TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d25b18ce6e83
Sample: 5d25b18ce6e83

Download results

Summary
ID: 5d25b18ce6e83
Date: Wed Jul 10 10:39:08 2019
Strain: lineage2.2.1
Drug-resistance: Drug-resistant

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
AmikacinRrrs r.1401a>g (0.20)
CapreomycinRrrs r.1401a>g (0.20)
KanamycinRrrs r.1401a>g (0.20)

Lineage2FamilyMain SpoligotypeRDS
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6097c.858G>A0.333
gyrB6100c.861G>A0.320
gyrB6109c.870G>C0.276
gyrB6115c.876A>G0.938
gyrB6121c.882C>T0.688
gyrB6123p.Ala295Gly0.250
gyrB6127c.888G>C0.250
gyrB6130c.891T>C0.250
gyrB6133c.894G>C0.938
gyrB6136c.897G>A0.688
gyrB6151c.912C>T0.710
gyrB6172c.933C>T0.733
gyrB6175c.936G>A0.267
gyrB6181c.942C>A0.241
gyrB6184c.945C>T1.000
gyrB6193c.954G>A0.700
gyrB6196c.957C>T1.000
gyrB6202c.963C>T0.667
gyrB6202r.963ca>c1.000
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C0.923
gyrB6223c.984G>C0.923
gyrB6655c.1416T>C1.000
gyrB6664c.1425C>T1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T0.976
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T0.977
gyrB6763c.1524G>C0.980
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C0.983
gyrB6798p.Gly520Ala0.982
gyrB6808c.1569C>G0.979
gyrB6824c.1585C>T0.952
gyrB6838c.1599C>T0.951
gyrB6841c.1602T>C0.952
gyrB6862c.1623C>G0.927
gyrB6869c.1630T>C0.929
gyrB6872c.1633T>C0.926
gyrB6878c.1639T>C0.926
gyrB6889c.1650G>A0.917
gyrB6898c.1659G>C0.913
gyrB6982c.1743A>C0.273
gyrB6985c.1746C>T0.273
gyrB6988c.1749C>G0.273
gyrB7006c.1767T>G0.556
gyrB7010p.Leu591Ile0.579
gyrB7015c.1776G>A0.579
gyrB7018c.1779G>C0.579
gyrB7024c.1785G>A0.933
gyrB7033c.1794G>C0.933
gyrB7051p.Glu604Asp0.938
gyrB7060c.1821T>C0.938
gyrB7066c.1827G>T0.938
gyrB7081c.1842T>C0.938
gyrB7084c.1845A>G0.938
gyrB7090c.1851C>T0.938
gyrB7093c.1854T>C0.938
gyrB7100c.1861T>C0.882
gyrA7343c.42G>C1.000
gyrA7355c.54T>A1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7406c.105G>C0.147
gyrA7412c.111C>G1.000
gyrA7418c.117C>T0.139
gyrA7421c.120G>C0.750
gyrA7424c.123G>C0.778
gyrA7427c.126G>C0.786
gyrA7433c.132G>C0.185
gyrA7439c.138C>T0.679
gyrA7442c.141G>C0.963
gyrA7451c.150C>A0.692
gyrA7457c.156T>C0.960
gyrA7463c.162G>C0.818
gyrA7484c.183T>C1.000
gyrA7499c.198G>C0.964
gyrA7511c.210C>T0.783
gyrA7523c.222C>G0.815
gyrA7526c.225G>C0.971
gyrA7532c.231T>G0.158
gyrA7541c.240C>G0.158
gyrA7547c.246C>T0.988
gyrA7559c.258G>C0.867
gyrA7565c.264C>T0.976
gyrA7569p.Ala90Ser0.113
gyrA7574c.273G>C0.870
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.892
gyrA7595c.294C>T0.984
gyrA7607c.306C>T0.983
gyrA7637c.336C>A1.000
gyrA7728c.427A>C1.000
gyrA7763c.462T>G1.000
gyrA7775c.474C>T1.000
gyrA7784c.483A>G1.000
gyrA7790c.489G>C1.000
gyrA7796c.495G>T1.000
gyrA7799c.498A>G1.000
gyrA7802c.501C>G1.000
gyrA7832c.531G>T1.000
gyrA7835c.534A>G1.000
gyrA7841c.540C>T1.000
gyrA7847c.546G>C1.000
gyrA7859c.558A>C1.000
gyrA7865c.564T>C1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile0.857
gyrA8191p.Ala297Gly0.143
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8210c.909G>A0.200
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8324c.1023T>C0.333
gyrA8327c.1026C>T0.333
gyrA8330c.1029C>G0.667
gyrA8339c.1038A>G0.974
gyrA8340p.Ala347Ser0.974
gyrA8354c.1053G>C0.964
gyrA8366c.1065G>A0.440
gyrA8372c.1071G>T0.917
gyrA8382c.1081C>T0.450
gyrA8535p.Glu412Gln1.000
gyrA8546p.Asp415Glu1.000
gyrA8561c.1260A>C1.000
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G0.214
gyrA8580p.Ile427Val0.214
gyrA8603c.1302A>C1.000
gyrA8792c.1491G>C0.900
gyrA8796p.Ile499Val0.182
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala0.875
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T0.957
gyrA8846c.1545C>T0.893
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8876c.1575C>T0.108
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8924c.1623C>T0.837
gyrA8942c.1641G>C0.971
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T0.900
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G0.833
gyrA8993c.1692C>T0.812
gyrA8996c.1695T>C0.812
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760142c.336C>T0.981
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.900
rpoB760274p.Glu156Asp0.852
rpoB760276p.Lys157Met0.840
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C0.684
rpoB760310c.504G>C0.316
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G0.800
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C0.821
rpoB760400c.594G>C0.851
rpoB760406c.600G>C0.979
rpoB760406r.600ga>g1.000
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C0.898
rpoB760430c.624T>C1.000
rpoB760460c.654G>C0.924
rpoB760475c.669A>G1.000
rpoB760481c.675G>T1.000
rpoB760484c.678A>G1.000
rpoB760499c.693G>A0.949
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760553c.747C>G0.932
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760585p.Asn260Ser0.229
rpoB760588p.Thr261Ile0.765
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T0.762
rpoB760611c.805T>C1.000
rpoB760634c.828T>C0.782
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G0.283
rpoB760668p.Thr288Ala0.690
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760724c.918T>C0.310
rpoB760727c.921C>G0.667
rpoB760730c.924T>C1.000
rpoB760736c.930C>G0.640
rpoB760787c.981G>C0.333
rpoB760793c.987A>G0.944
rpoB760799c.993C>T0.636
rpoB760805c.999G>C0.960
rpoB760817c.1011A>G0.957
rpoB760820c.1014T>C0.958
rpoB760826c.1020C>G0.958
rpoB760830c.1024T>C0.962
rpoB760841c.1035T>C0.969
rpoB760858p.Val351Ala0.833
rpoB760862c.1056G>C0.972
rpoB760877c.1071G>T0.111
rpoB760883c.1077G>C0.111
rpoB760886p.Glu360Asp0.111
rpoB760887p.Thr361Val0.978
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T0.962
rpoB760979c.1173G>A0.889
rpoB760982c.1176G>T1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>C1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G0.951
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>T0.972
rpoB761133c.1327T>C0.971
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T0.943
rpoB761178p.Ser458Thr0.937
rpoB761186p.Glu460Asp0.934
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>T1.000
rpoB761219c.1413G>C0.936
rpoB761231c.1425C>T0.932
rpoB761234c.1428G>T1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G0.923
rpoB761258c.1452G>A0.921
rpoB761261c.1455G>C1.000
rpoB761264c.1458C>G0.985
rpoB761273c.1467T>C0.889
rpoB761282c.1476C>T0.116
rpoB761288c.1482G>T0.103
rpoB761297c.1491C>T0.873
rpoB761318c.1512G>C0.164
rpoB761327c.1521A>G1.000
rpoB761330c.1524G>C0.157
rpoB761339c.1533C>G0.822
rpoB761345c.1539G>C1.000
rpoB761346p.Val514Ser0.529
rpoB761354c.1548C>A0.438
rpoB761357c.1551G>T0.562
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761367p.Glu521Gln0.357
rpoB761373p.Val523His0.692
rpoB761387c.1581C>T0.692
rpoB761393c.1587G>A0.692
rpoB761408c.1602G>C0.300
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T0.967
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C0.936
rpoB761573c.1767C>G1.000
rpoB761579c.1773G>C1.000
rpoB761606c.1800C>G1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761648c.1842T>C0.986
rpoB761657c.1851C>T0.900
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>C0.102
rpoB761682c.1876C>T0.105
rpoB761687c.1881C>T0.865
rpoB761690c.1884G>C0.980
rpoB761693c.1887G>C0.882
rpoB761705c.1899C>A0.898
rpoB761720c.1914C>G0.200
rpoB761722p.Glu639Gly0.938
rpoB761727p.Ser641Gly0.938
rpoB761741c.1935G>A0.545
rpoB761747c.1941G>C0.455
rpoB761750c.1944G>T0.545
rpoB761760p.Ile652Val0.333
rpoB761765c.1959T>C1.000
rpoB761772p.His656Ala1.000
rpoB761778p.Asn658Asp1.000
rpoB761785p.Thr660Ser1.000
rpoB761791p.Arg662His1.000
rpoB761813c.2007T>C1.000
rpoB761834c.2028T>C1.000
rpoB761852c.2046C>G0.667
rpoB761863p.Ala686Glu0.636
rpoB761873c.2067A>G1.000
rpoB761885c.2079T>C0.190
rpoB761891c.2085G>C1.000
rpoB761892p.Ile696Val1.000
rpoB761906c.2100C>G0.174
rpoB761909c.2103T>C0.957
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761921c.2115C>T0.138
rpoB761924c.2118G>A0.833
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C0.839
rpoB761936c.2130C>T0.844
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A0.114
rpoB761955p.Ile717Val0.886
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C0.844
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G0.131
rpoB762038c.2232C>T0.852
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A0.843
rpoB762065c.2259T>G0.137
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T0.833
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A0.804
rpoB762137c.2331C>T0.196
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>C0.154
rpoB762158c.2352G>C0.986
rpoB762167c.2361T>C0.986
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C0.854
rpoB762224c.2418C>G0.117
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C0.862
rpoB762239c.2433G>A0.833
rpoB762245c.2439G>C1.000
rpoB762254c.2448T>C0.819
rpoB762284c.2478G>T0.986
rpoB762293c.2487T>C0.984
rpoB762296c.2490G>C0.855
rpoB762308c.2502G>C0.132
rpoB762314c.2508C>T0.959
rpoB762317c.2511A>G0.979
rpoB762323c.2517C>A0.822
rpoB762329c.2523G>C0.977
rpoB762356p.Glu850Asp0.200
rpoB762362p.Glu852Asp0.920
rpoB762368p.Glu854Asp0.690
rpoB762369c.2563T>C0.207
rpoB762374c.2568G>T0.188
rpoB762380c.2574T>C0.763
rpoB762383c.2577C>G0.775
rpoB762392c.2586G>C0.838
rpoB762395c.2589G>T0.917
rpoB762398c.2592T>C0.923
rpoB762404c.2598T>C0.952
rpoB762410c.2604T>G0.933
rpoB762416c.2610A>G0.966
rpoB762434c.2628T>C0.158
rpoB762443c.2637G>C0.158
rpoB762449c.2643C>A0.974
rpoB762452c.2646G>C0.974
rpoB762470c.2664G>C0.974
rpoB762488c.2682G>C0.765
rpoB762491c.2685T>C0.971
rpoB762509c.2703T>G0.947
rpoB762510p.Ala902Pro0.947
rpoB762515c.2709C>T0.982
rpoB762527c.2721G>C0.304
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762557c.2751G>A0.560
rpoB762560c.2754A>C0.500
rpoB762563c.2757G>T1.000
rpoB762827c.3021G>C0.158
rpoB762833c.3027C>T0.143
rpoB762839c.3033G>A0.143
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C0.774
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T0.694
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T0.776
rpoB762899c.3093G>C0.769
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G0.741
rpoB762929c.3123G>C0.242
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763004c.3198G>A0.226
rpoB763007c.3201C>T0.246
rpoB763022c.3216C>G0.230
rpoB763028c.3222T>C0.226
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G0.746
rpoB763040c.3234C>G0.746
rpoB763053c.3247T>C0.259
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T0.778
rpoB763085c.3279C>G0.192
rpoB763088c.3282C>G0.808
rpoB763094c.3288G>C0.804
rpoB763103c.3297G>C0.213
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763130c.3324G>A0.143
rpoB763133c.3327G>C0.143
rpoB763136c.3330C>T1.000
rpoB763142c.3336C>G0.161
rpoB763145c.3339G>A0.828
rpoB763157c.3351G>T0.833
rpoB763160c.3354G>T0.174
rpoB763166c.3360A>G1.000
rpoB763169c.3363A>G0.167
rpoB763172c.3366G>C0.812
rpoB763179c.3373C>T0.800
rpoB763190c.3384C>T0.214
rpoB763193c.3387C>G0.769
rpoC763375c.6C>A0.500
rpoC763402c.33C>T0.667
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G0.294
rpoC763415p.Thr16Ser0.706
rpoC763423p.Glu18Asp0.294
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A0.804
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C0.986
rpoC763492c.123G>C0.986
rpoC763528c.159G>A0.978
rpoC763531c.162G>T0.857
rpoC763546c.177A>G0.978
rpoC763558c.189C>T0.121
rpoC763570c.201G>C0.976
rpoC763594c.225C>T0.976
rpoC763603c.234C>T0.120
rpoC763609c.240C>T0.838
rpoC763615c.246G>C0.103
rpoC763618c.249C>T0.111
rpoC763621c.252C>T0.825
rpoC763633c.264T>C0.987
rpoC763657c.288G>A0.772
rpoC763660c.291T>G1.000
rpoC763666c.297G>C0.149
rpoC763669c.300C>G0.841
rpoC763675c.306C>G1.000
rpoC763696c.327T>C0.583
rpoC763699c.330G>T0.565
rpoC763702c.333C>G1.000
rpoC763705c.336G>A0.429
rpoC763708c.339G>C0.550
rpoC763709p.Leu114Phe0.450
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>G0.450
rpoC763741c.372C>T1.000
rpoC763744c.375G>C0.526
rpoC763747c.378G>A1.000
rpoC763765c.396T>G0.500
rpoC763774c.405G>C0.200
rpoC763879c.510A>G0.900
rpoC763882c.513G>A0.364
rpoC763888c.519G>T0.571
rpoC763891c.522G>C0.933
rpoC763894c.525A>G0.938
rpoC763900c.531G>C0.971
rpoC763933c.564C>T0.943
rpoC763940p.Ala191Ser0.971
rpoC763945c.576T>C0.971
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G0.971
rpoC763969c.600C>T0.943
rpoC763987c.618C>T0.958
rpoC763991p.Ile208Leu0.952
rpoC763996c.627T>C0.944
rpoC763999c.630C>T0.737
rpoC764002c.633C>G0.737
rpoC764003p.Ala212Ser0.684
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T0.925
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764098c.729A>G1.000
rpoC764110c.741C>T0.750
rpoC764134c.765C>G0.283
rpoC764143c.774G>C0.667
rpoC764147p.Ser260Ala0.658
rpoC764150p.Ile261Val0.658
rpoC764153p.Gln262Lys0.324
rpoC764161c.792G>C0.306
rpoC764165p.Glu266Gln0.633
rpoC764176c.807C>T0.182
rpoC764177p.Ile270Leu0.182
rpoC764182p.Asp271Glu0.182
rpoC764188c.819A>G0.900
rpoC764278c.909A>G0.800
rpoC764293c.924G>C0.818
rpoC764297p.Met310Leu0.833
rpoC764311c.942C>G0.552
rpoC764317c.948C>G0.581
rpoC764320c.951C>G0.588
rpoC764338c.969G>A0.674
rpoC764344c.975C>T0.277
rpoC764353c.984G>T0.980
rpoC764362c.993C>T0.755
rpoC764365c.996C>T0.981
rpoC764371c.1002G>C0.981
rpoC764377c.1008C>G0.782
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>T0.852
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764446c.1077T>C0.162
rpoC764449c.1080G>C0.156
rpoC764452c.1083T>C0.842
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764485c.1116G>C0.178
rpoC764491c.1122G>T0.157
rpoC764497c.1128A>G1.000
rpoC764500c.1131C>G0.176
rpoC764509c.1140G>A0.821
rpoC764510c.1141C>T0.821
rpoC764521c.1152T>C1.000
rpoC764527c.1158C>T1.000
rpoC764530c.1161C>T0.764
rpoC764533c.1164C>A0.764
rpoC764536c.1167G>T1.000
rpoC764539c.1170C>G1.000
rpoC764545c.1176C>A0.789
rpoC764575c.1206T>G1.000
rpoC764593c.1224C>T0.788
rpoC764605c.1236G>C0.217
rpoC764611c.1242G>T1.000
rpoC764623c.1254C>G0.190
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C0.984
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T0.735
rpoC764683c.1314G>A0.719
rpoC764692c.1323C>T0.733
rpoC764701c.1332C>G0.242
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.821
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.836
rpoC764815c.1446A>G0.981
rpoC764824c.1455T>C0.983
rpoC764827c.1458G>C0.983
rpoC764851c.1482C>T0.138
rpoC764858c.1489T>C0.983
rpoC764869c.1500C>T0.980
rpoC764875c.1506C>A0.152
rpoC764878c.1509C>G0.128
rpoC764887c.1518G>C0.977
rpoC764888c.1519T>C0.978
rpoC764911c.1542A>G0.978
rpoC764912p.Met515Gln0.978
rpoC764932c.1563C>A0.983
rpoC764935c.1566T>C0.121
rpoC764948c.1579T>C0.985
rpoC764968c.1599T>C1.000
rpoC765338p.Gln657Lys0.200
rpoC765343c.1974G>A0.600
rpoC765352c.1983G>C0.875
rpoC765356p.Met663Ala0.647
rpoC765370c.2001G>A0.727
rpoC765379c.2010G>C0.774
rpoC765382c.2013G>T0.774
rpoC765383p.Met672Leu0.968
rpoC765400c.2031G>C0.209
rpoC765403c.2034G>C0.977
rpoC765404p.Leu679Asn0.209
rpoC765409c.2040T>G0.214
rpoC765412c.2043T>C0.200
rpoC765421c.2052C>G0.755
rpoC765425p.Lys686Glu0.231
rpoC765445c.2076G>C0.213
rpoC765449p.Ala694Ser0.770
rpoC765452p.Ala695Arg0.213
rpoC765466c.2097C>T0.190
rpoC765469c.2100G>C0.797
rpoC765478c.2109T>G0.189
rpoC765480p.Tyr704Phe0.986
rpoC765496c.2127C>G0.192
rpoC765499c.2130C>G0.986
rpoC765517c.2148C>G0.786
rpoC765529c.2160C>T0.980
rpoC765533p.Tyr722His0.978
rpoC765544c.2175C>G0.763
rpoC765547c.2178C>T0.750
rpoC765548c.2179A>T0.970
rpoC765553c.2184C>T0.970
rpoC765556c.2187G>C0.970
rpoC765562c.2193G>C0.970
rpoC765577c.2208G>T0.152
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T0.757
rpoC765861p.Phe831Tyr0.778
rpoC765871c.2502T>C0.217
rpoC765875p.Val836Ile1.000
rpoC765886c.2517C>G0.221
rpoC765895c.2526G>A0.791
rpoC765904c.2535C>G0.212
rpoC765907c.2538G>T0.769
rpoC765908p.Leu847Phe0.231
rpoC765928c.2559C>G0.800
rpoC765934c.2565C>T0.200
rpoC765940c.2571A>T1.000
rpoC765946c.2577C>T0.213
rpoC765947c.2578T>C1.000
rpoC765952c.2583G>C0.222
rpoC765961c.2592G>T0.214
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G0.743
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C0.760
rpoC766009c.2640G>C0.667
rpoC766012c.2643C>G0.923
rpoC766321c.2952C>G0.514
rpoC766333c.2964G>T0.525
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G0.525
rpoC766353p.Val995Ala0.525
rpoC766363c.2994G>C0.333
rpoC766369c.3000C>G0.683
rpoC766375c.3006C>G0.683
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T0.727
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766798c.3429C>G0.786
rpoC766804c.3435A>G0.857
rpoC766837c.3468G>C0.833
rpoC766843c.3474T>C0.833
rpoC766846c.3477C>G0.833
rpoC766931p.Ala1188Ser0.120
rpoC766942c.3573C>T0.933
rpoC766945c.3576A>C0.938
rpoC766948c.3579G>C0.118
rpoC766963c.3594T>C0.955
rpoC766975c.3606C>T0.878
rpoC766996c.3627C>T0.969
rpoC767002c.3633G>C0.971
rpoC767008c.3639G>A0.972
rpoC767023c.3654C>T0.975
rpoC767044c.3675G>C0.883
rpoC767080c.3711G>C0.882
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767105p.Asn1246His0.121
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C0.851
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T0.817
rpoC767158c.3789T>C1.000
rpoC767162p.Asn1265Ala0.125
rpoC767167c.3798C>T0.125
rpoC767174p.Asn1269Asp0.148
rpoC7671801271A>1271*0.143
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G0.830
rpoC767206c.3837C>G0.827
rpoC767209c.3840T>C0.820
rpoC767212c.3843G>C0.857
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C0.984
rpoC767254c.3885G>C0.930
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn0.976
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T0.769
rpsL781595c.36T>C1.000
rpsL781598c.39G>C0.200
rpsL781605p.Ile16Val0.200
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G0.758
rpsL781628c.69T>C0.985
rpsL781631c.72G>C0.221
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C0.257
rpsL781670c.111G>C0.730
rpsL781682c.123T>C0.250
rpsL781706c.147T>C0.673
rpsL781709c.150G>C0.333
rpsL781715c.156T>G0.333
rpsL781728c.169T>C1.000
rpsL781742c.183C>T0.308
rpsL781751c.192G>C0.875
rpsL781754c.195G>T0.278
rpsL781760c.201T>C0.889
rpsL781763c.204C>G0.278
rpsL781766c.207C>T0.350
rpsL781772c.213C>T0.957
rpsL781802c.243G>C0.820
rpsL781808c.249C>T0.120
rpsL781814c.255C>T0.960
rpsL781817c.258G>T0.960
rpsL781829c.270G>C0.963
rpsL781832c.273T>C0.964
rpsL781859c.300T>C0.132
rpsL781865c.306G>C0.143
rpsL781868c.309T>C0.979
rpsL781871c.312G>C0.979
rpsL781877c.318T>A0.826
rpsL781892c.333A>G1.000
rpsL781898c.339A>T0.219
rpsL781901c.342C>T0.219
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933c.374G>A0.667
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.578
rrs1471986r.141c>t1.000
rrs1472019r.174g>a0.359
rrs1472023r.178g>t0.342
rrs1472030r.185g>a0.417
rrs1472031r.186g>c0.955
rrs1472032r.187g>a0.455
rrs1472033r.188a>c0.952
rrs1472035r.190g>t0.952
rrs1472040r.195t>g0.952
rrs1472041r.196c>t0.952
rrs1472042r.197t>g0.952
rrs1472043r.198t>a0.357
rrs1472050r.205g>c0.367
rrs1472053r.208agc>a0.967
rrs1472061r.216a>t0.976
rrs1472075r.230a>g0.457
rrs1472106r.261g>a0.979
rrs1472108r.263c>t0.979
rrs1472113r.268t>c0.543
rrs1472150r.305t>a0.958
rrs1472251r.406g>a0.977
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a0.978
rrs1472452r.607g>a0.977
rrs1472464r.619a>g0.980
rrs1472612r.767g>t0.595
rrs1472734r.889c>t0.604
rrs1472741r.896g>a0.620
rrs1472846r.1001c>a0.179
rrs1472847r.1002g>c0.179
rrs1472849r.1004c>g0.167
rrs1472850r.1005t>c0.167
rrs1472857r.1012a>g0.147
rrs1472858r.1013g>t0.147
rrs1472860r.1015c>g0.147
rrs1472861r.1016g>t0.147
rrs1472956r.1111t>c0.767
rrs1472957r.1112c>t0.762
rrs1472969r.1124a>g0.732
rrs1472970r.1125c>g0.732
rrs1472973r.1128a>t0.250
rrs1472977r.1132g>c0.732
rrs1472978r.1133t>c0.732
rrs1472989r.1144g>a0.760
rrs1472990r.1145a>g0.755
rrs1473082r.1237g>a0.625
rrs1473088r.1243a>g0.600
rrs1473099r.1254t>a0.500
rrs1473104r.1259c>t0.971
rrs1473105r.1260g>a0.485
rrs1473110r.1265t>g0.969
rrs1473111r.1266a>g0.969
rrs1473120r.1275c>ct0.385
rrs1473121r.1276t>c0.538
rrs1473123r.1278a>c0.405
rrs1473129r.1284c>t0.537
rrs1473145r.1300c>t0.541
rrs1473166r.1321g>a0.541
rrs1473276r.1431a>g0.420
rrs1473288r.1443c>t0.577
rrs1473290r.1445c>t0.961
rrs1473291r.1446g>t0.596
rrs1473301r.1456t>c0.407
rrl1473684r.27g>a0.550
rrl1473696r.39t>c0.450
rrl1473697r.40c>t0.450
rrl1473699r.42a>g0.450
rrl1473707r.50t>a0.538
rrl1473717r.60g>t0.464
rrl1473731r.74t>a0.567
rrl1473746r.89t>c0.970
rrl1473756r.99g>t0.629
rrl1473758r.101g>t1.000
rrl1473770r.113t>g0.368
rrl1473788r.131a>g0.333
rrl1473806r.149c>t1.000
rrl1473807r.150t>c0.242
rrl1473812r.155g>a0.667
rrl1473814r.157a>t0.652
rrl1473815r.158t>g1.000
rrl1473823r.166t>c0.276
rrl1473829r.172g>t0.296
rrl1473830r.173t>g0.296
rrl1473831r.174g>t1.000
rrl1473832r.175c>a0.296
rrl1473839r.182g>a0.676
rrl1473876r.219g>a1.000
rrl1473887r.230t>a0.242
rrl1473888r.231t>c0.750
rrl1473898r.241c>t0.966
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473922r.265a>g0.143
rrl1473923r.266c>g1.000
rrl1473935r.278c>t0.176
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t0.800
rrl1474061r.404t>c0.600
rrl1474074r.417c>t0.667
rrl1474083r.426c>t0.231
rrl1474089r.432c>t0.692
rrl1474091r.434c>t0.231
rrl1474093r.436g>a0.923
rrl1474096r.439c>t0.231
rrl1474099r.442g>a0.231
rrl1474100r.443c>t0.692
rrl1474103r.446a>c0.900
rrl1474108r.451c>g0.231
rrl1474130r.473c>t0.714
rrl1474135r.478g>a0.303
rrl1474140r.483c>t0.971
rrl1474151r.494c>t0.976
rrl1474174r.517a>g0.267
rrl1474181r.524c>t0.244
rrl1474183r.526t>c0.278
rrl1474184r.527c>a0.722
rrl1474185r.528g>a0.278
rrl1474185r.528ga>g1.000
rrl1474186r.529a>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.733
rrl1474266r.609t>c0.256
rrl1474269r.612c>t0.244
rrl1474282r.625g>a0.750
rrl1474289r.632c>t0.133
rrl1474291r.634tttcctctccggagga>t0.966
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.680
rrl1474362r.705a>g1.000
rrl1474387r.730c>t0.660
rrl1474413r.756a>c0.781
rrl1474414r.757c>t0.219
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.781
rrl1474417r.760acacgcgc>a1.000
rrl1474437r.780gaa>g1.000
rrl1474446r.789c>t0.261
rrl1474496r.839c>g0.667
rrl1474497r.840g>c0.667
rrl1474506r.849c>g0.688
rrl1474507r.850g>c0.688
rrl1474626r.969t>c1.000
rrl1474627r.970g>a0.188
rrl1474629r.972g>a0.188
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474673r.1016t>c0.270
rrl1474676r.1019t>a0.250
rrl1474677r.1020a>g0.250
rrl1474710r.1053t>a0.273
rrl1474717r.1060a>g1.000
rrl1474720r.1063c>t0.217
rrl1474722r.1065t>c0.679
rrl1474743r.1086t>g0.725
rrl1474753r.1096a>g0.214
rrl1474760r.1103a>g0.976
rrl1474794r.1137c>t0.959
rrl1474803r.1146g>a0.960
rrl1474812r.1155g>a0.958
rrl1474830r.1173a>g0.960
rrl1474913r.1256t>c0.673
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>t0.304
rrl1475061r.1404c>a0.333
rrl1475061r.1404ca>c0.667
rrl1475062r.1405a>t1.000
rrl1475076r.1419c>a0.625
rrl1475090r.1433a>t0.659
rrl1475114r.1457c>t0.649
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a0.639
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475419r.1762c>t0.375
rrl1475429r.1772g>t0.333
rrl1475443r.1786g>a0.700
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t0.667
rrl1475479r.1822c>g0.333
rrl1475480r.1823a>t0.667
rrl1475483r.1826c>t0.320
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475544r.1887a>t0.429
rrl1475545r.1888t>g0.429
rrl1475573r.1916g>a0.391
rrl1475649r.1992a>g0.727
rrl1475659r.2002g>a0.957
rrl1475753r.2096c>t0.286
rrl1475760r.2103ccg>c0.674
rrl1475762r.2105g>t0.857
rrl1475763r.2106c>t0.353
rrl1475764r.2107a>c0.353
rrl1475765r.2108a>g0.353
rrl1475775r.2118g>a0.300
rrl1475953r.2296a>g0.639
rrl1475975r.2318c>t0.679
rrl1475977r.2320a>g0.679
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c0.667
rrl1475991r.2334t>c0.333
rrl1475993r.2336c>t0.667
rrl1475995r.2338g>a0.333
rrl1475997r.2340a>t0.667
rrl1476085r.2428g>a0.286
rrl1476086r.2429g>a0.286
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c0.308
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c0.966
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c0.606
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>g0.343
rrl1476256r.2599a>t0.361
rrl1476260r.2603a>g0.371
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476529r.2872a>g0.351
rrl1476540r.2883c>t0.426
rrl1476583r.2926g>a0.449
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g0.477
rrl1476619r.2962c>t0.476
rrl1476628r.2971t>a1.000
rrl1476664r.3007t>c0.619
rrl1476665r.3008t>a0.381
rrl1476666r.3009c>t0.381
rrl1476674r.3017t>c1.000
rrl1476679r.3022t>c0.579
rrl1476689r.3032a>t1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833554p.Thr5Ser0.192
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T0.887
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G0.889
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G0.982
rpsA1833679c.138G>T0.982
rpsA1833685c.144G>C0.980
rpsA1833691c.150G>A0.887
rpsA1833694c.153G>T0.957
rpsA1833697c.156C>T0.957
rpsA1833700c.159C>T0.882
rpsA1833709c.168C>T0.905
rpsA1833724c.183C>T0.964
rpsA1833727c.186G>C0.964
rpsA1833733c.192C>G0.938
rpsA1833734p.Ala65Ser0.943
rpsA1833745c.204G>C0.967
rpsA1833748c.207C>G0.852
rpsA1833760c.219C>T0.969
rpsA1833787c.246C>G0.966
rpsA1833790c.249T>C0.950
rpsA1833802c.261A>G0.970
rpsA1833811c.270G>T0.985
rpsA1833823c.282G>A0.881
rpsA1833829c.288A>G0.118
rpsA1833832c.291G>A1.000
rpsA1833835c.294C>T0.867
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G0.119
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G0.864
rpsA1833877c.336C>G0.866
rpsA1833886c.345C>G0.868
rpsA1833894p.Ala118Glu1.000
rpsA1833904c.363G>A0.116
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833958c.417C>T0.837
rpsA1833961c.420C>G0.831
rpsA1833970c.429G>T1.000
rpsA1833976c.435C>T0.148
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G0.133
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C0.119
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834073p.Lys178Arg0.833
rpsA1834096c.555G>C0.800
rpsA1834097p.Ser186Arg0.200
rpsA1834102c.561T>C0.191
rpsA1834108c.567C>G0.795
rpsA1834114c.573G>C0.795
rpsA1834177c.636A>C1.000
rpsA1834189c.648G>C0.148
rpsA1834213c.672G>C0.145
rpsA1834228c.687C>A0.824
rpsA1834231c.690T>G0.816
rpsA1834234c.693G>T0.180
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T0.188
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T0.843
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T0.870
rpsA1834348c.807T>C1.000
rpsA1834357c.816T>C0.896
rpsA1834361c.820T>C0.106
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>T0.887
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T0.941
rpsA1834417c.876G>C0.941
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T0.942
rpsA1834438c.897C>T0.943
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T0.926
rpsA1834489c.948T>C1.000
rpsA1834516c.975G>A0.897
rpsA1834519c.978G>C0.862
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834540c.999G>C0.127
rpsA1834543c.1002C>G0.982
rpsA1834546c.1005T>C0.982
rpsA1834552c.1011G>T0.824
rpsA1834555c.1014T>G0.976
rpsA1834557p.Ala339Gly0.816
rpsA1834606c.1065C>T0.984
rpsA1834609c.1068T>C0.984
rpsA1834619c.1078T>C0.981
rpsA1834622c.1081T>A0.980
rpsA1834633c.1092A>G0.984
rpsA1834639c.1098T>C0.985
rpsA1834645c.1104C>T0.771
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.781
rpsA1834705c.1164C>G0.758
rpsA1834720c.1179C>G0.817
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834747c.1206A>G0.809
rpsA1834753c.1212T>C0.174
rpsA1834756c.1215G>A0.179
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T0.191
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834786c.1245A>G0.191
rpsA1834789c.1248T>C1.000
rpsA1834792c.1251G>C0.191
rpsA1834813c.1272G>T0.750
rpsA1834829p.Ala430Ile0.222
rpsA1834840c.1299G>A0.261
kasA2518723c.609G>A0.636
kasA2518726c.612G>C0.286
kasA2518732c.618C>G0.185
kasA2518738c.624G>C0.793
kasA2518747c.633C>G0.167
kasA2518756c.642G>C0.968
kasA2518768c.654C>G0.794
kasA2518771c.657C>G0.794
kasA2518774c.660C>T0.794
kasA2518780p.Glu222Asp0.176
kasA2518783c.669T>G0.176
kasA2518785p.Glu224Ala0.176
kasA2518787p.Arg225Asn0.176
kasA2518792c.678C>T0.176
kasA2518795c.681C>T0.971
kasA2518798c.684G>C0.800
kasA2518813c.699C>T0.135
kasA2518816c.702C>T0.135
kasA2518822c.708C>A0.815
kasA2518825c.711T>C0.981
kasA2518843c.729T>C0.173
kasA2518846c.732G>T0.816
kasA2518847p.Leu245Ile0.167
kasA2518853p.Leu247Val0.159
kasA2518864c.750G>C1.000
kasA2518877p.Lys255Leu0.148
thyX3067334c.612G>T1.000
thyX3067340c.606C>T1.000
thyX3067346c.600G>C1.000
thyX3067349c.597C>G1.000
thyX3067355c.591T>C1.000
thyX3067376c.570C>G1.000
thyX3067403c.543G>C1.000
thyX3067406c.540T>C1.000
thyX3067415c.531G>A1.000
thyX3067423c.523G>A1.000
thyX3067424c.522C>T1.000
thyX3067427c.519C>G1.000
thyX3067430c.516G>C1.000
thyX3067436c.510G>C1.000
thyX3067442c.504G>C1.000
thyX3067457c.489G>A1.000
panD4044167c.115G>A0.900
panD4044171c.111G>A0.900
panD4044174c.108G>A0.900
panD4044180p.Asp34Glu0.900
panD4044188c.94C>G0.900
panD4044189c.93G>A0.900
panD4044194p.Ala30Pro0.900
panD4044195c.87A>G0.900
panD4044219c.63G>A0.818
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044240c.42C>G0.900
panD4044249c.33G>A1.000
embC4240717c.855T>C0.215
embC4240729c.867C>G0.797
embC4240735c.873C>G0.776
embC4240741c.879C>T0.762
embC4240756c.894G>C0.762
embC4240768c.906G>A0.197
embC4240771c.909G>C0.722
embC4240772p.Ser304Ala0.722
embC4240777c.915G>A0.224
embC4240778p.His306Gly0.776
embC4240781p.Ala307Ser0.792
embC4240786c.924C>T0.164
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser0.885
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr0.818
embC4240859p.Leu333Ile0.806
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embA4245454p.Ala741Val1.000
embA4245459p.Pro743Ala1.000
embA4245465p.Pro745Thr1.000
embB4247470c.957T>C1.000
embB4247491c.978G>C1.000
embB4247497c.984T>C1.000
embB4247511p.Tyr333Phe1.000
embB4247527c.1014G>C1.000
embB4247536c.1023C>G1.000
embB4248220c.1707A>G0.900
embB4248225p.Ala571Val0.900
embB4248233c.1720C>T0.900
embB4248242p.Val577Ile0.909
embB4248252p.Gly580Ala0.917
embB4248264p.Phe584Cys0.917
embB4248277c.1764G>C0.917
embB4248304c.1791G>C0.909

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;