TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d25b09ecfefd
Sample: 5d25b09ecfefd

Download results

Summary
ID: 5d25b09ecfefd
Date: Wed Jul 10 10:35:17 2019
Strain: root
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6086p.Thr283Pro0.947
gyrB6097c.858G>A0.613
gyrB6100c.861G>C0.333
gyrB6109c.870G>C0.636
gyrB6115c.876A>G0.970
gyrB6121c.882C>T0.333
gyrB6123p.Ala295Gly0.636
gyrB6127c.888G>T0.333
gyrB6130c.891T>C0.636
gyrB6133c.894G>C0.970
gyrB6136c.897G>A0.333
gyrB6151c.912C>T0.333
gyrB6172c.933C>T0.344
gyrB6175c.936G>A0.625
gyrB6181c.942C>A0.613
gyrB6184c.945C>T0.967
gyrB6193c.954G>A0.286
gyrB6196c.957C>T0.947
gyrB6202c.963C>T0.222
gyrB6202r.963ca>c1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C0.176
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C0.714
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T0.718
gyrB6745c.1506T>C0.975
gyrB6751c.1512G>C0.262
gyrB6754c.1515C>T0.750
gyrB6760c.1521G>C0.244
gyrB6763c.1524G>C0.750
gyrB6769c.1530C>T0.250
gyrB6772c.1533C>G0.750
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C1.000
gyrB6797p.Gly520Thr0.250
gyrB6808c.1569C>G0.256
gyrB6811c.1572C>T0.256
gyrB6824c.1585C>T0.714
gyrB6838c.1599C>G0.171
gyrB6841c.1602T>C1.000
gyrB6844c.1605T>G0.176
gyrB6853c.1614A>G0.176
gyrB6856c.1617T>C0.125
gyrB6859c.1620T>C0.125
gyrB6862c.1623C>G0.871
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A0.923
gyrB6898c.1659G>T0.917
gyrB6955c.1716G>A0.964
gyrB6970p.Asp577Glu0.964
gyrB6982c.1743A>C0.125
gyrB6985c.1746C>T0.125
gyrB6988c.1749C>G0.125
gyrB7006c.1767T>G0.176
gyrB7010p.Leu591Ile0.176
gyrB7015c.1776G>A0.176
gyrB7018c.1779G>C0.171
gyrB7108c.1869G>A0.562
gyrB7123c.1884C>G0.933
gyrB7126c.1887G>A0.923
gyrB7129c.1890T>G0.923
gyrB7132c.1893T>G0.923
gyrB7153c.1914G>T0.920
gyrB7156c.1917C>T0.920
gyrB7159c.1920C>T0.920
gyrB7162c.1923C>T0.920
gyrB7165c.1926C>T0.920
gyrB7168c.1929C>G0.958
gyrB7178c.1939T>C0.966
gyrB7210p.Asp657Glu0.966
gyrB7213c.1974G>A0.966
gyrB7225c.1986T>C0.958
gyrB7234c.1995C>T0.957
gyrB7243c.2004G>A1.000
gyrB7246c.2007T>C1.000
gyrA7343c.42G>T1.000
gyrA7355c.54T>C1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7406c.105G>C1.000
gyrA7412c.111C>G1.000
gyrA7418c.117C>T1.000
gyrA7433c.132G>A1.000
gyrA7442c.141G>C1.000
gyrA7457c.156T>C1.000
gyrA7463c.162G>C1.000
gyrA7472c.171T>C1.000
gyrA7475c.174A>G1.000
gyrA7480p.Phe60Tyr1.000
gyrA7484c.183T>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T0.220
gyrA7523c.222C>G0.256
gyrA7526c.225G>C0.262
gyrA7532c.231T>G0.721
gyrA7541c.240C>G0.643
gyrA7547c.246C>T1.000
gyrA7553c.252C>T0.400
gyrA7559c.258G>C0.400
gyrA7565c.264C>T1.000
gyrA7569p.Ala90Ser0.548
gyrA7574c.273G>C0.487
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.548
gyrA7592c.291G>C0.421
gyrA7595c.294C>T0.405
gyrA7601c.300C>T0.429
gyrA7607c.306C>T0.412
gyrA7613c.312G>A0.394
gyrA7622c.321C>T0.367
gyrA7631c.330G>C0.333
gyrA7637c.336C>A0.333
gyrA7728c.427A>C0.964
gyrA7763c.462T>G0.953
gyrA7775c.474C>T0.956
gyrA7784c.483A>G0.955
gyrA7790c.489G>C0.955
gyrA7796c.495G>T0.952
gyrA7799c.498A>G0.952
gyrA7802c.501C>G0.952
gyrA7832c.531G>T0.974
gyrA7835c.534A>G0.973
gyrA7841c.540C>T0.971
gyrA7847c.546G>C0.971
gyrA7859c.558A>C0.966
gyrA7865c.564T>C0.963
gyrA7886c.585T>G0.955
gyrA8156c.855T>C1.000
gyrA8159c.858G>C0.368
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile0.368
gyrA8191p.Ala297Gly0.632
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8210c.909G>A0.632
gyrA8219c.918T>C1.000
gyrA8222c.921C>T1.000
gyrA8225c.924T>C1.000
gyrA8267c.966G>C0.964
gyrA8283p.Ile328Leu0.966
gyrA8288c.987T>C0.966
gyrA8294c.993T>C0.974
gyrA8324c.1023T>C0.489
gyrA8327c.1026C>G0.356
gyrA8330c.1029C>G0.489
gyrA8339c.1038A>G0.976
gyrA8340p.Ala347Ser0.976
gyrA8354c.1053G>C0.974
gyrA8366c.1065G>C0.459
gyrA8372c.1071G>T0.543
gyrA8382c.1081C>T0.562
gyrA8471c.1170T>C1.000
gyrA8480c.1179C>T1.000
gyrA8486c.1185T>C1.000
gyrA8504c.1203G>C1.000
gyrA8510c.1209G>A0.957
gyrA8513c.1212C>G0.957
gyrA8516c.1215T>C0.957
gyrA8519c.1218A>G0.957
gyrA8520c.1219C>T0.957
gyrA8535p.Glu412Gln0.976
gyrA8546p.Asp415Glu0.977
gyrA8561c.1260A>C0.978
gyrA8571c.1270C>T0.978
gyrA8603c.1302A>C0.976
gyrA8810c.1509A>G0.333
gyrA8813p.Asp504Glu0.308
gyrA8816c.1515C>G0.308
gyrA8817p.Ser506Ala0.600
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T0.455
gyrA8846c.1545C>T0.543
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C0.432
gyrA8867c.1566A>G0.410
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8876c.1575C>T0.390
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8939c.1638T>C0.303
gyrA8942c.1641G>T0.367
gyrA8945c.1644G>C0.286
gyrA8946c.1645T>C1.000
gyrA8952p.Gln551Ala0.286
gyrA8957c.1656C>T0.625
gyrA8967p.Ala556Asn1.000
gyrA8978c.1677C>T0.636
gyrA8981c.1680G>C0.400
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G0.333
gyrA8993c.1692C>T0.333
gyrA8996c.1695T>C0.333
gyrA8998p.Leu566Trp1.000
gyrA9650c.2349G>C1.000
gyrA9656c.2355C>G1.000
gyrA9662c.2361G>C1.000
gyrA9668c.2367C>T1.000
gyrA9683c.2382G>T1.000
gyrA9689c.2388G>T1.000
gyrA9701c.2400T>C1.000
gyrA9707c.2406G>C1.000
gyrA9716c.2415T>C0.917
gyrA9738p.Leu813Ile0.917
gyrA9743c.2442C>G0.917
gyrA9746c.2445C>T0.917
rpoB760079c.273G>A0.692
rpoB760082c.276C>T0.308
rpoB760088c.282C>G0.308
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760104c.298T>A0.286
rpoB760110c.304T>A0.588
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760136c.330G>A0.622
rpoB760139c.333A>T0.395
rpoB760142c.336C>G0.600
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.286
rpoB760274p.Glu156Asp0.244
rpoB760276p.Lys157Met0.238
rpoB760283c.477G>C0.976
rpoB760298c.492G>C1.000
rpoB760307c.501T>C0.163
rpoB760310c.504G>C0.837
rpoB760316c.510C>G1.000
rpoB760325c.519G>C1.000
rpoB760331c.525G>C1.000
rpoB760334c.528G>T1.000
rpoB760340c.534G>T1.000
rpoB760357p.Thr184Ser0.977
rpoB760361c.555T>C0.977
rpoB760376p.Asp190Glu0.980
rpoB760400c.594G>C0.130
rpoB760406c.600G>C0.927
rpoB760407p.Ser201Gly0.981
rpoB760415c.609C>T0.983
rpoB760418c.612G>C0.220
rpoB760424c.618C>G0.758
rpoB760430c.624T>C0.983
rpoB760433c.627C>T0.754
rpoB760457c.651C>T0.672
rpoB760460c.654G>C0.311
rpoB760463c.657C>T0.667
rpoB760475c.669A>G0.980
rpoB760478c.672C>T0.560
rpoB760481c.675G>T0.420
rpoB760484c.678A>G0.980
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760533p.Val243Thr0.395
rpoB760541c.735G>C1.000
rpoB760547c.741G>C0.439
rpoB760567p.Ser254Trp0.955
rpoB760571c.765G>C0.958
rpoB760585p.Asn260Ser0.641
rpoB760588p.Thr261Ile0.333
rpoB760591p.Val262Ala0.974
rpoB760595c.789C>T0.974
rpoB760596p.Thr264Pro0.975
rpoB760608c.802C>T0.304
rpoB760611c.805T>C0.979
rpoB760634c.828T>C0.298
rpoB760646c.840C>G0.981
rpoB760655c.849A>G0.981
rpoB760661c.855A>C0.222
rpoB760668p.Thr288Ala0.167
rpoB760674c.868T>C0.977
rpoB760679c.873A>G0.978
rpoB760683c.877T>C0.979
rpoB760703c.897C>T1.000
rpoB760721c.915C>G0.971
rpoB760724c.918T>C0.824
rpoB760727c.921C>G0.147
rpoB760730c.924T>C0.970
rpoB760736c.930C>G0.156
rpoB760748c.942C>G0.944
rpoB760751c.945G>C0.941
rpoB760755p.His317Asn0.941
rpoB760759p.Val318Ala0.941
rpoB760764p.Glu320Gln0.944
rpoB760769c.963C>G0.944
rpoB760784c.978G>T1.000
rpoB760793c.987A>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala0.579
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T0.579
rpoB760877c.1071G>T0.308
rpoB760883c.1077G>C0.308
rpoB760886p.Glu360Asp0.308
rpoB760887p.Thr361Val0.962
rpoB760910c.1104C>T0.968
rpoB760916c.1110C>T0.966
rpoB760919c.1113C>T0.310
rpoB760925c.1119T>C0.269
rpoB760928c.1122G>C0.962
rpoB760931c.1125C>G0.280
rpoB760943c.1137C>T0.667
rpoB760946c.1140A>G0.958
rpoB760965p.Met387Leu0.944
rpoB760970c.1164G>C0.944
rpoB760973c.1167G>T0.353
rpoB760982c.1176G>C0.909
rpoB760985c.1179G>C0.900
rpoB760988c.1182C>G0.900
rpoB760991c.1185G>T0.900
rpoB760997c.1191G>C0.909
rpoB761006c.1200C>G0.636
rpoB761015c.1209G>C0.909
rpoB761084c.1278C>A0.929
rpoB761097c.1291A>T0.929
rpoB761102c.1296A>G1.000
rpoB761111c.1305C>T0.514
rpoB761132c.1326G>C0.462
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T0.513
rpoB761178p.Ser458Thr0.512
rpoB761186p.Glu460Asp0.476
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C0.462
rpoB761213c.1407G>C0.425
rpoB761217p.Pro471Ser0.421
rpoB761234c.1428G>C0.970
rpoB761249c.1443A>G0.971
rpoB761255c.1449T>G0.552
rpoB761258c.1452G>A0.571
rpoB761261c.1455G>C0.370
rpoB761264c.1458C>G0.964
rpoB761273c.1467T>C0.517
rpoB761282c.1476C>T0.516
rpoB761288c.1482G>T0.571
rpoB761303c.1497G>C0.342
rpoB761318c.1512G>T0.974
rpoB761327c.1521A>G0.973
rpoB761330c.1524G>C0.703
rpoB761333c.1527G>T0.237
rpoB761339c.1533C>G0.211
rpoB761345c.1539G>C1.000
rpoB761354c.1548C>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761367p.Glu521Gln1.000
rpoB761374p.Val523Asp1.000
rpoB761408c.1602G>C1.000
rpoB761414c.1608A>G1.000
rpoB761423c.1617T>C1.000
rpoB761528c.1722C>T0.219
rpoB761531c.1725C>T0.242
rpoB761537c.1731C>G0.972
rpoB761552c.1746G>C0.707
rpoB761555c.1749G>C0.976
rpoB761558c.1752C>G0.976
rpoB761564c.1758G>C0.250
rpoB761570c.1764T>C0.957
rpoB761573c.1767C>G0.900
rpoB761579c.1773G>C0.982
rpoB761606c.1800C>G0.661
rpoB761612c.1806G>T0.984
rpoB761615c.1809A>C0.983
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761648c.1842T>C0.667
rpoB761657c.1851C>T0.304
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A0.258
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T0.267
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C0.296
rpoB761705c.1899C>A0.333
rpoB761708c.1902C>T0.556
rpoB761712p.Val636Ile0.529
rpoB761718p.Ala638Phe0.333
rpoB761747c.1941G>C0.941
rpoB761765c.1959T>C0.941
rpoB761772p.His656Ala0.938
rpoB761778p.Asn658Asp0.938
rpoB761785p.Thr660Ser0.938
rpoB761791p.Arg662His0.938
rpoB761813c.2007T>C0.938
rpoB761834c.2028T>C0.929
rpoB761885c.2079T>C0.750
rpoB761891c.2085G>C1.000
rpoB761892p.Ile696Val0.706
rpoB761906c.2100C>G0.550
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C0.950
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761921c.2115C>T0.545
rpoB761924c.2118G>A0.345
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C0.333
rpoB761936c.2130C>T0.323
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>G0.419
rpoB761955p.Ile717Val0.419
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C0.390
rpoB762008c.2202C>T0.984
rpoB762014c.2208C>T0.353
rpoB762038c.2232C>T0.354
rpoB762047c.2241G>A0.984
rpoB762053c.2247T>C0.968
rpoB762056c.2250G>A0.328
rpoB762065c.2259T>C0.288
rpoB762083c.2277T>C0.982
rpoB762086c.2280G>C0.982
rpoB762101c.2295C>G0.967
rpoB762114p.Ile770Val0.984
rpoB762122c.2316C>T0.300
rpoB762131c.2325C>G0.982
rpoB762134c.2328C>A0.273
rpoB762137c.2331C>T0.980
rpoB762140c.2334G>C0.981
rpoB762143c.2337T>C0.982
rpoB762149c.2343G>C0.339
rpoB762158c.2352G>C0.982
rpoB762167c.2361T>C0.982
rpoB762176c.2370T>C0.982
rpoB762185c.2379G>C0.982
rpoB762194c.2388G>C0.283
rpoB762224c.2418C>G0.718
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C0.227
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T0.246
rpoB762284c.2478G>T0.210
rpoB762293c.2487T>C0.983
rpoB762296c.2490G>C0.175
rpoB762308c.2502G>C0.806
rpoB762314c.2508C>T0.828
rpoB762317c.2511A>G0.983
rpoB762323c.2517C>A0.136
rpoB762329c.2523G>C0.982
rpoB762338c.2532T>C0.976
rpoB762341c.2535G>C0.976
rpoB762347c.2541T>C1.000
rpoB762350c.2544C>T1.000
rpoB762362p.Glu852Asp1.000
rpoB762369c.2563T>C1.000
rpoB762374c.2568G>C1.000
rpoB762395c.2589G>C1.000
rpoB762398c.2592T>C1.000
rpoB762401c.2595G>C0.800
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>C0.214
rpoB762416c.2610A>G1.000
rpoB762434c.2628T>C0.732
rpoB762443c.2637G>C0.722
rpoB762449c.2643C>A0.980
rpoB762452c.2646G>C0.980
rpoB762470c.2664G>C0.981
rpoB762488c.2682G>C0.200
rpoB762491c.2685T>C0.977
rpoB762509c.2703T>G0.972
rpoB762510p.Ala902Pro0.971
rpoB762515c.2709C>T0.971
rpoB762527c.2721G>C0.697
rpoB762533c.2727T>C0.964
rpoB762536c.2730T>C0.963
rpoB762537c.2731T>C0.963
rpoB762551c.2745C>T0.962
rpoB762557c.2751G>A0.292
rpoB762560c.2754A>T0.227
rpoB762563c.2757G>T0.947
rpoB762812c.3006C>G0.923
rpoB762814p.Met1003Thr0.923
rpoB762816c.3010C>T0.923
rpoB762827c.3021G>T0.286
rpoB762830c.3024C>G0.190
rpoB762833c.3027C>T0.708
rpoB762839c.3033G>A0.692
rpoB762857c.3051C>G0.964
rpoB762860c.3054G>C0.241
rpoB762863c.3057T>C0.967
rpoB762866c.3060C>T0.281
rpoB762879p.Met1025Leu0.971
rpoB762894c.3088C>T0.325
rpoB762899c.3093G>C0.378
rpoB762917c.3111C>G0.959
rpoB762920c.3114C>T0.958
rpoB762923c.3117C>G0.453
rpoB762929c.3123G>C0.490
rpoB762959c.3153G>C0.985
rpoB762962c.3156C>T0.985
rpoB762995c.3189G>T0.986
rpoB763004c.3198G>A0.543
rpoB763007c.3201C>T0.565
rpoB763022c.3216C>G0.563
rpoB763028c.3222T>C0.569
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G0.400
rpoB763040c.3234C>G0.391
rpoB763053c.3247T>C0.671
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T0.300
rpoB763085c.3279C>G0.694
rpoB763088c.3282C>G0.316
rpoB763094c.3288G>C0.310
rpoB763103c.3297G>C0.688
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763130c.3324G>A0.541
rpoB763133c.3327G>C0.541
rpoB763136c.3330C>T1.000
rpoB763142c.3336C>G0.588
rpoB763145c.3339G>A0.412
rpoB763157c.3351G>T0.433
rpoB763160c.3354G>T0.586
rpoB763166c.3360A>G1.000
rpoB763169c.3363A>G0.640
rpoB763172c.3366G>C0.400
rpoB763190c.3384C>T0.611
rpoB763193c.3387C>G0.412
rpoC763375c.6C>A0.839
rpoC763402c.33C>T0.135
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>C0.139
rpoC763415p.Thr16Ser0.139
rpoC763423p.Glu18Asp0.143
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A0.267
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>T0.295
rpoC763528c.159G>A1.000
rpoC763531c.162G>T0.306
rpoC763546c.177A>G1.000
rpoC763558c.189C>T0.667
rpoC763570c.201G>C1.000
rpoC763573c.204G>C0.690
rpoC763594c.225C>T1.000
rpoC763603c.234C>T0.702
rpoC763615c.246G>C0.714
rpoC763618c.249C>T0.700
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.241
rpoC763660c.291T>G1.000
rpoC763666c.297G>A0.231
rpoC763669c.300C>G0.235
rpoC763675c.306C>G1.000
rpoC763702c.333C>G1.000
rpoC763705c.336G>A0.900
rpoC763709c.340C>T0.906
rpoC763714c.345G>C0.969
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>T0.968
rpoC763741c.372C>T1.000
rpoC763747c.378G>A0.974
rpoC763765c.396T>G1.000
rpoC763792p.Glu141Asp0.974
rpoC763807c.438T>C0.971
rpoC763813c.444C>G0.941
rpoC763831c.462A>G0.963
rpoC763837c.468G>C0.962
rpoC763840c.471G>C0.960
rpoC763855c.486C>G0.947
rpoC763858c.489A>G0.944
rpoC763861c.492C>T0.944
rpoC763872p.Gly168Ala1.000
rpoC763876p.Glu169Asp1.000
rpoC763879c.510A>G1.000
rpoC763882c.513G>A0.800
rpoC763888c.519G>T0.182
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763921c.552G>C0.450
rpoC763924c.555G>A0.421
rpoC763930c.561G>A0.421
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C0.154
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763978c.609C>T0.154
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T0.818
rpoC764002c.633C>G0.750
rpoC764003p.Ala212Ser0.750
rpoC764024c.655T>C1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T0.389
rpoC764059c.690G>T1.000
rpoC764071c.702G>C0.579
rpoC764083c.714A>G0.950
rpoC764084p.Asn239Val0.950
rpoC764089c.720C>G0.550
rpoC764095c.726C>T0.400
rpoC764098c.729A>G0.950
rpoC764101c.732C>G0.550
rpoC764102p.Val245Gln0.550
rpoC764110c.741C>T0.206
rpoC764134c.765C>G0.757
rpoC764143c.774G>C0.147
rpoC764147p.Ser260Ala0.121
rpoC764150p.Ile261Val0.121
rpoC764153p.Gln262Lys0.844
rpoC764161c.792G>C0.839
rpoC764182p.Asp271Glu0.958
rpoC764188c.819A>G0.957
rpoC764227c.858G>C0.632
rpoC764239c.870T>G0.739
rpoC764242c.873C>T0.208
rpoC764254c.885G>T0.966
rpoC764257c.888G>C0.812
rpoC764263c.894G>T0.812
rpoC764266c.897T>C0.156
rpoC764272c.903G>C0.829
rpoC764278c.909A>G0.971
rpoC764279p.Gln304Asn0.143
rpoC764284c.915G>C0.143
rpoC764285p.Gly306Thr0.135
rpoC764293c.924G>C0.132
rpoC764296c.927G>C0.128
rpoC764297p.Met310Arg0.128
rpoC764311c.942C>G0.196
rpoC764317c.948C>G0.188
rpoC764320c.951C>G0.245
rpoC764338c.969G>A0.316
rpoC764344c.975C>T0.661
rpoC764353c.984G>T0.983
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G0.259
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C0.327
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764446c.1077T>C0.574
rpoC764449c.1080G>C0.574
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764470c.1101C>T0.294
rpoC764485c.1116G>C0.692
rpoC764491c.1122G>T0.704
rpoC764497c.1128A>G1.000
rpoC764500c.1131C>G0.717
rpoC764510c.1141C>T0.268
rpoC764521c.1152T>C0.737
rpoC764524c.1155C>G0.268
rpoC764527c.1158C>T0.727
rpoC764530c.1161C>G0.232
rpoC764534p.Arg389Ser0.232
rpoC764539c.1170C>G0.258
rpoC764542c.1173C>T0.246
rpoC764545c.1176C>A0.242
rpoC764560c.1191T>C0.306
rpoC764575c.1206T>G0.984
rpoC764605c.1236G>C0.688
rpoC764611c.1242G>T0.987
rpoC764623c.1254C>G0.685
rpoC764626c.1257C>T0.986
rpoC764632c.1263T>C0.974
rpoC764650c.1281G>T0.986
rpoC764668c.1299C>T0.309
rpoC764692c.1323C>T0.313
rpoC764701c.1332C>G0.656
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.391
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.371
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764851c.1482C>T0.642
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>T0.353
rpoC764878c.1509C>G0.660
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764935c.1566T>C0.709
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C0.981
rpoC765007c.1638T>G0.857
rpoC765008c.1639T>C0.857
rpoC765011c.1642A>T0.857
rpoC765016c.1647C>A0.857
rpoC765022c.1653G>T0.706
rpoC765034c.1665T>C0.706
rpoC765040c.1671T>C0.882
rpoC765041c.1672T>C0.833
rpoC765047c.1678T>C0.833
rpoC765055c.1686C>G0.833
rpoC765352c.1983G>C0.900
rpoC765356p.Met663Ala0.300
rpoC765361c.1992C>G0.545
rpoC765370c.2001G>C0.308
rpoC765379c.2010G>C0.267
rpoC765382c.2013G>T0.267
rpoC765383p.Met672Leu0.867
rpoC765400c.2031G>C0.600
rpoC765403c.2034G>C0.867
rpoC765404p.Leu679Asn0.600
rpoC765409c.2040T>C0.267
rpoC765412c.2043T>C0.562
rpoC765421c.2052C>G0.318
rpoC765425p.Lys686Glu0.652
rpoC765445c.2076G>C0.630
rpoC765449p.Ala694Ser0.333
rpoC765452p.Ala695Arg0.615
rpoC765466c.2097C>T0.703
rpoC765469c.2100G>C0.278
rpoC765478c.2109T>C0.242
rpoC765480p.Tyr704Phe1.000
rpoC765496c.2127C>G0.714
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G0.273
rpoC765529c.2160C>T0.710
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G0.222
rpoC765547c.2178C>T0.222
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>C0.273
rpoC765577c.2208G>T0.727
rpoC765591p.Arg741Gln0.917
rpoC765596p.Lys743Gln0.909
rpoC765772c.2403C>G1.000
rpoC765778c.2409C>G1.000
rpoC765779p.Asp804Lys1.000
rpoC765793c.2424C>G1.000
rpoC765796c.2427C>T1.000
rpoC765800p.Phe811Leu1.000
rpoC765811c.2442T>G1.000
rpoC765814c.2445A>C1.000
rpoC765817c.2448G>C1.000
rpoC765823c.2454C>A0.735
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T0.270
rpoC765861p.Phe831Tyr0.327
rpoC765871c.2502T>C0.673
rpoC765875p.Val836Ile1.000
rpoC765886c.2517C>G0.368
rpoC765904c.2535C>G0.635
rpoC765907c.2538G>T0.358
rpoC765908p.Leu847Phe0.642
rpoC765928c.2559C>G0.367
rpoC765934c.2565C>T0.604
rpoC765940c.2571A>T0.978
rpoC765946c.2577C>T0.525
rpoC765947c.2578T>C0.975
rpoC765952c.2583G>C0.538
rpoC765961c.2592G>T0.528
rpoC765962c.2593T>C0.967
rpoC765967c.2598C>T0.967
rpoC765973c.2604C>G0.333
rpoC765979c.2610C>G0.967
rpoC765982c.2613C>T0.967
rpoC765994c.2625A>T0.958
rpoC766003c.2634G>C0.286
rpoC766012c.2643C>G0.933
rpoC766021c.2652G>C0.929
rpoC766027c.2658G>T0.900
rpoC766345c.2976T>C0.962
rpoC766348c.2979A>G0.962
rpoC766351c.2982C>G0.115
rpoC766354c.2985C>G0.148
rpoC766363c.2994G>C0.733
rpoC766369c.3000C>G0.258
rpoC766375c.3006C>G0.258
rpoC766381c.3012C>T0.968
rpoC766384c.3015A>G0.968
rpoC766390c.3021C>T0.969
rpoC766393c.3024C>T0.303
rpoC766408c.3039C>T0.966
rpoC766435p.Glu1022Asp0.909
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766588c.3219G>A0.923
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766765c.3396A>C0.923
rpoC766771c.3402G>C0.923
rpoC766774c.3405T>C0.857
rpoC766775p.Arg1136Lys0.857
rpoC766792c.3423C>G0.400
rpoC766798c.3429C>G0.541
rpoC766799p.Ala1144Ser0.378
rpoC766804c.3435A>G0.917
rpoC766837c.3468G>C0.903
rpoC766843c.3474T>C0.452
rpoC766846c.3477C>G0.438
rpoC766858c.3489C>T0.850
rpoC766861c.3492G>C0.900
rpoC766864c.3495G>C0.200
rpoC766867c.3498C>G0.842
rpoC766876c.3507C>T0.800
rpoC766931p.Ala1188Ser0.381
rpoC766942c.3573C>T0.963
rpoC766945c.3576A>C1.000
rpoC766948c.3579G>C0.433
rpoC766963c.3594T>C1.000
rpoC766978c.3609C>T0.608
rpoC766981c.3612T>C0.615
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767020c.3651C>G0.710
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C0.254
rpoC767080c.3711G>C0.270
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767105p.Asn1246Gln0.714
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C0.259
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T0.281
rpoC767158c.3789T>C1.000
rpoC767162p.Asn1265Ala0.660
rpoC767167c.3798C>T0.615
rpoC767174p.Asn1269Asp0.623
rpoC767179c.3810C>T0.358
rpoC767180p.Ala1271Gln0.358
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G0.290
rpoC767206c.3837C>G0.295
rpoC767209c.3840T>C0.300
rpoC767212c.3843G>C0.323
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C0.466
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn0.920
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.958
rpsL781572p.Gln5Asn0.967
rpsL781586c.27C>T0.293
rpsL781595c.36T>C1.000
rpsL781598c.39G>C0.651
rpsL781605p.Ile16Val0.651
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G0.300
rpsL781628c.69T>C1.000
rpsL781631c.72G>C0.701
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>G0.270
rpsL781670c.111G>C0.256
rpsL781682c.123T>C0.740
rpsL781706c.147T>C0.210
rpsL781709c.150G>C0.790
rpsL781715c.156T>C0.217
rpsL781728c.169T>C1.000
rpsL781742c.183C>T1.000
rpsL781751c.192G>C1.000
rpsL781760c.201T>C1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C0.239
rpsL781808c.249C>T0.771
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781838c.279G>C0.774
rpsL781841c.282C>T0.764
rpsL781859c.300T>G0.197
rpsL781865c.306G>C0.797
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A0.203
rpsL781892c.333A>G1.000
rpsL781898c.339A>C0.182
rpsL781901c.342C>T0.818
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rplC800904c.96G>C0.875
rplC800916c.108A>G0.933
rplC800921p.Arg38Leu0.933
rplC800928c.120C>T0.933
rplC800931c.123G>C0.933
rplC800937c.129A>G0.933
rplC800946c.138T>C0.933
rplC800949c.141T>C0.933
rplC800964c.156G>C0.933
rplC800985c.177A>G0.933
rplC801171c.363A>G1.000
rplC801174c.366T>C1.000
rplC801195c.387G>T1.000
rplC801205p.Arg133Ala1.000
rplC801210c.402T>C1.000
rplC801220p.Ser138Ala1.000
rplC801237c.429G>A1.000
rplC801252c.444G>C1.000
rplC801264c.456C>T1.000
rplC801267c.459A>C1.000
rplC801276c.468G>C1.000
rplC801281p.Ala158Gly1.000
rplC801285c.477G>C1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.152
rrs1471986r.141c>t1.000
rrs1472019r.174g>a0.815
rrs1472023r.178g>t0.828
rrs1472031r.186g>c0.972
rrs1472032r.187g>a0.139
rrs1472033r.188a>c0.972
rrs1472035r.190g>t0.972
rrs1472040r.195t>g0.972
rrs1472041r.196c>t0.972
rrs1472042r.197t>g0.972
rrs1472043r.198t>a0.102
rrs1472053r.208agc>a0.980
rrs1472061r.216a>t0.984
rrs1472075r.230a>g0.775
rrs1472106r.261g>a0.986
rrs1472108r.263c>t0.986
rrs1472113r.268t>c0.253
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.989
rrs1472328r.483g>t0.900
rrs1472337r.492c>g0.981
rrs1472380r.535g>c1.000
rrs1472446r.601t>a0.989
rrs1472452r.607g>a0.989
rrs1472464r.619a>g0.978
rrs1472734r.889c>t0.179
rrs1472741r.896g>a0.180
rrs1472846r.1001c>t0.121
rrs1472847r.1002g>a0.121
rrs1472849r.1004c>g0.800
rrs1472850r.1005t>c0.800
rrs1472857r.1012a>g0.800
rrs1472858r.1013g>t0.800
rrs1472860r.1015c>t0.150
rrs1472861r.1016g>a0.148
rrs1472956r.1111t>c0.195
rrs1472957r.1112c>t0.192
rrs1472969r.1124a>g0.181
rrs1472970r.1125c>g0.183
rrs1472973r.1128a>t0.811
rrs1472977r.1132g>c0.181
rrs1472978r.1133t>c0.176
rrs1472989r.1144g>a0.184
rrs1472990r.1145a>g0.188
rrs1473082r.1237g>a0.222
rrs1473088r.1243a>g0.214
rrs1473099r.1254t>a0.153
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a0.137
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473120r.1275c>ct0.699
rrs1473121r.1276t>c0.204
rrs1473123r.1278a>t0.239
rrs1473129r.1284c>t0.210
rrs1473145r.1300c>t0.253
rrs1473166r.1321g>a0.239
rrs1473276r.1431a>g0.843
rrs1473288r.1443c>t0.135
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t0.141
rrs1473291r.1446g>gt0.847
rrs1473301r.1456t>c0.864
rrl1473668r.11c>t1.000
rrl1473684r.27g>a0.193
rrl1473695r.38a>ac1.000
rrl1473696r.39t>c0.817
rrl1473697r.40c>a0.183
rrl1473699r.42a>g0.820
rrl1473707r.50t>a0.176
rrl1473717r.60g>a0.203
rrl1473731r.74t>a0.228
rrl1473746r.89t>c1.000
rrl1473756r.99g>t0.240
rrl1473758r.101g>t1.000
rrl1473770r.113t>c0.247
rrl1473788r.131a>g0.716
rrl1473806r.149c>t1.000
rrl1473807r.150t>c0.564
rrl1473812r.155g>a0.312
rrl1473814r.157a>t0.312
rrl1473815r.158t>g1.000
rrl1473823r.166t>c0.688
rrl1473829r.172g>c0.290
rrl1473830r.173t>g0.710
rrl1473831r.174g>t0.969
rrl1473832r.175c>t0.294
rrl1473839r.182g>a0.241
rrl1473876r.219g>a0.981
rrl1473887r.230t>c0.213
rrl1473888r.231t>c0.217
rrl1473898r.241c>t0.978
rrl1473899r.242a>g0.978
rrl1473916r.259c>a0.976
rrl1473922r.265a>g0.583
rrl1473923r.266c>g0.952
rrl1473935r.278c>t0.619
rrl1473937r.280c>t0.950
rrl1473943r.286g>t0.950
rrl1473945r.288t>a0.947
rrl1473946r.289a>t0.947
rrl1473950r.293g>t0.263
rrl1474044r.387c>t1.000
rrl1474045r.388c>t0.812
rrl1474051r.394t>c0.176
rrl1474053r.396g>a0.824
rrl1474054r.397t>c1.000
rrl1474074r.417c>t0.111
rrl1474083r.426c>t0.828
rrl1474089r.432c>t0.172
rrl1474091r.434c>t0.828
rrl1474093r.436g>a1.000
rrl1474096r.439c>t0.828
rrl1474099r.442g>a0.828
rrl1474100r.443c>t0.172
rrl1474106r.449a>act1.000
rrl1474108r.451c>g0.821
rrl1474130r.473c>t0.171
rrl1474135r.478g>a0.829
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474174r.517a>g0.832
rrl1474181r.524c>t0.792
rrl1474183r.526t>c0.813
rrl1474184r.527c>a0.187
rrl1474185r.528g>a0.813
rrl1474186r.529a>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.284
rrl1474266r.609t>c0.708
rrl1474269r.612c>t0.708
rrl1474282r.625g>a0.296
rrl1474289r.632c>t0.440
rrl1474292r.635t>g1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.195
rrl1474362r.705a>g1.000
rrl1474387r.730c>t0.208
rrl1474413r.756a>c0.556
rrl1474414r.757c>t0.444
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.556
rrl1474417r.760acacgcgc>a1.000
rrl1474437r.780gaa>g1.000
rrl1474446r.789c>t0.726
rrl1474496r.839c>g0.244
rrl1474497r.840g>c0.244
rrl1474506r.849c>g0.253
rrl1474507r.850g>c0.253
rrl1474626r.969t>c1.000
rrl1474627r.970g>a0.724
rrl1474629r.972g>a0.724
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474673r.1016t>c0.724
rrl1474676r.1019t>a0.716
rrl1474677r.1020a>g0.724
rrl1474710r.1053t>a0.658
rrl1474711r.1054g>c1.000
rrl1474712r.1055g>a1.000
rrl1474713r.1056t>a1.000
rrl1474717r.1060a>g1.000
rrl1474720r.1063c>t0.675
rrl1474722r.1065t>c0.283
rrl1474743r.1086t>g0.262
rrl1474753r.1096a>g0.770
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a0.987
rrl1474830r.1173a>g0.986
rrl1474913r.1256t>c0.130
rrl1474932r.1275c>t0.985
rrl1475031r.1374g>c0.205
rrl1475061r.1404c>a0.778
rrl1475062r.1405a>t0.977
rrl1475076r.1419c>a0.162
rrl1475090r.1433a>t0.157
rrl1475114r.1457c>t0.153
rrl1475120r.1463g>t0.985
rrl1475129r.1472g>a0.174
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475315r.1658a>t1.000
rrl1475353r.1696a>t1.000
rrl1475354r.1697a>g1.000
rrl1475355r.1698c>t1.000
rrl1475363r.1706c>t1.000
rrl1475379r.1722g>a1.000
rrl1475380r.1723c>a1.000
rrl1475381r.1724g>c1.000
rrl1475382r.1725a>g1.000
rrl1475395r.1738t>c1.000
rrl1475396r.1739c>g1.000
rrl1475397r.1740g>t1.000
rrl1475398r.1741c>t1.000
rrl1475403r.1746t>a0.952
rrl1475404r.1747a>t0.952
rrl1475419r.1762c>t0.810
rrl1475429r.1772g>a0.167
rrl1475443r.1786g>a0.177
rrl1475452r.1795c>a0.984
rrl1475475r.1818c>t0.188
rrl1475479r.1822c>t0.167
rrl1475480r.1823a>t0.167
rrl1475483r.1826c>t0.817
rrl1475505r.1848g>a0.987
rrl1475526r.1869c>a0.988
rrl1475531r.1874c>t0.989
rrl1475544r.1887a>t0.864
rrl1475545r.1888t>g0.864
rrl1475602r.1945g>c1.000
rrl1475603r.1946g>c1.000
rrl1475604r.1947a>c1.000
rrl1475612r.1955g>c1.000
rrl1475615r.1958c>g1.000
rrl1475616r.1959a>g1.000
rrl1475618r.1961c>t1.000
rrl1475625r.1968g>gc1.000
rrl1475626r.1969t>c1.000
rrl1475629r.1972g>c1.000
rrl1475637r.1980t>g1.000
rrl1475638r.1981c>g1.000
rrl1475639r.1982c>g1.000
rrl1475643r.1986c>g0.643
rrl1475647r.1990g>c0.633
rrl1475649r.1992a>g0.193
rrl1475659r.2002g>a1.000
rrl1475753r.2096c>t0.814
rrl1475760r.2103ccg>c0.284
rrl1475762r.2105g>t1.000
rrl1475763r.2106c>t0.787
rrl1475764r.2107a>t0.213
rrl1475765r.2108a>t0.213
rrl1475775r.2118g>a0.829
rrl1475975r.2318c>t0.156
rrl1475977r.2320a>g0.158
rrl1475988r.2331a>g0.988
rrl1475991r.2334t>c0.894
rrl1475995r.2338g>a0.893
rrl1476030r.2373a>g0.980
rrl1476032r.2375c>a0.980
rrl1476033r.2376t>g0.980
rrl1476035r.2378g>c0.980
rrl1476044r.2387t>g1.000
rrl1476046r.2389g>t1.000
rrl1476047r.2390g>t1.000
rrl1476049r.2392c>t1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c0.986
rrl1476214r.2557g>t0.983
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c0.254
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c0.271
rrl1476256r.2599a>t0.712
rrl1476260r.2603a>g0.733
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476529r.2872a>g0.813
rrl1476540r.2883c>t0.773
rrl1476583r.2926g>a0.761
rrl1476584r.2927c>t0.971
rrl1476594r.2937c>t0.971
rrl1476597r.2940g>a0.972
rrl1476603r.2946g>a0.971
rrl1476608r.2951c>g0.176
rrl1476619r.2962c>t0.162
rrl1476628r.2971t>a0.969
rrl1476664r.3007t>c0.812
rrl1476665r.3008t>a0.149
rrl1476666r.3009c>t0.149
rrl1476674r.3017t>c0.956
rrl1476679r.3022t>c0.800
rrl1476689r.3032a>t0.938
rrl1476690r.3033c>t0.938
rrl1476693r.3036g>a0.938
rrl1476695r.3038t>a0.938
rrl1476716r.3059a>c1.000
rrl1476726r.3069a>g0.900
rrl1476731r.3074g>a0.900
rrl1476732r.3075t>c0.900
fabG11673901c.462A>G0.929
fabG11673905p.Ser156Ala0.929
fabG11673916c.477A>C0.950
fabG11673917p.Val160Leu0.950
fabG11673922c.483T>C0.952
fabG11673931c.492C>G0.952
fabG11673941p.Ala168Ser0.952
fabG11673955c.516G>C0.952
fabG11673961c.522A>C0.952
fabG11673962p.Asn175Gly0.952
fabG11673967c.528G>C0.952
fabG11673973c.534G>C0.958
fabG11673976c.537T>C0.962
fabG11674006p.Asp189Glu0.977
fabG11674024c.585T>C0.974
fabG11674037p.Gln200Ala0.958
fabG11674042c.603G>C0.955
fabG11674045c.606G>C0.955
fabG11674049p.Gln204Asp0.955
fabG11674054c.615T>C0.955
fabG11674060c.621A>C0.955
fabG11674079p.Pro214Ala0.905
fabG11674083p.Ala215Glu0.900
fabG11674096c.657G>C0.875
fabG11674098p.Val220Ala0.867
fabG11674102c.663C>G0.867
fabG11674114c.675T>A0.800
inhA1674651c.450C>T1.000
inhA1674656p.Ser152Thr1.000
inhA1674660c.459G>C1.000
inhA1674663c.462G>C1.000
inhA1674672c.471C>A1.000
inhA1674690c.489C>G1.000
inhA1674702c.501G>T1.000
inhA1674703c.502T>C1.000
inhA1674718c.517A>C1.000
inhA1674729c.528G>T1.000
inhA1674742p.Lys181Ala1.000
inhA1674745p.Tyr182Ala1.000
inhA1674753c.552G>C1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>G0.115
inhA1674904p.Ala235Pro1.000
inhA1674924c.723G>T0.893
inhA1674930c.729C>T0.880
inhA1674934c.733C>T0.880
inhA1674942c.741T>C1.000
inhA1674949p.Leu250Met0.176
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>A0.250
inhA1674966c.765T>C1.000
inhA1674967p.Asp256Thr0.750
inhA1674975c.774C>T0.250
inhA1674977p.Tyr259Phe0.250
rpsA1833538c.-4CA>C1.000
rpsA1833539c.-3A>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833554p.Thr5Ser0.529
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T0.373
rpsA1833616c.75A>C0.386
rpsA1833619c.78A>C0.983
rpsA1833625c.84A>G0.410
rpsA1833628c.87G>C0.574
rpsA1833634c.93G>A0.587
rpsA1833661c.120A>G0.547
rpsA1833664c.123C>A0.426
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>T0.347
rpsA1833691c.150G>A0.347
rpsA1833694c.153G>C0.326
rpsA1833697c.156C>G0.341
rpsA1833700c.159C>T0.356
rpsA1833703c.162C>T0.580
rpsA1833709c.168C>T0.440
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833730c.189C>T0.512
rpsA1833733c.192C>G0.488
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G0.480
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G0.471
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833793c.252C>T0.455
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.673
rpsA1833829c.288A>G0.309
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G0.635
rpsA1833886c.345C>G0.619
rpsA1833894p.Ala118Glu1.000
rpsA1833904c.363G>A0.361
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G0.481
rpsA1833970c.429G>T1.000
rpsA1833976c.435C>T0.510
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>A0.434
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>T0.356
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T0.328
rpsA1834073p.Lys178Arg0.250
rpsA1834096c.555G>C0.254
rpsA1834097p.Ser186Arg0.733
rpsA1834102c.561T>C0.733
rpsA1834108c.567C>G0.242
rpsA1834114c.573G>C0.230
rpsA1834150c.609G>C1.000
rpsA1834153c.612T>C1.000
rpsA1834154p.Asn205Gln1.000
rpsA1834157c.616T>C1.000
rpsA1834162c.621A>G1.000
rpsA1834165c.624A>G1.000
rpsA1834168c.627C>T1.000
rpsA1834169p.Thr210Ala1.000
rpsA1834177c.636A>C1.000
rpsA1834189c.648G>C0.574
rpsA1834213c.672G>C0.586
rpsA1834228c.687C>A0.280
rpsA1834231c.690T>G0.261
rpsA1834234c.693G>C0.255
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>C0.267
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T0.438
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T0.408
rpsA1834345c.804C>T0.592
rpsA1834348c.807T>C0.597
rpsA1834357c.816T>C0.360
rpsA1834361c.820T>C0.632
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C0.324
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>C0.180
rpsA1834414c.873C>T0.177
rpsA1834417c.876G>C0.182
rpsA1834420c.879C>T0.167
rpsA1834423c.882G>T0.162
rpsA1834429c.888C>T0.169
rpsA1834438c.897C>T0.190
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T0.266
rpsA1834489c.948T>C1.000
rpsA1834513c.972C>G0.710
rpsA1834519c.978G>C0.284
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.317
rpsA1834540c.999G>C0.620
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T0.375
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly0.400
rpsA1834606c.1065C>T0.964
rpsA1834609c.1068T>C0.981
rpsA1834619c.1078T>C0.943
rpsA1834622c.1081T>A0.939
rpsA1834633c.1092A>G0.979
rpsA1834639c.1098T>C0.981
rpsA1834645c.1104C>T0.268
rpsA1834666c.1125G>C0.966
rpsA1834667p.Ala376Ser0.966
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.246
rpsA1834705c.1164C>G0.235
rpsA1834720c.1179C>G0.289
rpsA1834732c.1191T>C0.986
rpsA1834738c.1197A>G0.986
rpsA1834753c.1212T>C0.983
rpsA1834756c.1215G>A0.576
rpsA1834759c.1218A>C0.983
rpsA1834765p.Glu408Asp0.982
rpsA1834774c.1233C>G0.462
rpsA1834776p.Ala412Glu0.949
rpsA1834780c.1239A>G0.949
rpsA1834786c.1245A>G0.487
rpsA1834789c.1248T>C0.949
rpsA1834792c.1251G>C0.487
rpsA1834813c.1272G>T0.394
rpsA1834829p.Ala430Ile0.417
rpsA1834840c.1299G>A0.400
katG2155661p.Val151Leu1.000
katG2155668c.444C>G1.000
katG2155674c.438C>G1.000
katG2155680c.432C>T1.000
katG2155691c.421A>G1.000
katG2155696p.Ala139Val1.000
katG2155716c.396A>C1.000
katG2155722c.390C>G1.000
katG2155728c.384C>G1.000
katG2155742p.Gly124Arg1.000
katG2155747p.Ala122Gly1.000
katG2155752c.360G>A1.000
katG2155766p.His116Glu1.000
katG2155769p.Ile115Val1.000
katG2155770c.342G>C1.000
kasA2518726c.612G>A0.938
kasA2518732c.618C>G0.615
kasA2518738c.624G>C0.344
kasA2518747c.633C>G0.636
kasA2518756c.642G>C0.973
kasA2518768c.654C>G0.282
kasA2518771c.657C>G0.263
kasA2518774c.660C>T0.282
kasA2518780p.Glu222Asp0.718
kasA2518783c.669T>C0.282
kasA2518785p.Glu224Ala0.718
kasA2518787p.Arg225Asp0.282
kasA2518792c.678C>G0.282
kasA2518795c.681C>T1.000
kasA2518798c.684G>C0.229
kasA2518813c.699C>T0.646
kasA2518816c.702C>T0.646
kasA2518822c.708C>A0.329
kasA2518825c.711T>C1.000
kasA2518843c.729T>C0.685
kasA2518846c.732G>T0.269
kasA2518847p.Leu245Ile0.727
kasA2518853p.Leu247Ile0.290
kasA2518864c.750G>C1.000
kasA2518877p.Lys255Leu0.682
kasA2518898c.784T>C1.000
kasA2518903c.789C>T1.000
kasA2518906c.792A>G1.000
kasA2518907c.793T>C1.000
kasA2518910p.Leu266Met1.000
thyX3067319c.627C>G1.000
thyX3067325c.621T>C1.000
thyX3067331c.615G>A1.000
thyX3067334c.612G>T1.000
thyX3067340c.606C>T1.000
thyX3067346c.600G>C1.000
thyX3067349c.597C>G1.000
thyX3067355c.591T>C0.970
thyX3067376c.570C>G0.975
thyX3067403c.543G>C0.975
thyX3067406c.540T>C0.975
thyX3067415c.531G>A0.975
thyX3067423c.523G>A0.962
thyX3067424c.522C>T0.962
thyX3067427c.519C>G0.962
thyX3067430c.516G>C0.962
thyX3067436c.510G>C0.962
thyX3067442c.504G>C0.962
thyX3067457c.489G>A1.000
thyX3067465p.Ile161Val1.000
thyX3067466c.480C>G1.000
thyX3067475c.471T>C1.000
panD4044233p.Cys17His0.818
panD4044234c.48G>C0.818
panD4044249c.33G>A0.818
embC4240717c.855T>C0.490
embC4240729c.867C>G0.431
embC4240735c.873C>G0.417
embC4240741c.879C>T0.424
embC4240756c.894G>C0.425
embC4240768c.906G>A0.543
embC4240771c.909G>C0.361
embC4240772p.Ser304Ala0.361
embC4240777c.915G>A0.593
embC4240778p.His306Gly0.396
embC4240781p.Ala307Ser0.404
embC4240786c.924C>T0.517
embC4240789c.927T>C0.983
embC4240819c.957A>C0.985
embC4240826p.Ala322Ser0.410
embC4240831c.969T>G0.983
embC4240856p.Ala332Thr0.275
embC4240859p.Leu333Ile0.275
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4241560c.1698C>G1.000
embC4241584c.1722T>C1.000
embC4241587c.1725C>G1.000
embC4241593c.1731C>G1.000
embC4241611c.1749G>C1.000
embC4241614c.1752A>C1.000
embC4241626c.1764T>C1.000
embC4241635c.1773G>C1.000
embC4241644c.1782G>C1.000
embC4241647c.1785G>A1.000
embC4241648c.1786T>C1.000
embC4241656c.1794G>A1.000
embC4241659c.1797G>C1.000
embC4241665c.1803G>T1.000
embC4241668c.1806G>C1.000
embC4241671c.1809T>G1.000
embC4241750p.Leu630Met0.909
embC4241756c.1894C>T0.909
embC4241767c.1905C>G0.909
embC4241769p.Ser636Thr0.909
embC4241809c.1947A>C0.909
embA4244645c.1413T>C0.846
embA4244648c.1416G>C0.857
embA4244665p.Thr478Ser0.867
embA4244669c.1437G>C0.867
embA4244681c.1449A>C0.867
embA4244684c.1452C>G0.867
embA4244695p.Lys488Thr0.867
embA4244712p.Ala494Ser0.867
embA4244726p.Asp498Glu0.929
embA4244747c.1515T>G0.923
embA4245042p.Thr604Ala0.800
embA4245053c.1821G>C0.857
embA4245060c.1828T>C0.857
embA4245071c.1839G>C0.800
embA4245083c.1851A>C0.800
embA4245089c.1857G>C0.800
embA4245092c.1860C>G0.857
embA4245094p.Ile621Thr0.857
embA4245101c.1869G>C0.857
embA4245122c.1890C>T0.857
embA4245125c.1893G>C0.923
embA4245431c.2199T>C1.000
embA4245454p.Ala741Val1.000
embA4245459p.Pro743Ala1.000
embA4245465p.Pro745Thr1.000
embB4247389c.876C>G1.000
embB4247398c.885G>C1.000
embB4247401c.888T>C1.000
embB4247407c.894G>C1.000
embB4247426p.Gly305Gln1.000
embB4247434c.921C>G1.000
embB4247437c.924A>C1.000
embB4247440c.927C>G1.000
embB4247449c.936C>T0.967
embB4247464c.951C>G1.000
embB4247470c.957T>C1.000
embB4247491c.978G>C1.000
embB4247497c.984T>C1.000
embB4247511p.Tyr333Phe0.972
embB4247527c.1014G>C0.969
embB4247536c.1023C>G0.968
embB4247554c.1041T>C1.000
embB4247555p.Leu348Ile0.923
embB4247566c.1053C>A0.917
embB4247572c.1059A>C0.900
embB4247590c.1077A>G0.818
embB4248199c.1686A>G1.000
embB4248200p.Ile563Val1.000
embB4248206p.Ser565Gly1.000
embB4248220c.1707A>G1.000
embB4248225p.Ala571Val0.794
embB4248232c.1719G>T0.194
embB4248233c.1720C>T0.189
embB4248236p.Met575Leu0.211
embB4248242p.Val577Ile0.681
embB4248245p.Ile578Val0.312
embB4248250c.1737C>T0.340
embB4248252p.Gly580Ala0.647
embB4248259p.Met582Ile0.353
embB4248264p.Phe584Cys0.654
embB4248275p.Thr588Ala0.346
embB4248292c.1779G>A0.360
embB4248304c.1791G>C0.640
embB4248319c.1806A>G0.964
embB4248322c.1809G>T0.960

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;