475975r.2318c>t0.947
rrl1475977r.2320a>g0.947
rrl1475988r.2331a>g0.923
rrl1475989r.2332t>c0.923
rrl1475993r.2336c>t0.923
rrl1475997r.2340a>t0.923
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t0.938
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
inhA1674855c.654C>G1.000
inhA1674858c.657G>A1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C0.944
inhA1674957c.756G>C0.944
inhA1674963c.762G>C0.895
inhA1674966c.765T>C0.895
inhA1674975c.774C>T0.895
inhA1674977p.Tyr259Phe0.895
inhA1674993c.792G>T0.818
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G0.985
rpsA1833676c.135A>G0.983
rpsA1833679c.138G>T0.981
rpsA1833685c.144G>C0.980
rpsA1833691c.150G>A0.979
rpsA1833694c.153G>T0.979
rpsA1833697c.156C>T0.978
rpsA1833700c.159C>T0.958
rpsA1833709c.168C>T0.964
rpsA1833724c.183C>T0.972
rpsA1833727c.186G>C0.971
rpsA1833733c.192C>G0.946
rpsA1833734p.Ala65Ser0.946
rpsA1833742c.201A>G0.975
rpsA1833745c.204G>C0.975
rpsA1833748c.207C>G0.976
rpsA1833760c.219C>T0.980
rpsA1833787c.246C>G0.980
rpsA1833790c.249T>C0.980
rpsA1833802c.261A>G0.981
rpsA1833811c.270G>T0.981
rpsA1833823c.282G>A0.980
rpsA1833832c.291G>A0.982
rpsA1833838c.297G>C0.982
rpsA1833841c.300C>G0.982
rpsA1833847c.306C>G0.984
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T0.980
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C0.974
rpsA1834228c.687C>A0.977
rpsA1834231c.690T>G0.976
rpsA1834234c.693G>T0.976
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T0.977
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G0.978
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T0.983
rpsA1834294c.753G>T0.981
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T0.984
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T0.986
rpsA1834451c.910T>C0.986
rpsA1834456c.915T>G0.985
rpsA1834468c.927A>G0.985
rpsA1834477c.936C>T0.986
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C0.976
rpsA1834520p.Ala327Ser0.976
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.976
rpsA1834543c.1002C>G0.976
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T0.974
rpsA1834555c.1014T>G0.974
rpsA1834557p.Ala339Gly0.974
rpsA1834606c.1065C>T0.982
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C0.947
rpsA1834622c.1081T>A0.971
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T0.958
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser0.981
rpsA1834690c.1149T>C1.000
rpsA1834701p.Gln387Pro0.980
rpsA1834720c.1179C>G0.984
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G0.984
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G0.917
panD4044150c.132T>G0.895
panD4044156c.126T>C0.895
panD4044167c.115G>A0.944
panD4044171c.111G>A0.944
panD4044174c.108G>A0.944
panD4044180p.Asp34Glu0.944
panD4044188c.94C>G0.944
panD4044189c.93G>A0.944
panD4044194p.Ala30Pro0.944
panD4044195c.87A>G0.944
panD4044233p.Cys17His0.971
panD4044234c.48G>C0.971
panD4044249c.33G>A0.971
panD4044266p.Leu6Met0.967
panD4044273c.9C>G0.960
panD4044276p.Leu2Phe0.958
embC4240729c.867C>G0.986
embC4240735c.873C>G0.986
embC4240741c.879C>T0.987
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C0.984
embC4240826p.Ala322Ser0.983
embC4240831c.969T>G0.982
embC4240856p.Ala332Thr0.975
embC4240859p.Leu333Ile0.974
embC4240876c.1014C>T0.964
embC4240879c.1017G>T0.964
embC4240885c.1023T>C0.960
embC4240886p.Ile342Val0.960
embC4240897c.1035C>G0.950
embC4240900c.1038A>G0.944
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;