TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d258afdcd983
Sample: 5d258afdcd983

Download results

Summary
ID: 5d258afdcd983
Date: Wed Jul 10 07:54:40 2019
Strain: lineage4;lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T0.939
gyrB6127c.888G>C1.000
gyrB6133c.894G>C0.939
gyrB6136c.897G>A1.000
gyrB6151c.912C>T0.939
gyrB6172c.933C>T0.912
gyrB6184c.945C>T0.912
gyrB6193c.954G>A0.800
gyrB6196c.957C>T0.800
gyrB6202c.963C>T0.750
gyrB6203p.Ser322Ala0.750
gyrB6214c.975G>C0.750
gyrB6223c.984G>C0.750
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A0.966
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T0.943
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T0.957
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T0.941
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.893
gyrB6775c.1536G>C0.944
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G0.913
gyrB6824c.1585C>T0.885
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C0.884
gyrB6872c.1633T>C0.878
gyrB6878c.1639T>C1.000
gyrB6881c.1642T>C0.122
gyrB6889c.1650G>A0.139
gyrB6898c.1659G>T0.875
gyrB6901c.1662G>C0.125
gyrB7006c.1767T>G0.167
gyrB7010p.Leu591Met0.167
gyrB7015c.1776G>A0.167
gyrB7018c.1779G>C0.833
gyrB7023p.Leu595His0.167
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7078c.1839A>G0.909
gyrB7081c.1842T>C0.833
gyrB7084c.1845A>G0.917
gyrB7090c.1851C>T0.917
gyrB7093c.1854T>C0.909
gyrB7099c.1860G>A0.214
gyrB7100c.1861T>C0.714
gyrB7108c.1869G>A0.214
gyrB7114c.1875C>A0.214
gyrA7490c.189C>G0.143
gyrA7499c.198G>C0.871
gyrA7505c.204C>T0.118
gyrA7511c.210C>T0.861
gyrA7523c.222C>G0.950
gyrA7526c.225G>A0.875
gyrA7547c.246C>T0.962
gyrA7553c.252C>T0.915
gyrA7559c.258G>C0.933
gyrA7565c.264C>T0.934
gyrA7574c.273G>C0.938
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.973
gyrA7595c.294C>T0.973
gyrA7607c.306C>T0.972
gyrA7637c.336C>A0.965
gyrA8111c.810G>C0.143
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C0.955
gyrA8159c.858G>C0.818
gyrA8168c.867A>G0.955
gyrA8174c.873C>G0.818
gyrA8177c.876A>C0.955
gyrA8187p.Leu296Ile0.857
gyrA8192c.891C>G0.857
gyrA8198c.897T>C0.957
gyrA8207c.906T>C0.957
gyrA8267c.966G>C0.971
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C0.973
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T0.906
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C0.911
gyrA8382c.1081C>T0.118
gyrA8387c.1086C>T0.121
gyrA8580p.Ile427Val0.800
gyrA8603c.1302A>C0.889
gyrA8609c.1308G>C0.727
gyrA8619c.1318T>C0.833
gyrA8624c.1323G>T0.800
gyrA8633c.1332C>G0.615
gyrA8636c.1335A>C0.846
gyrA8642c.1341A>G0.917
gyrA8645c.1344C>G0.667
gyrA8649p.Arg450Lys0.667
gyrA8666c.1365G>C0.615
gyrA8672c.1371A>G0.917
gyrA8678c.1377G>A0.250
gyrA8693c.1392T>C0.917
gyrA8696c.1395G>C0.917
gyrA8699c.1398A>G0.917
gyrA8792c.1491G>C0.615
gyrA8799p.Ala500Ser0.643
gyrA8807c.1506C>T0.150
gyrA8810c.1509A>G0.950
gyrA8816c.1515C>G0.150
gyrA8817p.Ser506Ala0.800
gyrA8828c.1527T>C0.955
gyrA8829c.1528T>C0.739
gyrA8837c.1536C>G0.156
gyrA8846c.1545C>T0.794
gyrA8852c.1551T>C0.974
gyrA8858c.1557T>C1.000
gyrA8867c.1566A>G0.227
gyrA8870c.1569G>C0.978
gyrA8873c.1572A>G0.208
gyrA8891c.1590G>A0.182
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G0.790
gyrA8933c.1632G>C0.220
gyrA8939c.1638T>C0.228
gyrA8942c.1641G>T0.204
gyrA8945c.1644G>C0.812
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T0.767
gyrA8966c.1665C>G0.189
gyrA8967p.Ala556Lys0.200
gyrA8978c.1677C>T0.788
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T0.760
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9017c.1716C>G0.250
gyrA9018p.Gln573Lys0.722
gyrA9023c.1722A>C1.000
gyrA9026c.1725G>C0.688
gyrA9029c.1728T>C1.000
gyrA9032c.1731T>C0.333
gyrA9035c.1734G>C1.000
gyrA9044c.1743C>G0.727
gyrA9047c.1746C>T0.600
gyrA9050p.Asp583Glu0.300
gyrA9051c.1750T>C0.300
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G0.984
rpoB760235c.429T>C1.000
rpoB760244c.438G>C0.887
rpoB760256c.450C>T0.880
rpoB760274p.Glu156Asp0.806
rpoB760276p.Lys157Met0.800
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760310c.504G>C0.240
rpoB760343c.537G>C0.182
rpoB760357p.Thr184Ser0.700
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760380p.Thr192Leu0.195
rpoB760388c.582C>T0.791
rpoB760400c.594G>C0.851
rpoB760406c.600G>C0.940
rpoB760407p.Ser201Gly0.854
rpoB760412c.606C>G0.111
rpoB760415c.609C>T0.889
rpoB760418c.612G>C0.891
rpoB760424c.618C>G0.103
rpoB760430c.624T>C1.000
rpoB760460c.654G>C0.922
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G0.960
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561c.756 757del1.000
rpoB762510p.Ala902Pro0.889
rpoB762515c.2709C>T0.818
rpoB762521c.2715C>T0.161
rpoB762533c.2727T>C0.957
rpoB762536c.2730T>C0.957
rpoB762537c.2731T>C0.957
rpoB762551c.2745C>T0.235
rpoB762557c.2751G>A0.545
rpoB762560c.2754A>C0.600
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G0.875
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T0.909
rpoB762879p.Met1025Leu0.927
rpoB762894c.3088C>T0.929
rpoB762899c.3093G>C0.913
rpoB762917c.3111C>G0.938
rpoB762920c.3114C>T0.936
rpoB762923c.3117C>G0.939
rpoB762929c.3123G>C0.981
rpoB762959c.3153G>C0.966
rpoB762962c.3156C>T0.966
rpoB762995c.3189G>T0.986
rpoB763031c.3225T>G0.985
rpoB763034c.3228C>G0.985
rpoB763040c.3234C>G0.985
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T0.873
rpoB763085c.3279C>G0.127
rpoB763088c.3282C>G0.871
rpoB763094c.3288G>C0.862
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C0.850
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A0.822
rpoB763148c.3342G>C0.171
rpoB763157c.3351G>T0.825
rpoB763158c.3352C>T0.175
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C0.743
rpoB763190c.3384C>T0.290
rpoB763193c.3387C>G0.750
rpoC763402c.33C>G0.500
rpoC763408c.39T>C0.500
rpoC763411c.42T>C0.500
rpoC763414c.45T>G0.467
rpoC763415p.Thr16Ser0.533
rpoC763423p.Glu18Asp0.533
rpoC763430c.61A>C0.533
rpoC763433p.Gln22Asn0.500
rpoC763441c.72C>T0.467
rpoC763443p.Tyr25Phe0.533
rpoC763450c.81G>A0.872
rpoC763456c.87A>G1.000
rpoC763468c.99G>C0.914
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T0.935
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763573c.204G>C0.179
rpoC763594c.225C>T1.000
rpoC763603c.234C>T0.167
rpoC763633c.264T>C0.833
rpoC763636c.267T>C0.161
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C0.863
rpoC763669c.300C>G0.843
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T0.833
rpoC763702c.333C>G1.000
rpoC763708c.339G>C0.862
rpoC763711c.342G>C0.862
rpoC763714c.345G>C0.862
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A0.138
rpoC763738c.369G>A0.138
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A0.821
rpoC763765c.396T>C1.000
rpoC763774c.405G>C1.000
rpoC763781p.Ser138Ala0.667
rpoC763888c.519G>T0.900
rpoC763891c.522G>C0.909
rpoC763894c.525A>G0.917
rpoC763900c.531G>C0.969
rpoC763933c.564C>T0.886
rpoC763940p.Ala191Ser0.886
rpoC763947p.Ala193Val0.912
rpoC763951c.582G>C0.970
rpoC763960c.591T>G0.969
rpoC763969c.600C>T0.939
rpoC763987c.618C>T0.952
rpoC763991p.Ile208Leu0.947
rpoC763996c.627T>C0.947
rpoC763999c.630C>T0.842
rpoC764002c.633C>G0.947
rpoC764003p.Ala212Ser0.842
rpoC764024c.655T>C0.929
rpoC764029p.Glu220Asp0.714
rpoC764032p.Asp221Glu0.214
rpoC764040p.Ser224Thr0.952
rpoC764044c.675T>C0.955
rpoC764054c.685C>T0.826
rpoC764059c.690G>T1.000
rpoC764083c.714A>G0.960
rpoC764084p.Asn239Val0.840
rpoC764095c.726C>T0.840
rpoC764098c.729A>G0.960
rpoC764102p.Val245Ile0.120
rpoC764110c.741C>T0.840
rpoC764112p.Tyr248Phe0.120
rpoC764116c.747C>T0.154
rpoC764131c.762T>C0.154
rpoC764143c.774G>C0.773
rpoC764147p.Ser260Ala0.714
rpoC764150p.Ile261Val0.714
rpoC764165p.Glu266Gln0.722
rpoC764311c.942C>G0.773
rpoC764317c.948C>G0.760
rpoC764320c.951C>G0.741
rpoC764338c.969G>A0.973
rpoC764353c.984G>T0.143
rpoC764365c.996C>T0.976
rpoC764371c.1002G>C0.850
rpoC764377c.1008C>G0.854
rpoC764380c.1011G>C0.976
rpoC764381c.1012T>A0.119
rpoC764387c.1018T>C0.977
rpoC764405c.1036A>C0.981
rpoC764428c.1059G>C0.981
rpoC764431c.1062G>C0.980
rpoC764434c.1065A>G0.980
rpoC764435c.1066A>C0.880
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764470c.1101C>T0.867
rpoC764489c.1120C>T0.106
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G0.923
rpoC764530c.1161C>G0.915
rpoC764534c.1165C>A0.913
rpoC764539c.1170C>T0.975
rpoC764542c.1173C>T0.929
rpoC764545c.1176C>A0.929
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T0.915
rpoC764632c.1263T>C0.915
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T0.883
rpoC764692c.1323C>T0.885
rpoC764713c.1344G>T0.900
rpoC764716c.1347G>C0.912
rpoC764746c.1377G>T0.907
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G0.904
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.909
rpoC764803c.1434C>T0.907
rpoC764809c.1440C>T0.979
rpoC764810p.Pro481Ala0.898
rpoC764815c.1446A>G0.981
rpoC764824c.1455T>C0.887
rpoC764827c.1458G>C0.981
rpoC764858c.1489T>C0.969
rpoC764869c.1500C>T0.889
rpoC764872c.1503A>G0.109
rpoC764875c.1506C>A0.879
rpoC764887c.1518G>C0.869
rpoC764888c.1519T>C0.968
rpoC764911c.1542A>G0.984
rpoC764912p.Met515Gln0.885
rpoC764932c.1563C>A0.986
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C0.871
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G0.897
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C0.682
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C0.667
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T0.588
rpoC765129p.Tyr587Phe0.588
rpoC765143p.Val592Ile0.500
rpoC765343c.1974G>A0.583
rpoC765346c.1977C>G0.333
rpoC765349c.1980T>C0.333
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val0.667
rpoC765370c.2001G>C0.842
rpoC765379c.2010G>C0.857
rpoC765382c.2013G>T0.857
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C0.875
rpoC765405p.Leu679His0.875
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser0.875
rpoC765454c.2085C>G0.877
rpoC765469c.2100G>C0.881
rpoC765478c.2109T>G0.125
rpoC765480p.Tyr704Phe0.862
rpoC765499c.2130C>G0.983
rpoC765517c.2148C>G0.852
rpoC765529c.2160C>T0.130
rpoC765533p.Tyr722His0.848
rpoC765541c.2172C>G0.140
rpoC765544c.2175C>G0.741
rpoC765547c.2178C>T0.731
rpoC765548c.2179A>T0.760
rpoC765553c.2184C>T0.960
rpoC765556c.2187G>C0.962
rpoC765559c.2190G>C0.192
rpoC765562c.2193G>T0.731
rpoC765580c.2211G>C0.130
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T0.788
rpoC765850c.2481G>C0.147
rpoC765861p.Phe831Tyr0.846
rpoC765875p.Val836Ile0.880
rpoC765886c.2517C>T0.979
rpoC765907c.2538G>T0.872
rpoC765910c.2541G>C0.867
rpoC765928c.2559C>G0.821
rpoC765937c.2568T>C0.139
rpoC765940c.2571A>T0.833
rpoC765947c.2578T>C0.972
rpoC765962c.2593T>C0.708
rpoC765967c.2598C>T0.958
rpoC765973c.2604C>G0.708
rpoC765979c.2610C>G0.708
rpoC765982c.2613C>T0.182
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C0.789
rpoC766009c.2640G>C0.765
rpoC766010p.Ser881Arg0.188
rpoC766321c.2952C>G0.923
rpoC766333c.2964G>T0.833
rpoC766345c.2976T>C0.947
rpoC766348c.2979A>G0.947
rpoC766351c.2982C>G0.842
rpoC766353p.Val995Ala0.842
rpoC766369c.3000C>G0.923
rpoC766375c.3006C>G0.925
rpoC766381c.3012C>T0.976
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp0.941
rpoC766501c.3132G>C0.800
rpoC766507c.3138C>T0.840
rpoC766513c.3144C>T0.846
rpoC766522c.3153C>A0.154
rpoC766528c.3159T>G0.154
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G0.846
rpoC766537c.3168G>A0.815
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C0.868
rpoC766573c.3204T>G0.132
rpoC766588c.3219G>A0.889
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T0.846
rpoC766624c.3255G>C0.838
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C0.781
rpoC766642c.3273C>T0.364
rpoC766645c.3276A>G0.300
rpoC766792c.3423C>G0.750
rpoC766799p.Ala1144Arg0.692
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C0.562
rpoC766843c.3474T>G0.529
rpoC766846c.3477C>A0.450
rpoC766858c.3489C>T0.450
rpoC766861c.3492G>C1.000
rpoC766864c.3495G>C0.550
rpoC766867c.3498C>G0.450
rpoC766876c.3507C>T0.409
rpoC766883p.Ser1172Ala0.133
rpoC766900c.3531T>C1.000
rpoC766931p.Ala1188Ser0.714
rpoC766942c.3573C>T0.755
rpoC766945c.3576A>C0.240
rpoC766963c.3594T>C1.000
rpoC766972c.3603G>C0.148
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C0.931
rpoC767008c.3639G>A0.931
rpoC767023c.3654C>T0.957
rpoC767044c.3675G>C0.983
rpoC767080c.3711G>C0.910
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G0.922
rpoC767107c.3738C>T0.915
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C0.921
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T0.905
rpoC767149c.3780C>T0.905
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T0.903
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A0.904
rpoC767203c.3834C>G0.917
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C0.969
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn0.957
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.912
rpsL781572p.Gln5Asn0.925
rpsL781586c.27C>T0.942
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala0.982
rpsL781616c.57C>G0.926
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C0.971
rpsL781670c.111G>C0.969
rpsL781706c.147T>C0.956
rpsL781715c.156T>G1.000
rpsL781772c.213C>T0.970
rpsL781802c.243G>C0.949
rpsL781814c.255C>T0.909
rpsL781817c.258G>T0.913
rpsL781829c.270G>C0.926
rpsL781832c.273T>C0.945
rpsL781859c.300T>C0.896
rpsL781868c.309T>C0.925
rpsL781871c.312G>C0.925
rpsL781877c.318T>A0.919
rpsL781892c.333A>G0.943
rpsL781898c.339A>T0.941
rpsL781907c.348T>C0.867
rpsL781916c.357T>C0.933
rpsL781929p.Gly124Ser0.905
rpsL781933374G>A0.727
rrs1471922r.77gt>g0.848
rrs1471925r.80t>c0.977
rrs1471931r.86ga>g0.818
rrs1471934r.89a>g0.977
rrs1471969r.124t>c0.178
rrs1471970r.125g>a0.191
rrs1471985r.140t>c0.792
rrs1471986r.141c>t0.792
rrs1472030r.185g>t0.176
rrs1472031r.186g>a0.176
rrs1472032r.187g>a0.824
rrs1472033r.188a>g0.176
rrs1472034r.189t>c0.176
rrs1472035r.190g>t0.737
rrs1472040r.195t>g0.636
rrs1472041r.196c>t0.636
rrs1472042r.197t>g0.636
rrs1472043r.198t>a0.636
rrs1472044r.199g>t0.364
rrs1472045r.200t>a0.364
rrs1472050r.205g>c0.636
rrs1472061r.216a>t1.000
rrs1472075r.230a>g0.238
rrs1472106r.261g>a0.776
rrs1472108r.263c>t1.000
rrs1472113r.268t>c0.792
rrs1472150r.305t>a0.843
rrs1472251r.406g>a0.900
rrs1472286r.441c>g0.417
rrs1472287r.442c>t0.364
rrs1472289r.444t>g0.364
rrs1472290r.445c>g0.364
rrs1472313r.468g>a0.364
rrs1472315r.470t>g0.364
rrs1472324r.479g>c0.364
rrs1472325r.480g>c0.364
rrs1472327r.482g>a0.364
rrs1472328r.483g>c0.333
rrs1472337r.492c>g0.735
rrs1472380r.535g>c0.842
rrs1472446r.601t>a0.875
rrs1472452r.607g>a0.889
rrs1472464r.619a>g0.889
rrs1472612r.767g>t0.750
rrs1472734r.889c>t0.756
rrs1472741r.896g>a0.744
rrs1472846r.1001c>t0.676
rrs1472847r.1002g>a0.676
rrs1472848r.1003t>c0.686
rrs1472860r.1015c>t0.722
rrs1472861r.1016g>a0.722
rrs1472956r.1111t>c0.704
rrs1472957r.1112c>t0.704
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a0.812
rrs1472990r.1145a>g0.794
rrs1473082r.1237g>a0.900
rrs1473088r.1243a>g0.897
rrs1473099r.1254t>a0.875
rrs1473104r.1259c>t0.931
rrs1473105r.1260g>a0.966
rrs1473110r.1265t>g0.933
rrs1473111r.1266a>g0.935
rrs1473121r.1276t>c0.850
rrs1473123r.1278a>t0.973
rrs1473129r.1284c>t0.925
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t0.925
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t0.925
rrl1473684r.27g>a0.556
rrl1473697r.40c>a0.556
rrl1473707r.50t>a0.704
rrl1473717r.60g>a0.724
rrl1473731r.74t>a0.788
rrl1473746r.89t>c0.842
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c0.844
rrl1473806r.149c>t1.000
rrl1473812r.155g>a0.857
rrl1473814r.157a>t0.857
rrl1473815r.158t>g0.857
rrl1473829r.172g>c0.839
rrl1473831r.174g>t0.839
rrl1473832r.175c>t0.788
rrl1473839r.182g>a0.824
rrl1473876r.219g>a0.825
rrl1473877r.220g>a0.184
rrl1473887r.230t>c0.800
rrl1473888r.231t>c0.788
rrl1473898r.241c>t1.000
rrl1473899r.242a>g0.759
rrl1473916r.259c>a0.633
rrl1473923r.266c>g0.621
rrl1473937r.280c>t0.586
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t0.560
rrl1474030r.373g>a0.300
rrl1474044r.387c>t0.417
rrl1474051r.394t>c0.455
rrl1474054r.397t>c0.455
rrl1474056r.399t>c0.538
rrl1474061r.404t>c0.583
rrl1474074r.417c>t0.818
rrl1474089r.432c>t0.900
rrl1474130r.473c>t0.909
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.816
rrl1474184r.527c>a0.886
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.871
rrl1474282r.625g>a0.889
rrl1474291r.634tttcctctccggagga>t1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t0.964
rrl1474409r.752ggcgacccacac>g1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.825
rrl1474497r.840g>c0.825
rrl1474506r.849c>g0.829
rrl1474507r.850g>c0.829
rrl1474626r.969t>c0.816
rrl1474632r.975g>t0.750
rrl1474636r.979a>t0.744
rrl1474637r.980c>t0.744
rrl1474638r.981c>g0.744
rrl1474639r.982g>a0.256
rrl1474640r.983c>t0.744
rrl1474717r.1060a>g0.829
rrl1474722r.1065t>c0.829
rrl1474743r.1086t>g0.860
rrl1474760r.1103a>g0.878
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a0.950
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g0.897
rrl1474913r.1256t>c0.868
rrl1474932r.1275c>t0.844
rrl1475031r.1374g>c0.852
rrl1475061r.1404ca>c0.895
rrl1475076r.1419c>a0.907
rrl1475090r.1433a>t0.913
rrl1475114r.1457c>t0.953
rrl1475120r.1463g>t0.953
rrl1475129r.1472g>a0.951
rrl1475199r.1542g>a0.133
rrl1475202r.1545g>c0.833
rrl1475206r.1549c>t0.148
rrl1475209r.1552g>c0.167
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t0.826
rrl1475419r.1762c>t0.200
rrl1475429r.1772g>a1.000
rrl1475436r.1779c>t0.222
rrl1475443r.1786g>a0.789
rrl1475452r.1795c>a0.850
rrl1475475r.1818c>t0.846
rrl1475479r.1822c>t0.846
rrl1475480r.1823a>t0.846
rrl1475483r.1826c>t0.143
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t0.926
rrl1475573r.1916g>a0.833
rrl1475599r.1942a>g0.200
rrl1475649r.1992a>g0.800
rrl1475657r.2000a>g0.143
rrl1475659r.2002g>t0.139
rrl1475760r.2103ccg>c1.000
rrl1475763r.2106c>t0.125
rrl1475764r.2107a>t0.875
rrl1475765r.2108a>t0.857
rrl1475881r.2224t>c0.122
rrl1475975r.2318c>t0.826
rrl1475977r.2320a>g0.826
rrl1475988r.2331a>g0.972
rrl1475989r.2332t>c0.806
rrl1475993r.2336c>t0.806
rrl1475997r.2340a>t0.784
rrl1476085r.2428g>a0.800
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c0.800
rrl1476089r.2432t>c0.200
rrl1476095r.2438c>g0.143
rrl1476099r.2442a>g0.857
rrl1476103r.2446c>g0.923
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c0.923
rrl1476114r.2457t>c0.923
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t0.879
rrl1476160r.2503t>c0.917
rrl1476214r.2557g>a0.156
rrl1476215r.2558c>t0.844
rrl1476221r.2564t>c0.844
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c0.885
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t0.918
rrl1476299r.2642c>t0.918
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t0.882
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a0.853
rrl1476666r.3009c>t0.853
rrl1476674r.3017t>c0.818
inhA1674864c.663C>T0.364
inhA1674870c.669T>C0.500
inhA1674876c.675C>T0.500
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp0.583
inhA1674900c.699G>A0.462
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C0.538
inhA1674915c.714C>G0.538
inhA1674942c.741T>C0.462
inhA1674949c.748C>T0.538
inhA1674954c.753G>C0.500
inhA1674957c.756G>C0.500
inhA1674960c.759C>G0.429
inhA1674963c.762G>C0.500
inhA1674966c.765T>C0.429
inhA1674967p.Asp256Thr0.429
inhA1674975c.774C>T0.500
inhA1674977p.Tyr259Phe0.500
inhA1674987c.786C>T0.385
rpsA1833532c.-10A>C0.207
rpsA1833536c.-6A>C0.767
rpsA1833538c.-4CA>C0.767
rpsA1833541c.-1T>C0.774
rpsA1833547c.6G>A0.816
rpsA1833554p.Thr5Ala0.163
rpsA1833568c.27G>C0.143
rpsA1833589c.48A>C0.164
rpsA1833595c.54T>G0.179
rpsA1833596p.Ser19Ala0.821
rpsA1833604c.63C>T0.875
rpsA1833616c.75A>T0.877
rpsA1833619c.78A>C0.877
rpsA1833625c.84A>G0.881
rpsA1833664c.123C>G0.919
rpsA1833676c.135A>G0.926
rpsA1833679c.138G>T0.920
rpsA1833685c.144G>C0.936
rpsA1833691c.150G>A0.930
rpsA1833694c.153G>T0.927
rpsA1833697c.156C>T0.927
rpsA1833700c.159C>T0.907
rpsA1833709c.168C>T0.923
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.929
rpsA1833734p.Ala65Ser0.907
rpsA1833734r.193g>gt0.930
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T0.962
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G0.983
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.877
rpsA1833832c.291G>A0.877
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T0.869
rpsA1833874c.333T>G0.131
rpsA1833886c.345C>G0.852
rpsA1833894p.Ala118Glu0.857
rpsA1833928c.387G>C1.000
rpsA1833940c.399C>G0.113
rpsA1833949c.408T>C0.901
rpsA1833961c.420C>G0.903
rpsA1833970c.429G>T0.914
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G0.928
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T0.921
rpsA1834012c.471G>C0.935
rpsA1834015c.474G>C0.937
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T0.971
rpsA1834073p.Lys178Arg0.942
rpsA1834096c.555G>C0.907
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C0.895
rpsA1834123c.582C>G0.139
rpsA1834177c.636A>C1.000
rpsA1834189c.648G>C0.109
rpsA1834195c.654G>C0.128
rpsA1834210c.669C>T0.125
rpsA1834222c.681T>C0.113
rpsA1834228c.687C>A0.875
rpsA1834231c.690T>G0.132
rpsA1834234c.693G>T0.135
rpsA1834240c.699T>C0.838
rpsA1834246c.705G>T0.824
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G0.829
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T0.881
rpsA1834294c.753G>T0.872
rpsA1834297c.756C>T0.846
rpsA1834303c.762T>G0.154
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T0.870
rpsA1834333c.792C>T0.130
rpsA1834348c.807T>C0.128
rpsA1834357c.816T>C0.900
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C0.894
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G0.139
rpsA1834414c.873C>T0.816
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T0.816
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T0.848
rpsA1834435c.894G>C0.140
rpsA1834438c.897C>T0.860
rpsA1834451c.910T>C0.981
rpsA1834456c.915T>G0.860
rpsA1834468c.927A>G0.980
rpsA1834477c.936C>T0.898
rpsA1834489c.948T>C0.981
rpsA1834519c.978G>C0.841
rpsA1834520p.Ala327Ser0.841
rpsA1834528c.987T>C0.977
rpsA1834534c.993C>T0.860
rpsA1834540c.999G>C0.140
rpsA1834543c.1002C>G0.833
rpsA1834546c.1005T>C0.974
rpsA1834552c.1011G>T0.811
rpsA1834555c.1014T>G0.811
rpsA1834557p.Ala339Gly0.811
rpsA1834606c.1065C>T0.881
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C0.844
rpsA1834622c.1081T>A0.818
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T0.900
rpsA1834666c.1125G>C0.898
rpsA1834667p.Ala376Ser0.898
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.902
rpsA1834705c.1164C>G0.904
rpsA1834720c.1179C>G0.908
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C0.930
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T0.929
rpsA1834776p.Ala412Glu0.929
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T0.886
rpsA1834830p.Ala430Val0.861
katG2155704c.408G>C0.231
katG2155716c.396A>C1.000
katG2155722c.390C>T0.231
katG2155728c.384C>G0.231
katG2155742p.Gly124Pro0.231
katG2155743c.369C>G1.000
katG2155758c.354G>T0.769
katG2155761c.351G>A0.769
katG2155766p.His116Gly0.833
katG2155769p.Ile115Val0.833
katG2155782c.330G>C0.167
katG2155785c.327A>G1.000
katG2155794c.318C>G1.000
katG2155803c.309G>A0.909
katG2155806c.306A>G1.000
katG2155811p.Leu101Met1.000
kasA2518723c.609G>A0.200
kasA2518726c.612G>C0.333
kasA2518732c.618C>G0.296
kasA2518738c.624G>C0.690
kasA2518744c.630C>T0.300
kasA2518747c.633C>G0.323
kasA2518756c.642G>C0.677
kasA2518768c.654C>G0.303
kasA2518771c.657C>G0.719
kasA2518774c.660C>T0.719
kasA2518777c.663C>T0.281
kasA2518783c.669T>G0.281
kasA2518787p.Arg225Asn0.719
kasA2518792c.678C>T0.226
kasA2518795c.681C>T0.226
kasA2518798c.684G>C0.750
kasA2518822c.708C>A0.849
kasA2518825c.711T>C0.963
kasA2518846c.732G>T0.824
kasA2518849c.735G>C0.816
kasA2518853p.Leu247Val0.822
kasA2518864c.750G>C1.000
kasA2519116c.1002C>G0.900
kasA2519122c.1008G>C0.900
kasA2519137c.1023T>G0.917
kasA2519158c.1044C>T0.909
kasA2519167c.1053T>G0.900
kasA2519173c.1059C>G0.900
kasA2519196p.Thr361Ser0.900
thyX3067349c.597C>G0.923
thyX3067355c.591T>G0.923
thyX3067367c.579C>G0.909
thyX3067373c.573G>C0.900
thyX3067394c.552C>G0.900
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C0.960
panD4044167c.115G>A0.960
panD4044171c.111G>A0.960
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu0.960
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro0.962
panD4044195c.87A>G0.962
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240729c.867C>G0.875
embC4240735c.873C>G0.848
embC4240741c.879C>T0.857
embC4240756c.894G>C0.868
embC4240771c.909G>C0.857
embC4240772p.Ser304Ala0.852
embC4240778p.His306Gly0.867
embC4240781p.Ala307Ser0.867
embC4240789c.927T>C0.974
embC4240819c.957A>C0.122
embC4240826p.Ala322Ser0.831
embC4240831c.969T>G0.967
embC4240856p.Ala332Thr0.857
embC4240859p.Leu333Ile0.854
embC4240870c.1008T>C0.103
embC4240873c.1011C>G0.103
embC4240876c.1014C>T0.886
embC4240879c.1017G>T0.121
embC4240880p.Ala340Thr0.121
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val0.879
embC4240897c.1035C>G1.000
embC4240898c.1036C>T0.148
embC4240903c.1041C>G0.148
embC4240911p.Ala350Val0.148
embB4247940p.Leu476Trp1.000
embB4247945c.1432T>C1.000
embB4247951p.Ser480Ala1.000
embB4247956c.1443G>C1.000
embB4247974c.1461C>G1.000
embB4248190c.1677G>C0.267
embB4248199c.1686A>G0.364
embB4248200p.Ile563Val0.909
embB4248205c.1692C>G0.462
embB4248206p.Ser565Gly0.923
embB4248220c.1707A>G0.176
embB4248226c.1713G>C0.794
embB4248232c.1719G>T0.750
embB4248233p.Leu574Val0.730
embB4248236p.Met575Leu0.763
embB4248245p.Ile578Val0.837
embB4248250c.1737C>T0.816
embB4248259p.Met582Ile0.827
embB4248275p.Thr588Ala0.796
embB4248292c.1779G>A0.796
embB4248304c.1791G>C0.167
embB4248316c.1803C>G0.148
embB4248319c.1806A>G0.750
embB4249441c.2928A>G1.000
embB4249444c.2931T>C1.000
embB4249486c.2973T>G0.909
embB4249498c.2985G>C0.833

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;