TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d25a78659cb2
Sample: 5d25a78659cb2

Download results

Summary
ID: 5d25a78659cb2
Date: Wed Jul 10 09:56:39 2019
Strain: lineage2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.943
gyrB6115c.876A>G0.947
gyrB6121c.882C>T0.947
gyrB6127c.888G>C0.947
gyrB6133c.894G>C0.947
gyrB6136c.897G>A0.947
gyrB6151c.912C>T0.947
gyrB6172c.933C>T0.947
gyrB6184c.945C>T0.973
gyrB6193c.954G>A0.900
gyrB6196c.957C>T0.947
gyrB6202c.963C>T0.944
gyrB6203p.Ser322Ala0.944
gyrB6214c.975G>C0.944
gyrB6223c.984G>C1.000
gyrB6229c.990G>A1.000
gyrB6655c.1416T>C0.960
gyrB6673c.1434A>C0.973
gyrB6676c.1437T>G0.973
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.984
gyrB6775c.1536G>C0.984
gyrB6793c.1554T>C0.986
gyrB6798p.Gly520Ala0.985
gyrB6808c.1569C>G0.982
gyrB6824c.1585C>T0.980
gyrB6841c.1602T>C0.979
gyrB6862c.1623C>G0.972
gyrB6865c.1626G>A0.971
gyrB6869c.1630T>C0.971
gyrB6872c.1633T>C0.971
gyrB6878c.1639T>C0.944
gyrB6889c.1650G>A0.941
gyrB6898c.1659G>T0.938
gyrB6988c.1749C>G1.000
gyrB7006c.1767T>G0.947
gyrB7010p.Leu591Met0.947
gyrB7015c.1776G>A0.947
gyrB7018c.1779G>C0.900
gyrB7024c.1785G>C0.900
gyrB7033c.1794G>C0.900
gyrB7051p.Glu604Asp0.900
gyrB7060c.1821T>C0.900
gyrB7066c.1827G>T0.900
gyrB7078c.1839A>G0.900
gyrB7081c.1842T>C0.900
gyrB7084c.1845A>G0.900
gyrB7090c.1851C>T0.900
gyrB7093c.1854T>C0.900
gyrB7100c.1861T>C0.947
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>A1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T0.980
gyrA8382c.1081C>T1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C0.985
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C0.988
gyrA8915c.1614A>G0.989
gyrA8942c.1641G>C0.972
gyrA8945c.1644G>C0.970
gyrA8946c.1645T>C0.970
gyrA8967p.Ala556Lys0.946
gyrA8978c.1677C>T0.942
gyrA8987c.1686C>G0.919
gyrA8990c.1689C>G0.917
gyrA8993c.1692C>T0.917
gyrA8996c.1695T>C0.917
gyrA8998p.Leu566Trp0.917
gyrA9018p.Gln573Lys0.786
gyrA9023c.1722A>C0.750
gyrA9026c.1725G>C0.750
gyrA9029c.1728T>C0.750
gyrA9032c.1731T>C0.750
gyrA9035c.1734G>C0.750
gyrA9044c.1743C>G0.727
gyrA9047c.1746C>T0.727
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser0.970
rpoB760361c.555T>C0.971
rpoB760370c.564C>G0.971
rpoB760376p.Asp190Glu0.976
rpoB760382c.576G>C0.977
rpoB760388c.582C>T0.978
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.922
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T0.982
rpoB760418c.612G>C0.984
rpoB760430c.624T>C0.986
rpoB760460c.654G>C0.988
rpoB760475c.669A>G0.988
rpoB760481c.675G>C0.986
rpoB760484c.678A>G0.987
rpoB760502c.696C>G0.986
rpoB760522p.Ser239Asn0.987
rpoB760532c.726T>C0.987
rpoB760541c.735G>C0.987
rpoB760567p.Ser254Trp1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T0.974
rpoB760721c.915C>G0.929
rpoB760727c.921C>G0.917
rpoB760730c.924T>C0.913
rpoB760736c.930C>G0.905
rpoB760805c.999G>C0.867
rpoB760817c.1011A>G0.909
rpoB760820c.1014T>C0.917
rpoB760826c.1020C>G0.926
rpoB760830c.1024T>C0.931
rpoB760841c.1035T>C0.946
rpoB760858p.Val351Ala0.976
rpoB760862c.1056G>C0.977
rpoB760865c.1059C>T0.956
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760907c.1101C>T0.961
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T0.978
rpoB760946c.1140A>G0.977
rpoB760965p.Met387Leu0.973
rpoB760970c.1164G>C0.971
rpoB760973c.1167G>T0.968
rpoB760982c.1176G>C0.933
rpoB760985c.1179G>C0.929
rpoB760988c.1182C>G0.929
rpoB760991c.1185G>T0.933
rpoB760997c.1191G>C0.963
rpoB761006c.1200C>G0.966
rpoB761015c.1209G>C0.966
rpoB761027c.1221A>C0.970
rpoB761036c.1230G>C0.971
rpoB761037c.1231T>C0.972
rpoB761051c.1245G>T0.978
rpoB761054c.1248G>C0.978
rpoB761057c.1251G>C0.978
rpoB761060c.1254C>G0.978
rpoB761063c.1257C>G0.980
rpoB761084c.1278C>A0.985
rpoB761097c.1291A>T0.984
rpoB761102c.1296A>G0.984
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C0.986
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761219c.1413G>C1.000
rpoB761234c.1428G>C1.000
rpoB761246c.1440C>T1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C1.000
rpoB761264c.1458C>G1.000
rpoB761273c.1467T>C1.000
rpoB761303c.1497G>C1.000
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761345c.1539G>C1.000
rpoB761346p.Val514Ser1.000
rpoB761354c.1548C>A1.000
rpoB761357c.1551G>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761373p.Val523His1.000
rpoB761384c.1578C>G1.000
rpoB761393c.1587G>A1.000
rpoB761414c.1608A>G1.000
rpoB761471c.1665C>T0.900
rpoB761482p.Ala559Gly0.917
rpoB761497p.Tyr564Phe0.923
rpoB761502p.Pro566Ser0.857
rpoB761505p.Ser567Ala0.857
rpoB761508p.Ser568Thr0.857
rpoB761516c.1710G>C0.956
rpoB761528c.1722C>T0.962
rpoB761531c.1725C>T0.963
rpoB761537c.1731C>G0.967
rpoB761555c.1749G>C0.969
rpoB761558c.1752C>G0.970
rpoB761564c.1758G>C0.971
rpoB761570c.1764T>C0.986
rpoB761573c.1767C>G0.973
rpoB761579c.1773G>C0.988
rpoB761612c.1806G>T0.989
rpoB761615c.1809A>C0.989
rpoB761636c.1830G>T0.987
rpoB761645c.1839C>G0.986
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761891c.2085G>C0.970
rpoB761909c.2103T>C0.976
rpoB761912c.2106T>C0.976
rpoB761915p.Asp703Glu0.976
rpoB761916p.Asp704Asn0.976
rpoB761924c.2118G>A0.957
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C0.983
rpoB761954c.2148C>A0.984
rpoB761955p.Ile717Val0.985
rpoB761969c.2163G>A0.986
rpoB761990c.2184G>C0.988
rpoB762008c.2202C>T0.976
rpoB762014c.2208C>G0.977
rpoB762038c.2232C>T0.973
rpoB762047c.2241G>A0.970
rpoB762053c.2247T>C0.968
rpoB762056c.2250G>A0.968
rpoB762065c.2259T>G0.966
rpoB762083c.2277T>C0.950
rpoB762086c.2280G>C0.966
rpoB762101c.2295C>G0.983
rpoB762114p.Ile770Val0.982
rpoB762122c.2316C>T0.982
rpoB762131c.2325C>G0.973
rpoB762134c.2328C>A0.971
rpoB762137c.2331C>T0.971
rpoB762140c.2334G>C0.971
rpoB762143c.2337T>C0.944
rpoB762149c.2343G>T0.983
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A0.973
rpoB762452c.2646G>C0.973
rpoB762470c.2664G>C0.973
rpoB762488c.2682G>C0.967
rpoB762491c.2685T>C0.964
rpoB762509c.2703T>G0.900
rpoB762510p.Ala902Pro0.900
rpoB762515c.2709C>T0.947
rpoB762533c.2727T>C0.900
rpoB762536c.2730T>C0.900
rpoB762537c.2731T>C0.900
rpoB762827c.3021G>C0.935
rpoB762830c.3024C>T0.938
rpoB762857c.3051C>G0.957
rpoB762860c.3054G>C0.957
rpoB762863c.3057T>C0.978
rpoB762866c.3060C>T0.978
rpoB762879p.Met1025Leu0.981
rpoB762894c.3088C>T0.984
rpoB762899c.3093G>C0.985
rpoB762917c.3111C>G0.985
rpoB762920c.3114C>T0.985
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C0.986
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763193c.3387C>G1.000
rpoC763402c.33C>T0.938
rpoC763408c.39T>C0.938
rpoC763411c.42T>C0.938
rpoC763414c.45T>G0.938
rpoC763415p.Thr16Ser0.938
rpoC763423p.Glu18Asp0.938
rpoC763430c.61A>C0.938
rpoC763433p.Gln22Asn0.938
rpoC763443p.Tyr25Phe0.938
rpoC763450c.81G>A0.976
rpoC763456c.87A>G0.977
rpoC763468c.99G>C0.981
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A0.987
rpoC763531c.162G>T0.987
rpoC763546c.177A>G0.987
rpoC763570c.201G>C0.989
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G0.983
rpoC763675c.306C>G1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763888c.519G>T1.000
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser0.978
rpoC763945c.576T>C0.978
rpoC763947p.Ala193Val0.978
rpoC763951c.582G>C0.978
rpoC763960c.591T>G0.978
rpoC763969c.600C>T0.978
rpoC763987c.618C>T0.957
rpoC763991p.Ile208Leu0.950
rpoC763996c.627T>C0.944
rpoC763999c.630C>T0.944
rpoC764002c.633C>G0.944
rpoC764003p.Ala212Ser0.944
rpoC764024c.655T>C0.962
rpoC764029p.Glu220Asp0.964
rpoC764032p.Asp221Glu0.935
rpoC764040p.Ser224Thr0.976
rpoC764044c.675T>C0.976
rpoC764054c.685C>T0.977
rpoC764059c.690G>T0.978
rpoC764083c.714A>G0.957
rpoC764084p.Asn239Val0.957
rpoC764095c.726C>T0.978
rpoC764098c.729A>G0.978
rpoC764143c.774G>C0.969
rpoC764147p.Ser260Ala0.964
rpoC764150p.Ile261Val0.964
rpoC764165p.Glu266Gln0.964
rpoC764176c.807C>T0.917
rpoC764177p.Ile270Leu0.900
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A0.960
rpoC764353c.984G>T0.968
rpoC764365c.996C>T0.970
rpoC764371c.1002G>C0.974
rpoC764377c.1008C>G0.975
rpoC764380c.1011G>C0.976
rpoC764387c.1018T>C0.978
rpoC764405c.1036A>C0.981
rpoC764428c.1059G>C0.982
rpoC764431c.1062G>C0.982
rpoC764434c.1065A>G0.964
rpoC764435c.1066A>C0.982
rpoC764458c.1089G>C0.987
rpoC764461c.1092A>G0.988
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T0.989
rpoC764524c.1155C>G0.976
rpoC764530c.1161C>G0.974
rpoC764534c.1165C>A0.973
rpoC764539c.1170C>T0.987
rpoC764542c.1173C>T0.974
rpoC764545c.1176C>A0.974
rpoC764560c.1191T>C0.978
rpoC764575c.1206T>G0.989
rpoC764611c.1242G>T0.988
rpoC764626c.1257C>T0.988
rpoC764632c.1263T>C0.975
rpoC764650c.1281G>T0.987
rpoC764668c.1299C>T0.988
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C0.987
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764896c.1527C>T1.000
rpoC764911c.1542A>G0.987
rpoC764912p.Met515Gln0.987
rpoC764932c.1563C>A0.989
rpoC764948c.1579T>C0.988
rpoC764968c.1599T>C0.987
rpoC765004c.1635G>C0.966
rpoC765007c.1638T>G0.962
rpoC765008c.1639T>C0.962
rpoC765011c.1642A>T0.962
rpoC765016c.1647C>G0.963
rpoC765019c.1650A>G0.963
rpoC765040c.1671T>C0.955
rpoC765041c.1672T>C0.955
rpoC765047c.1678T>C0.955
rpoC765055c.1686C>G0.951
rpoC765073c.1704G>C0.960
rpoC765076c.1707A>G0.957
rpoC765079c.1710T>G0.957
rpoC765082c.1713G>C0.957
rpoC765085c.1716T>C0.957
rpoC765089c.1720T>C0.957
rpoC765100c.1731G>C0.950
rpoC765103c.1734G>T0.950
rpoC765121c.1752G>T0.944
rpoC765129p.Tyr587Phe0.944
rpoC765143p.Val592Ile0.923
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His0.978
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T1.000
rpoC765826c.2457T>C0.974
rpoC765835c.2466C>T0.976
rpoC765841c.2472G>T0.979
rpoC765861p.Phe831Tyr0.982
rpoC765875p.Val836Ile0.985
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>C1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C0.905
rpoC766507c.3138C>T0.909
rpoC766513c.3144C>T0.926
rpoC766522c.3153C>A0.929
rpoC766528c.3159T>G0.929
rpoC766531c.3162G>C0.929
rpoC766534c.3165C>G0.929
rpoC766537c.3168G>A0.929
rpoC766540p.Asp1057Glu0.931
rpoC766549c.3180G>C0.957
rpoC766570c.3201T>C0.960
rpoC766573c.3204T>G0.960
rpoC766594c.3225G>T0.980
rpoC766607p.Ile1080Leu0.980
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766645c.3276A>G1.000
rpoC766651c.3282T>C1.000
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C0.989
rpoC767008c.3639G>A0.988
rpoC767023c.3654C>T0.988
rpoC767044c.3675G>C0.985
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767100p.Lys1244Arg0.980
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T0.984
rpoC767158c.3789T>C0.984
rpoC767179c.3810C>T0.985
rpoC767180p.Ala1271Ser0.985
rpoC767191c.3822C>G0.986
rpoC767197c.3828G>A0.986
rpoC767203c.3834C>G0.984
rpoC767206c.3837C>G0.984
rpoC767209c.3840T>C0.984
rpoC767212c.3843G>C0.984
rpoC767221c.3852C>G0.986
rpoC767230c.3861G>C0.986
rpoC767233c.3864T>C0.986
rpoC767254c.3885G>C0.986
rpoC767264p.Ala1299Ser0.983
rpoC767267p.Ala1300Asn0.983
rpoC767281c.3912C>G0.983
rpoC767284c.3915C>G0.983
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C0.987
rpsL781649c.90T>C0.988
rpsL781655c.96T>C0.988
rpsL781658c.99A>C0.976
rpsL781670c.111G>C0.986
rpsL781706c.147T>C0.982
rpsL781715c.156T>G0.980
rpsL781772c.213C>T0.967
rpsL781802c.243G>C0.977
rpsL781805c.246G>A0.956
rpsL781814c.255C>T0.980
rpsL781817c.258G>T0.980
rpsL781829c.270G>C0.981
rpsL781832c.273T>C0.982
rpsL781859c.300T>C0.946
rpsL781868c.309T>C0.942
rpsL781871c.312G>C0.941
rpsL781877c.318T>A0.957
rpsL781892c.333A>G0.951
rpsL781898c.339A>T0.950
rpsL781907c.348T>C0.941
rpsL781916c.357T>C0.935
rpsL781929p.Gly124Ser0.923
rpsL781933374G>A0.913
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472286r.441c>g1.000
rrs1472287r.442c>t1.000
rrs1472289r.444t>g1.000
rrs1472290r.445c>g1.000
rrs1472313r.468g>a0.909
rrs1472315r.470t>g0.909
rrs1472324r.479g>c0.909
rrs1472325r.480g>c0.909
rrs1472327r.482g>a0.909
rrs1472328r.483g>c0.909
rrs1472337r.492c>g0.977
rrs1472380r.535g>c0.985
rrs1472446r.601t>a0.984
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.986
rrs1472734r.889c>t0.982
rrs1472741r.896g>a0.982
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c0.980
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g0.980
rrs1472970r.1125c>g0.979
rrs1472977r.1132g>c0.959
rrs1472978r.1133t>c0.980
rrs1472989r.1144g>a0.984
rrs1472990r.1145a>g0.985
rrs1473082r.1237g>a0.979
rrs1473088r.1243a>g0.979
rrs1473099r.1254t>a0.973
rrs1473104r.1259c>t0.972
rrs1473105r.1260g>a0.972
rrs1473110r.1265t>g0.972
rrs1473111r.1266a>g0.972
rrs1473121r.1276t>c1.000
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473164r.1319c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t0.981
rrs1473290r.1445c>t0.981
rrs1473291r.1446g>t0.981
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac1.000
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c0.977
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a0.985
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c0.981
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a0.979
rrl1473923r.266c>g0.974
rrl1473937r.280c>t0.972
rrl1473943r.286g>t0.963
rrl1473945r.288t>a0.963
rrl1473946r.289a>t0.963
rrl1473950r.293g>t0.963
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t0.976
rrl1474140r.483c>t0.980
rrl1474151r.494c>t0.963
rrl1474184r.527c>a0.964
rrl1474249r.592g>t0.948
rrl1474263r.606g>a0.980
rrl1474282r.625g>a0.976
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c0.976
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.976
rrl1474496r.839c>g0.943
rrl1474497r.840g>c0.944
rrl1474506r.849c>g0.979
rrl1474507r.850g>c0.980
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474710r.1053tggtg>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g0.983
rrl1474794r.1137c>t0.984
rrl1474803r.1146g>a0.984
rrl1474812r.1155g>a0.984
rrl1474830r.1173a>g0.968
rrl1474913r.1256t>c0.984
rrl1474932r.1275c>t0.981
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a0.974
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g0.980
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c0.973
rrl1475764r.2107a>t0.968
rrl1475765r.2108a>t0.969
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a0.933
rrl1476086r.2429g>a0.933
rrl1476088r.2431a>c0.875
rrl1476099r.2442a>g0.824
rrl1476103r.2446c>g0.875
rrl1476105r.2448g>a0.824
rrl1476106r.2449a>t0.824
rrl1476110r.2453g>c0.875
rrl1476114r.2457t>c0.824
rrl1476115r.2458t>c0.882
rrl1476131r.2474c>t0.950
rrl1476160r.2503t>c0.962
rrl1476214r.2557g>t0.979
rrl1476215r.2558c>t0.979
rrl1476221r.2564t>c0.979
rrl1476224r.2567a>g0.979
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c0.978
rrl1476297r.2640c>t0.978
rrl1476299r.2642c>t0.978
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t0.985
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674858c.657G>A1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
inhA1674993c.792G>T1.000
rpsA1833536c.-6A>C0.957
rpsA1833538c.-4CA>C0.957
rpsA1833541c.-1T>C0.958
rpsA1833547c.6G>A0.970
rpsA1833589c.48A>C0.981
rpsA1833595c.54T>G0.981
rpsA1833596p.Ser19Ala0.981
rpsA1833604c.63C>T0.984
rpsA1833616c.75A>T0.985
rpsA1833619c.78A>C0.985
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G0.982
rpsA1834639c.1098T>C0.983
rpsA1834645c.1104C>T0.984
rpsA1834666c.1125G>C0.986
rpsA1834667p.Ala376Ser0.986
rpsA1834690c.1149T>C0.987
rpsA1834700p.Gln387Ala0.984
rpsA1834705c.1164C>G0.985
rpsA1834720c.1179C>G0.987
rpsA1834732c.1191T>C0.987
rpsA1834738c.1197A>G0.987
rpsA1834753c.1212T>C0.987
rpsA1834759c.1218A>C0.986
rpsA1834765p.Glu408Asp0.986
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>A1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T0.982
kasA2518849c.735G>C0.982
kasA2518853p.Leu247Val0.982
kasA2518864c.750G>C0.980
panD4044138c.144A>G0.923
panD4044150c.132T>G0.938
panD4044156c.126T>C0.938
panD4044167c.115G>A0.938
panD4044171c.111G>A0.938
panD4044174c.108G>A0.938
panD4044180p.Asp34Glu0.938
panD4044188c.94C>G0.938
panD4044189c.93G>A0.938
panD4044194p.Ala30Pro0.938
panD4044195c.87A>G1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240729c.867C>G0.981
embC4240735c.873C>G0.981
embC4240741c.879C>T0.983
embC4240756c.894G>C0.984
embC4240771c.909G>C0.980
embC4240772p.Ser304Ala0.980
embC4240778p.His306Gly0.979
embC4240781p.Ala307Ser0.958
embC4240789c.927T>C0.985
embC4240819c.957A>C0.984
embC4240826p.Ala322Ser0.982
embC4240831c.969T>G0.981
embC4240856p.Ala332Thr0.970
embC4240859p.Leu333Ile0.970
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embC4240909c.1047G>C1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;