TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d25af1bbaa4e
Sample: 5d25af1bbaa4e

Download results

Summary
ID: 5d25af1bbaa4e
Date: Wed Jul 10 10:28:57 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6202c.963C>T1.000
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C1.000
gyrB6223c.984G>C1.000
gyrB6229c.990G>A1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.950
gyrB6775c.1536G>C0.949
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C0.985
gyrB6862c.1623C>G0.984
gyrB6869c.1630T>C0.961
gyrB6872c.1633T>C0.959
gyrB6878c.1639T>C0.959
gyrB6889c.1650G>A0.957
gyrB6898c.1659G>T0.952
gyrB7006c.1767T>G0.923
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>C1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7078c.1839A>G1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G0.923
gyrB7090c.1851C>T0.923
gyrB7093c.1854T>C0.923
gyrB7100c.1861T>C0.923
gyrA7499c.198G>C0.981
gyrA7511c.210C>T0.983
gyrA7523c.222C>G0.986
gyrA7526c.225G>C0.986
gyrA7547c.246C>T0.988
gyrA7553c.252C>T0.988
gyrA7559c.258G>C0.989
gyrA7565c.264C>T0.989
gyrA7574c.273G>C0.989
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.990
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C0.944
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile0.944
gyrA8192c.891C>G0.944
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C0.975
gyrA8283p.Ile328Leu0.978
gyrA8288c.987T>C0.980
gyrA8294c.993T>C0.984
gyrA8330c.1029C>G0.985
gyrA8339c.1038A>G0.983
gyrA8340p.Ala347Ser0.983
gyrA8354c.1053G>C0.982
gyrA8372c.1071G>T0.979
gyrA8382c.1081C>T1.000
gyrA8828c.1527T>C0.923
gyrA8829c.1528T>C0.923
gyrA8837c.1536C>G0.941
gyrA8840c.1539C>T0.895
gyrA8846c.1545C>T0.969
gyrA8852c.1551T>C0.971
gyrA8858c.1557T>C0.973
gyrA8870c.1569G>C0.956
gyrA8873c.1572A>G0.977
gyrA8897c.1596T>C0.982
gyrA8903c.1602T>C0.983
gyrA8915c.1614A>G0.984
gyrA8942c.1641G>C0.982
gyrA8945c.1644G>C0.981
gyrA8946c.1645T>C0.981
gyrA8957c.1656C>T0.980
gyrA8967p.Ala556Lys0.976
gyrA8978c.1677C>T0.975
gyrA8987c.1686C>G0.963
gyrA8990c.1689C>G0.960
gyrA8993c.1692C>T0.960
gyrA8996c.1695T>C0.960
gyrA8998p.Leu566Trp0.960
gyrA9018p.Gln573Lys1.000
gyrA9023c.1722A>C1.000
gyrA9026c.1725G>C1.000
gyrA9029c.1728T>C1.000
gyrA9035c.1734G>C1.000
rpoB760079c.273G>A0.946
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C0.982
rpoB760244c.438G>C0.982
rpoB760256c.450C>T0.979
rpoB760274p.Glu156Asp0.970
rpoB760276p.Lys157Met0.970
rpoB760283c.477G>C0.970
rpoB760298c.492G>C0.963
rpoB760307c.501T>C0.962
rpoB760357p.Thr184Ser0.955
rpoB760361c.555T>C0.958
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.982
rpoB760407p.Ser201Gly0.983
rpoB760415c.609C>T0.984
rpoB760418c.612G>C0.985
rpoB760430c.624T>C0.986
rpoB760460c.654G>C0.989
rpoB760475c.669A>G0.989
rpoB760481c.675G>C0.988
rpoB760484c.678A>G0.988
rpoB760502c.696C>G0.989
rpoB760522p.Ser239Asn0.989
rpoB760532c.726T>C0.987
rpoB760541c.735G>C0.972
rpoB760567p.Ser254Trp0.971
rpoB760571c.765G>C0.971
rpoB760588p.Thr261Ile0.979
rpoB760591p.Val262Ala0.979
rpoB760595c.789C>T0.979
rpoB760596p.Thr264Pro0.979
rpoB760608c.802C>T0.983
rpoB760611c.805T>C0.984
rpoB760634c.828T>C0.985
rpoB760646c.840C>G0.984
rpoB760655c.849A>G0.981
rpoB760661c.855A>G0.980
rpoB760668p.Thr288Ala0.976
rpoB760674c.868T>C0.952
rpoB760679c.873A>G0.976
rpoB760683c.877T>C0.976
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760747c.942 942del1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.987
rpoC763660c.291T>G0.986
rpoC763666c.297G>C0.985
rpoC763669c.300C>G0.984
rpoC763675c.306C>G0.984
rpoC763699c.330G>T0.978
rpoC763702c.333C>G0.977
rpoC763708c.339G>C0.971
rpoC763711c.342G>C0.970
rpoC763714c.345G>C0.970
rpoC763717c.348T>C0.970
rpoC763723c.354G>C0.970
rpoC763732c.363C>A0.969
rpoC763741c.372C>T0.955
rpoC763744c.375G>C0.955
rpoC763747c.378G>A0.955
rpoC763765c.396T>C0.933
rpoC763888c.519G>T0.938
rpoC763891c.522G>C0.944
rpoC763894c.525A>G0.950
rpoC763900c.531G>C0.974
rpoC763933c.564C>T0.974
rpoC763940p.Ala191Ser0.950
rpoC763945c.576T>C0.950
rpoC763947p.Ala193Val0.927
rpoC763951c.582G>C0.927
rpoC763960c.591T>G0.927
rpoC763969c.600C>T0.927
rpoC763987c.618C>T0.900
rpoC763991p.Ile208Leu0.897
rpoC763996c.627T>C0.897
rpoC763999c.630C>T0.897
rpoC764002c.633C>G0.897
rpoC764003p.Ala212Ser0.897
rpoC764024c.655T>C0.944
rpoC764029p.Glu220Asp0.941
rpoC764032p.Asp221Glu0.943
rpoC764040p.Ser224Thr0.957
rpoC764044c.675T>C0.978
rpoC764054c.685C>T0.980
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T1.000
rpoC764098c.729A>G1.000
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764242c.873C>T0.882
rpoC764254c.885G>C0.800
rpoC764266c.897T>G0.800
rpoC764278c.909A>G0.800
rpoC764279p.Gln304Asn0.800
rpoC764284c.915G>C0.800
rpoC764285p.Gly306Thr0.800
rpoC764293c.924G>A0.800
rpoC764296c.927G>C0.800
rpoC764297p.Met310Gly0.800
rpoC764311c.942C>G0.931
rpoC764317c.948C>G0.935
rpoC764320c.951C>G0.935
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G0.970
rpoC764530c.1161C>G0.984
rpoC764534c.1165C>A0.967
rpoC764539c.1170C>T0.983
rpoC764542c.1173C>T0.966
rpoC764545c.1176C>A0.983
rpoC764560c.1191T>C0.972
rpoC764575c.1206T>G0.975
rpoC764611c.1242G>T0.988
rpoC764626c.1257C>T0.989
rpoC764632c.1263T>C0.988
rpoC764650c.1281G>T0.988
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.989
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.988
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764896c.1527C>T0.978
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C0.980
rpoC765041c.1672T>C0.980
rpoC765047c.1678T>C0.980
rpoC765055c.1686C>G0.979
rpoC765073c.1704G>C0.966
rpoC765076c.1707A>G0.964
rpoC765079c.1710T>G0.964
rpoC765082c.1713G>C0.964
rpoC765085c.1716T>C0.964
rpoC765089c.1720T>C0.964
rpoC765100c.1731G>C0.960
rpoC765103c.1734G>T0.960
rpoC765121c.1752G>T0.955
rpoC765129p.Tyr587Phe0.955
rpoC765143p.Val592Ile0.950
rpoC765370c.2001G>C0.929
rpoC765379c.2010G>C0.933
rpoC765382c.2013G>T0.933
rpoC765383p.Met672Leu0.875
rpoC765403c.2034G>C0.913
rpoC765405p.Leu679His0.913
rpoC765409c.2040T>G0.958
rpoC765421c.2052C>G0.967
rpoC765449p.Ala694Ser0.976
rpoC765454c.2085C>G0.976
rpoC765469c.2100G>C0.983
rpoC765478c.2109T>G0.982
rpoC765480p.Tyr704Phe0.983
rpoC765499c.2130C>G0.984
rpoC765517c.2148C>G0.981
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T0.973
rpoC765548c.2179A>T0.973
rpoC765553c.2184C>T0.973
rpoC765556c.2187G>C0.973
rpoC765562c.2193G>T0.947
rpoC765591p.Arg741Gln0.727
rpoC765596p.Lys743Ala0.727
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G1.000
rpoC766021c.2652G>C1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>C1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766645c.3276A>G1.000
rpoC766651c.3282T>C1.000
rpoC766792c.3423C>G0.864
rpoC766799p.Ala1144Ser0.864
rpoC766804c.3435A>G0.864
rpoC766837c.3468G>C0.905
rpoC766843c.3474T>G0.905
rpoC766846c.3477C>A0.905
rpoC766858c.3489C>T0.905
rpoC766861c.3492G>C0.905
rpoC766867c.3498C>G0.905
rpoC766876c.3507C>T0.950
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767100p.Lys1244Arg1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C0.986
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C0.977
rpsL781715c.156T>G0.974
rpsL781766c.207C>T0.800
rpsL781772c.213C>T0.943
rpsL781802c.243G>C0.975
rpsL781805c.246G>A0.975
rpsL781814c.255C>T0.976
rpsL781817c.258G>T0.976
rpsL781829c.270G>C0.980
rpsL781832c.273T>C0.980
rpsL781859c.300T>C0.977
rpsL781868c.309T>C0.975
rpsL781871c.312G>C0.974
rpsL781877c.318T>A0.974
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rplC800806c.-3G>A0.909
rplC800808c.-1A>C0.909
rplC800815c.7C>A0.909
rplC800820c.12G>A0.909
rplC800823c.15C>A0.909
rplC800829c.21C>G1.000
rplC800832c.24T>C1.000
rplC800856c.48A>G1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a0.982
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.981
rrs1472286r.441c>g0.909
rrs1472287r.442c>t0.900
rrs1472289r.444t>g0.900
rrs1472290r.445c>g0.900
rrs1472313r.468g>a0.900
rrs1472315r.470t>g0.900
rrs1472324r.479g>c0.900
rrs1472325r.480g>c0.900
rrs1472327r.482g>a0.900
rrs1472328r.483g>c0.917
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.961
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473697r.40c>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c0.982
rrl1473831r.174g>t0.981
rrl1473832r.175c>t0.981
rrl1473839r.182g>a0.984
rrl1473876r.219g>a0.982
rrl1473887r.230t>c0.980
rrl1473888r.231t>c0.980
rrl1473898r.241c>t0.978
rrl1473899r.242a>g0.977
rrl1473916r.259c>a0.974
rrl1473923r.266c>g0.971
rrl1473937r.280c>t0.969
rrl1473943r.286g>t0.963
rrl1473945r.288t>a0.962
rrl1473946r.289a>t0.962
rrl1473950r.293g>t0.962
rrl1474051r.394t>c0.900
rrl1474054r.397t>c0.900
rrl1474056r.399t>c0.917
rrl1474061r.404t>c0.929
rrl1474074r.417c>t0.952
rrl1474089r.432c>t0.962
rrl1474093r.436g>a0.962
rrl1474100r.443c>t0.962
rrl1474103r.446a>c0.962
rrl1474130r.473c>t0.979
rrl1474140r.483c>t0.980
rrl1474151r.494c>t0.982
rrl1474181r.524c>ct0.859
rrl1474184r.527c>a0.982
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474306r.649a>c0.962
rrl1474308r.651g>t0.962
rrl1474310r.653t>g0.964
rrl1474356r.699t>c0.982
rrl1474362r.705a>g0.982
rrl1474387r.730c>t0.982
rrl1474413r.756a>c0.975
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.974
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c0.965
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c0.973
rrl1475076r.1419c>a0.978
rrl1475090r.1433a>t0.962
rrl1475114r.1457c>t0.967
rrl1475120r.1463g>t0.966
rrl1475129r.1472g>a0.964
rrl1475202r.1545g>c0.977
rrl1475209r.1552g>a0.976
rrl1475213r.1556c>t0.975
rrl1475220r.1563g>t0.947
rrl1475429r.1772g>a0.970
rrl1475443r.1786g>a0.971
rrl1475452r.1795c>a0.971
rrl1475475r.1818c>t0.974
rrl1475479r.1822c>t0.971
rrl1475480r.1823a>t0.971
rrl1475505r.1848g>a0.973
rrl1475526r.1869c>a0.973
rrl1475531r.1874c>t0.974
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g0.939
rrl1475659r.2002g>a0.950
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c0.983
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c0.976
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c0.983
rrl1476297r.2640c>t0.965
rrl1476299r.2642c>t0.982
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674855c.654C>G1.000
inhA1674858c.657G>A1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
inhA1674993c.792G>T1.000
rpsA1833536c.-6A>C0.923
rpsA1833538c.-4CA>C0.923
rpsA1833541c.-1T>C0.923
rpsA1833547c.6G>A0.947
rpsA1833589c.48A>C0.984
rpsA1833595c.54T>G0.984
rpsA1833596p.Ser19Ala0.984
rpsA1833604c.63C>T0.986
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.979
rpsA1833734p.Ala65Ser0.979
rpsA1833742c.201A>G0.981
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C0.984
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T0.984
rpsA1834249c.708T>C0.984
rpsA1834252c.711C>G0.985
rpsA1834261c.720A>G0.987
rpsA1834264c.723G>C0.987
rpsA1834279c.738C>T0.988
rpsA1834294c.753G>T0.986
rpsA1834297c.756C>T0.986
rpsA1834303c.762T>G0.986
rpsA1834306c.765T>C0.986
rpsA1834327c.786G>T0.989
rpsA1834357c.816T>C0.976
rpsA1834366c.825A>G0.976
rpsA1834375c.834G>C0.976
rpsA1834396c.855G>C0.988
rpsA1834411c.870T>G0.985
rpsA1834414c.873C>T0.985
rpsA1834417c.876G>C0.985
rpsA1834420c.879C>T0.985
rpsA1834423c.882G>C0.986
rpsA1834429c.888C>T0.988
rpsA1834438c.897C>T0.989
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T0.985
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>A1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu0.970
panD4044188c.94C>G0.970
panD4044189c.93G>A0.970
panD4044194p.Ala30Pro0.971
panD4044195c.87A>G0.971
panD4044233p.Cys17His0.985
panD4044234c.48G>C0.985
panD4044249c.33G>A0.985
panD4044266p.Leu6Met0.983
panD4044273c.9C>G0.980
panD4044276p.Leu2Phe0.979
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C0.987
embC4240826p.Ala322Ser0.986
embC4240831c.969T>G0.984
embC4240856p.Ala332Thr0.979
embC4240859p.Leu333Ile0.979
embC4240876c.1014C>T0.978
embC4240879c.1017G>T0.977
embC4240885c.1023T>C0.976
embC4240886p.Ile342Val0.976
embC4240897c.1035C>G0.974
embC4240900c.1038A>G0.974
embB4248206p.Ser565Gly0.800
embB4248220c.1707A>G0.952
embB4248226c.1713G>C0.953
embB4248232c.1719G>T0.953
embB4248233p.Leu574Val0.953
embB4248236p.Met575Leu0.956
embB4248245p.Ile578Val0.981
embB4248250c.1737C>T0.983
embB4248259p.Met582Ile0.983
embB4248275p.Thr588Ala0.983
embB4248292c.1779G>A0.983

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;