TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d25949df0d27
Sample: 5d25949df0d27

Download results

Summary
ID: 5d25949df0d27
Date: Wed Jul 10 08:35:50 2019
Strain: lineage2.2.1;lineage4
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T0.971
gyrB6127c.888G>C0.971
gyrB6133c.894G>C0.971
gyrB6136c.897G>A0.971
gyrB6151c.912C>T0.971
gyrB6172c.933C>T0.971
gyrB6184c.945C>T0.971
gyrB6193c.954G>A0.947
gyrB6196c.957C>T0.923
gyrB6202c.963C>T0.909
gyrB6203p.Ser322Ala0.909
gyrB6214c.975G>C0.909
gyrB6223c.984G>C0.909
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>T0.980
gyrB6676c.1437T>G0.980
gyrB6700c.1461T>C0.982
gyrB6703c.1464G>C0.982
gyrB6706c.1467G>A0.982
gyrB6709c.1470A>G0.982
gyrB6712c.1473G>C0.983
gyrB6727c.1488G>T0.969
gyrB6728c.1489C>T0.969
gyrB6745c.1506T>C0.965
gyrB6754c.1515C>T0.968
gyrB6763c.1524G>C0.968
gyrB6775c.1536G>C0.967
gyrB6793c.1554T>C0.978
gyrB6798p.Gly520Ala0.978
gyrB6808c.1569C>A0.976
gyrB6811c.1572C>T0.976
gyrB6824c.1585C>T0.986
gyrB6841c.1602T>C0.985
gyrB6862c.1623C>G0.985
gyrB6869c.1630T>C0.981
gyrB6872c.1633T>C0.979
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>C1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7066c.1827G>T1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrB7123c.1884C>G0.947
gyrB7126c.1887G>C0.944
gyrB7129c.1890T>G0.938
gyrB7132c.1893T>C0.938
gyrB7135c.1896G>A0.938
gyrB7136c.1897T>C0.938
gyrB7141c.1902T>G0.938
gyrB7144c.1905A>G0.938
gyrB7150c.1911G>A0.938
gyrB7153c.1914G>C0.938
gyrB7168c.1929C>G0.882
gyrB7178c.1939T>C0.846
gyrA7343c.42G>C1.000
gyrA7355c.54T>A1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T0.977
gyrA7394c.93T>C0.977
gyrA7397c.96G>C0.977
gyrA7412c.111C>G0.977
gyrA7421c.120G>C0.909
gyrA7499c.198G>C0.981
gyrA7511c.210C>T0.984
gyrA7523c.222C>G0.984
gyrA7526c.225G>C1.000
gyrA7547c.246C>T0.989
gyrA7559c.258G>C0.989
gyrA7565c.264C>T0.968
gyrA7574c.273G>C0.989
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.989
gyrA7595c.294C>T0.976
gyrA7607c.306C>T0.975
gyrA7637c.336C>A0.967
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C0.968
gyrA8580p.Ile427Val0.923
gyrA8603c.1302A>C0.929
gyrA8609c.1308G>C0.929
gyrA8619c.1318T>C0.929
gyrA8624c.1323G>T0.929
gyrA8633c.1332C>G0.929
gyrA8636c.1335A>T0.929
gyrA8642c.1341A>G0.929
gyrA8645c.1344C>G0.929
gyrA8649p.Arg450Lys0.929
gyrA8666c.1365G>C0.929
gyrA8672c.1371A>G0.929
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8924c.1623C>T0.966
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>A1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G0.985
rpoB760181c.375T>C0.986
rpoB760184c.378A>G0.986
rpoB760196c.390C>G0.985
rpoB760235c.429T>C0.983
rpoB760244c.438G>C0.964
rpoB760256c.450C>T0.981
rpoB760274p.Glu156Asp0.955
rpoB760276p.Lys157Met0.952
rpoB760283c.477G>C0.974
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser0.968
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.882
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>T1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G0.988
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C0.967
rpoB760588p.Thr261Ile0.980
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T0.980
rpoB760596p.Thr264Pro0.980
rpoB760608c.802C>T0.965
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760793c.987A>G1.000
rpoB760799c.993C>T1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760979c.1173G>A1.000
rpoB760982c.1176G>T1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>C1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>T0.952
rpoB761133c.1327T>C0.953
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>T1.000
rpoB761219c.1413G>C0.989
rpoB761231c.1425C>T0.988
rpoB761234c.1428G>T0.987
rpoB761249c.1443A>G0.986
rpoB761255c.1449T>G0.982
rpoB761258c.1452G>A0.982
rpoB761261c.1455G>C0.982
rpoB761264c.1458C>G0.950
rpoB761273c.1467T>C0.986
rpoB761276c.1470G>C0.972
rpoB761297c.1491C>T0.957
rpoB761318c.1512G>C0.981
rpoB761327c.1521A>G0.981
rpoB761339c.1533C>G0.956
rpoB761345c.1539G>C0.867
rpoB761346p.Val514Ser0.857
rpoB761354c.1548C>A0.923
rpoB761357c.1551G>T0.923
rpoB761360c.1554T>C0.923
rpoB761362p.Ser519Thr0.923
rpoB761373p.Val523His0.857
rpoB761384c.1578C>G0.857
rpoB761393c.1587G>A0.857
rpoB761414c.1608A>G0.800
rpoB761516c.1710G>C0.977
rpoB761528c.1722C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761573c.1767C>G1.000
rpoB761579c.1773G>C1.000
rpoB761606c.1800C>G1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761648c.1842T>C1.000
rpoB761660c.1854G>T1.000
rpoB761669c.1863C>T0.984
rpoB761675c.1869G>C0.983
rpoB761687c.1881C>T0.979
rpoB761690c.1884G>C0.978
rpoB761693c.1887G>C0.978
rpoB761705c.1899C>A0.974
rpoB761720c.1914C>G0.176
rpoB761722p.Glu639Gly0.929
rpoB761727p.Ser641Gly0.929
rpoB761741c.1935G>A0.917
rpoB761750c.1944G>T0.900
rpoB761863p.Ala686Glu0.909
rpoB761868p.Asp688Gln0.909
rpoB761873c.2067A>G0.917
rpoB761891c.2085G>C0.966
rpoB761909c.2103T>C0.971
rpoB761912c.2106T>C0.971
rpoB761915p.Asp703Glu0.971
rpoB761916p.Asp704Asn0.971
rpoB761924c.2118G>A0.976
rpoB761930c.2124G>C0.976
rpoB761933c.2127G>C0.976
rpoB761936c.2130C>T0.977
rpoB761948c.2142G>C0.981
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A0.984
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val0.968
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762239c.2433G>A0.970
rpoB762245c.2439G>C1.000
rpoB762254c.2448T>C0.968
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762314c.2508C>T1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762380c.2574T>C1.000
rpoB762383c.2577C>G1.000
rpoB762392c.2586G>C1.000
rpoB762395c.2589G>T1.000
rpoB762398c.2592T>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762507c.2702 2702del1.000
rpoC763402c.33C>T0.938
rpoC763408c.39T>C0.938
rpoC763411c.42T>C0.938
rpoC763414c.45T>G0.938
rpoC763415p.Thr16Ser0.938
rpoC763423p.Glu18Asp0.938
rpoC763430c.61A>C0.938
rpoC763433p.Gln22Asn0.938
rpoC763443p.Tyr25Phe0.941
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A0.980
rpoC763531c.162G>T0.990
rpoC763546c.177A>G0.980
rpoC763570c.201G>C0.990
rpoC763594c.225C>T0.988
rpoC763609c.240C>T0.975
rpoC763621c.252C>T0.962
rpoC763633c.264T>C0.971
rpoC763657c.288G>A0.966
rpoC763660c.291T>G0.964
rpoC763666c.297G>C0.960
rpoC763669c.300C>G0.959
rpoC763675c.306C>G0.957
rpoC763696c.327T>C0.933
rpoC763699c.330G>T0.929
rpoC763702c.333C>G0.929
rpoC763708c.339G>C0.923
rpoC763711c.342G>C0.923
rpoC763714c.345G>C0.923
rpoC763717c.348T>C0.923
rpoC763723c.354G>C0.923
rpoC763732c.363C>G0.923
rpoC763741c.372C>T0.917
rpoC763744c.375G>C0.900
rpoC763900c.531G>C1.000
rpoC763933c.564C>T0.971
rpoC763940p.Ala191Ser0.971
rpoC763945c.576T>C0.971
rpoC763947p.Ala193Val0.971
rpoC763951c.582G>C0.971
rpoC763960c.591T>G0.971
rpoC763969c.600C>T0.971
rpoC763987c.618C>T0.950
rpoC763991p.Ile208Leu0.882
rpoC763996c.627T>C0.933
rpoC763999c.630C>T0.933
rpoC764002c.633C>G0.933
rpoC764003p.Ala212Ser0.933
rpoC764024c.655T>C0.966
rpoC764029p.Glu220Asp0.966
rpoC764032p.Asp221Glu0.966
rpoC764040p.Ser224Thr0.951
rpoC764044c.675T>C0.953
rpoC764054c.685C>T0.955
rpoC764059c.690G>T0.957
rpoC764083c.714A>G0.981
rpoC764084p.Asn239Val0.981
rpoC764098c.729A>G0.980
rpoC764110c.741C>T0.981
rpoC764143c.774G>C0.966
rpoC764147p.Ser260Ala0.958
rpoC764150p.Ile261Val0.957
rpoC764165p.Glu266Gln0.955
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764362c.993C>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C0.977
rpoC764377c.1008C>G0.978
rpoC764380c.1011G>C0.978
rpoC764387c.1018T>C0.980
rpoC764405c.1036A>C0.983
rpoC764428c.1059G>T0.986
rpoC764431c.1062G>C0.985
rpoC764434c.1065A>G0.985
rpoC764435c.1066A>C0.985
rpoC764452c.1083T>C0.987
rpoC764458c.1089G>C0.987
rpoC764461c.1092A>G0.987
rpoC764497c.1128A>G0.986
rpoC764509c.1140G>A0.985
rpoC764510c.1141C>T0.985
rpoC764521c.1152T>C1.000
rpoC764527c.1158C>T1.000
rpoC764530c.1161C>T1.000
rpoC764533c.1164C>A1.000
rpoC764536c.1167G>T1.000
rpoC764539c.1170C>G1.000
rpoC764545c.1176C>A1.000
rpoC764575c.1206T>G1.000
rpoC764593c.1224C>T1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764683c.1314G>A1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C0.980
rpoC764869c.1500C>T0.980
rpoC764875c.1506C>A0.980
rpoC764887c.1518G>C0.981
rpoC764888c.1519T>C0.981
rpoC764911c.1542A>G0.980
rpoC764912p.Met515Gln0.980
rpoC764932c.1563C>A0.982
rpoC764948c.1579T>C0.980
rpoC764968c.1599T>C0.978
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>A0.966
rpoC765379c.2010G>C0.969
rpoC765382c.2013G>T0.969
rpoC765383p.Met672Leu0.969
rpoC765403c.2034G>C0.978
rpoC765405p.Leu679His0.957
rpoC765409c.2040T>G0.979
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765529c.2160C>T1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile0.982
rpoC765895c.2526G>A0.982
rpoC765907c.2538G>T0.981
rpoC765910c.2541G>C0.979
rpoC765928c.2559C>G0.978
rpoC765940c.2571A>T0.977
rpoC765947c.2578T>C0.976
rpoC765962c.2593T>C0.950
rpoC765967c.2598C>T0.950
rpoC765973c.2604C>G0.900
rpoC765979c.2610C>G0.944
rpoC765982c.2613C>T0.889
rpoC765994c.2625A>T0.938
rpoC766003c.2634G>C0.846
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T0.963
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G0.964
rpoC766353p.Val995Ala0.964
rpoC766369c.3000C>G0.982
rpoC766375c.3006C>G0.983
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T0.984
rpoC766408c.3039C>T0.985
rpoC766435p.Glu1022Asp0.971
rpoC766501c.3132G>C0.962
rpoC766507c.3138C>T0.964
rpoC766513c.3144C>T0.967
rpoC766522c.3153C>A0.968
rpoC766528c.3159T>G0.935
rpoC766531c.3162G>C0.968
rpoC766534c.3165C>G0.968
rpoC766537c.3168G>A0.970
rpoC766540p.Asp1057Glu0.973
rpoC766549c.3180G>C0.980
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766975c.3606C>T1.000
rpoC766996c.3627C>T0.986
rpoC767002c.3633G>C0.973
rpoC767008c.3639G>A0.973
rpoC767023c.3654C>T0.963
rpoC767044c.3675G>C0.956
rpoC767080c.3711G>C0.957
rpoC767098c.3729T>C0.953
rpoC767104c.3735C>G0.951
rpoC767107c.3738C>T0.950
rpoC767119c.3750A>G0.953
rpoC767125c.3756G>C0.948
rpoC767134c.3765C>T0.944
rpoC767138c.3769C>T0.947
rpoC767149c.3780C>T0.965
rpoC767158c.3789T>C0.983
rpoC767180p.Ala1271Ser0.982
rpoC767191c.3822C>G0.981
rpoC767197c.3828G>A0.980
rpoC767203c.3834C>G0.976
rpoC767206c.3837C>G0.976
rpoC767209c.3840T>C0.976
rpoC767212c.3843G>C0.977
rpoC767221c.3852C>G0.982
rpoC767230c.3861G>C0.982
rpoC767233c.3864T>C0.983
rpoC767254c.3885G>C0.981
rpoC767264p.Ala1299Ser0.976
rpoC767267p.Ala1300Asn0.975
rpoC767281c.3912C>G0.974
rpoC767284c.3915C>G0.974
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C0.984
rpsL781715c.156T>G0.983
rpsL781772c.213C>T0.951
rpsL781802c.243G>C0.961
rpsL781814c.255C>T0.958
rpsL781817c.258G>T0.962
rpsL781829c.270G>C0.966
rpsL781832c.273T>C0.983
rpsL781859c.300T>C0.983
rpsL781868c.309T>C0.981
rpsL781871c.312G>C0.980
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g0.983
rrs1471934r.89a>g0.983
rrs1471985r.140t>c0.981
rrs1471986r.141c>t0.980
rrs1472030r.185g>a0.958
rrs1472031r.186g>c0.958
rrs1472032r.187g>a0.958
rrs1472033r.188a>c0.958
rrs1472035r.190g>t0.958
rrs1472040r.195t>g0.958
rrs1472041r.196c>t0.958
rrs1472042r.197t>g0.958
rrs1472043r.198t>a0.958
rrs1472050r.205g>c0.962
rrs1472053r.208agc>a0.962
rrs1472061r.216a>t0.982
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t0.981
rrs1472741r.896g>a0.982
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c0.981
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.982
rrs1473088r.1243a>g0.981
rrs1473099r.1254t>a0.950
rrs1473104r.1259c>t0.973
rrs1473105r.1260g>a0.946
rrs1473110r.1265t>g0.973
rrs1473111r.1266a>g0.973
rrs1473121r.1276t>c0.955
rrs1473123r.1278a>t0.977
rrs1473129r.1284c>t0.957
rrs1473145r.1300c>t0.962
rrs1473166r.1321g>a0.981
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac1.000
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473806r.149c>t0.986
rrl1473812r.155g>a0.982
rrl1473814r.157a>t0.982
rrl1473815r.158t>g0.982
rrl1473829r.172g>c0.981
rrl1473831r.174g>t0.980
rrl1473832r.175c>t0.980
rrl1473839r.182g>a0.982
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g0.964
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474061r.404t>c0.909
rrl1474074r.417c>t0.957
rrl1474089r.432c>t0.958
rrl1474093r.436g>a0.958
rrl1474100r.443c>t0.958
rrl1474103r.446a>c0.958
rrl1474130r.473c>t0.979
rrl1474140r.483c>t0.981
rrl1474151r.494c>t0.967
rrl1474181r.524c>ct0.892
rrl1474184r.527c>a0.982
rrl1474185r.528ga>g0.982
rrl1474249r.592g>t0.981
rrl1474263r.606g>a0.982
rrl1474282r.625g>a0.980
rrl1474291r.634tttcctctccggagga>t0.978
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g0.985
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.958
rrl1474497r.840g>c0.958
rrl1474506r.849c>g0.971
rrl1474507r.850g>c0.971
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474708r.1051c>caataa0.692
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a0.986
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c0.976
rrl1475076r.1419c>a0.979
rrl1475090r.1433a>t0.983
rrl1475114r.1457c>t0.985
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t0.970
rrl1475479r.1822c>t0.970
rrl1475480r.1823a>t0.970
rrl1475505r.1848g>a0.966
rrl1475526r.1869c>a0.929
rrl1475531r.1874c>t0.933
rrl1475573r.1916g>a0.967
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.982
rrl1475977r.2320a>g0.982
rrl1475988r.2331a>g0.979
rrl1475989r.2332t>c0.979
rrl1475993r.2336c>t0.979
rrl1475997r.2340a>t0.979
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a0.981
rrl1476608r.2951c>g0.981
rrl1476619r.2962c>t0.981
rrl1476628r.2971t>a0.980
rrl1476665r.3008t>a0.969
rrl1476666r.3009c>t0.969
rrl1476674r.3017t>c0.968
rpsA1833536c.-6A>C0.958
rpsA1833538c.-4CA>C0.958
rpsA1833541c.-1T>C0.958
rpsA1833547c.6G>A0.972
rpsA1833589c.48A>C0.981
rpsA1833595c.54T>G0.981
rpsA1833596p.Ser19Ala0.981
rpsA1833604c.63C>T0.985
rpsA1833616c.75A>T0.987
rpsA1833619c.78A>C0.987
rpsA1833625c.84A>G0.988
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.966
rpsA1833734p.Ala65Ser0.966
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.983
rpsA1833832c.291G>A0.978
rpsA1833835c.294C>T0.977
rpsA1833838c.297G>C0.977
rpsA1833841c.300C>G0.978
rpsA1833847c.306C>G0.981
rpsA1833862c.321G>T0.983
rpsA1833874c.333T>G0.982
rpsA1833877c.336C>G0.982
rpsA1833886c.345C>G0.982
rpsA1833894p.Ala118Glu0.984
rpsA1833928c.387G>C0.987
rpsA1833949c.408T>C0.986
rpsA1833961c.420C>G0.987
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T0.984
rpsA1834030c.489C>G0.984
rpsA1834073p.Lys178Arg0.977
rpsA1834096c.555G>C0.975
rpsA1834099c.558C>G0.974
rpsA1834108c.567C>G0.970
rpsA1834114c.573G>C0.964
rpsA1834177c.636A>C0.964
rpsA1834228c.687C>A0.966
rpsA1834231c.690T>G0.962
rpsA1834234c.693G>T0.961
rpsA1834240c.699T>C0.961
rpsA1834246c.705G>T0.960
rpsA1834249c.708T>C0.961
rpsA1834252c.711C>G0.962
rpsA1834261c.720A>G0.972
rpsA1834264c.723G>C0.974
rpsA1834279c.738C>T0.975
rpsA1834294c.753G>T0.973
rpsA1834297c.756C>T0.973
rpsA1834303c.762T>G0.974
rpsA1834306c.765T>C0.961
rpsA1834327c.786G>T1.000
rpsA1834348c.807T>C1.000
rpsA1834357c.816T>C0.986
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834498c.957C>T1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G0.979
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834747c.1206A>G1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A0.985
kasA2518825c.711T>C0.985
kasA2518846c.732G>T0.984
kasA2518849c.735G>C0.984
kasA2518853p.Leu247Val0.984
kasA2518864c.750G>C0.982
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr0.977
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;