TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d269b08ab0f5
Sample: 5d269b08ab0f5

Download results

Summary
ID: 5d269b08ab0f5
Date: Thu Jul 11 03:15:25 2019
Strain: root
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T0.966
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6634c.1395T>C0.923
gyrB6637c.1398T>G0.923
gyrB6640c.1401A>C0.917
gyrB6643c.1404A>G0.929
gyrB6646c.1407C>T0.933
gyrB6655c.1416T>C0.967
gyrB6673c.1434A>C0.977
gyrB6676c.1437T>G0.978
gyrB6703c.1464G>C0.980
gyrB6706c.1467G>A0.980
gyrB6709c.1470A>G0.980
gyrB6712c.1473G>C0.981
gyrB6727c.1488G>T0.982
gyrB6728c.1489C>T0.982
gyrB6739c.1500C>T0.985
gyrB6745c.1506T>C0.986
gyrB6754c.1515C>T0.987
gyrB6763c.1524G>C0.977
gyrB6772c.1533C>G0.952
gyrB6775c.1536G>C0.951
gyrB6793c.1554T>C0.975
gyrB6798p.Gly520Ala0.976
gyrB6808c.1569C>G0.975
gyrB6824c.1585C>T0.970
gyrB6841c.1602T>C0.969
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C0.977
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>C1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C0.917
gyrB7066c.1827G>T1.000
gyrB7078c.1839A>G1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7499c.198G>C0.973
gyrA7511c.210C>T0.978
gyrA7523c.222C>G0.979
gyrA7526c.225G>A0.980
gyrA7547c.246C>T0.985
gyrA7553c.252C>T0.986
gyrA7559c.258G>C0.987
gyrA7565c.264C>T0.987
gyrA7574c.273G>C0.988
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.988
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A0.983
gyrA8121c.820T>C0.941
gyrA8129c.828T>C0.941
gyrA8156c.855T>C0.941
gyrA8159c.858G>C0.941
gyrA8168c.867A>G0.941
gyrA8174c.873C>G0.941
gyrA8177c.876A>C0.941
gyrA8187p.Leu296Ile0.941
gyrA8192c.891C>G0.941
gyrA8198c.897T>C0.941
gyrA8207c.906T>C0.941
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T0.800
gyrA8576c.1275C>G0.846
gyrA8580p.Ile427Val0.867
gyrA8603c.1302A>C0.867
gyrA8609c.1308G>C0.867
gyrA8619c.1318T>C0.929
gyrA8624c.1323G>T0.929
gyrA8633c.1332C>G0.929
gyrA8636c.1335A>C0.929
gyrA8642c.1341A>G0.929
gyrA8645c.1344C>G0.929
gyrA8649p.Arg450Lys0.929
gyrA8666c.1365G>C0.929
gyrA8672c.1371A>G0.929
gyrA8693c.1392T>C0.929
gyrA8696c.1395G>C0.929
gyrA8699c.1398A>G0.929
gyrA8783c.1482G>C0.909
gyrA8786c.1485T>G0.909
gyrA8792c.1491G>C0.867
gyrA8799p.Ala500Ser0.882
gyrA8810c.1509A>G0.947
gyrA8817p.Ser506Ala0.950
gyrA8828c.1527T>C0.900
gyrA8829c.1528T>C0.950
gyrA8837c.1536C>G0.913
gyrA8846c.1545C>T0.933
gyrA8852c.1551T>C0.968
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>T0.984
gyrA8945c.1644G>C0.984
gyrA8946c.1645T>C0.984
gyrA8957c.1656C>T0.966
gyrA8967p.Ala556Lys0.982
gyrA8978c.1677C>T0.981
gyrA8987c.1686C>G0.978
gyrA8990c.1689C>G0.977
gyrA8993c.1692C>T0.977
gyrA8996c.1695T>C0.977
gyrA8998p.Leu566Trp0.977
gyrA9018p.Gln573Lys0.941
gyrA9023c.1722A>C0.941
gyrA9026c.1725G>C0.933
gyrA9029c.1728T>C0.933
gyrA9035c.1734G>C0.933
gyrA9044c.1743C>G0.917
gyrA9047c.1746C>T0.900
rpoB760079c.273G>A0.969
rpoB760091c.285G>C0.972
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G0.981
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G0.962
rpoB760376p.Asp190Glu0.969
rpoB760382c.576G>C0.973
rpoB760388c.582C>T0.974
rpoB760400c.594G>C0.980
rpoB760406c.600G>C0.944
rpoB760407p.Ser201Gly0.982
rpoB760415c.609C>T0.984
rpoB760418c.612G>C0.984
rpoB760430c.624T>C0.986
rpoB760460c.654G>C0.962
rpoB760475c.669A>G0.961
rpoB760481c.675G>C0.961
rpoB760484c.678A>G0.961
rpoB760502c.696C>G0.963
rpoB760522p.Ser239Asn0.974
rpoB760532c.726T>C0.971
rpoB760541c.735G>C0.970
rpoB760567p.Ser254Trp0.880
rpoB760571c.765G>C0.917
rpoB760588p.Thr261Ile0.969
rpoB760591p.Val262Ala0.969
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C0.970
rpoB761036c.1230G>C0.969
rpoB761037c.1231T>C0.969
rpoB761051c.1245G>T0.974
rpoB761054c.1248G>C0.974
rpoB761057c.1251G>C0.974
rpoB761060c.1254C>G0.974
rpoB761063c.1257C>G0.976
rpoB761084c.1278C>A0.983
rpoB761097c.1291A>T0.982
rpoB761102c.1296A>G0.983
rpoB761132c.1326G>C0.975
rpoB761133c.1327T>C0.976
rpoB761147c.1341C>T0.976
rpoB761150c.1344A>T0.975
rpoB761165c.1359G>C0.976
rpoB761171c.1365C>T0.975
rpoB761178p.Ser458Thr0.986
rpoB761186p.Glu460Asp0.984
rpoB761189c.1383T>C0.984
rpoB761195c.1389G>C0.985
rpoB761198c.1392G>C0.985
rpoB761219c.1413G>C0.973
rpoB761234c.1428G>C0.972
rpoB761249c.1443A>G0.970
rpoB761255c.1449T>G0.963
rpoB761258c.1452G>A0.962
rpoB761261c.1455G>C0.922
rpoB761264c.1458C>G0.873
rpoB761273c.1467T>C0.940
rpoB761303c.1497G>C0.967
rpoB761318c.1512G>T0.962
rpoB761327c.1521A>G0.960
rpoB761333c.1527G>T0.958
rpoB761339c.1533C>G0.955
rpoB761345c.1539G>C0.882
rpoB761346p.Val514Ser0.882
rpoB761354c.1548C>A0.938
rpoB761357c.1551G>T0.938
rpoB761360c.1554T>C0.938
rpoB761362p.Ser519Thr0.938
rpoB761373p.Val523His0.938
rpoB761384c.1578C>G0.938
rpoB761393c.1587G>A0.938
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761531c.1725C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C0.977
rpoB761573c.1767C>G0.957
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A0.944
rpoB761891c.2085G>C0.969
rpoB761909c.2103T>C0.974
rpoB761912c.2106T>C0.974
rpoB761915p.Asp703Glu0.974
rpoB761916p.Asp704Asn0.974
rpoB761924c.2118G>A0.977
rpoB761930c.2124G>C0.956
rpoB761933c.2127G>C0.979
rpoB761936c.2130C>T0.980
rpoB761948c.2142G>C0.985
rpoB761954c.2148C>A0.986
rpoB761955p.Ile717Val0.986
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C0.986
rpoB762236c.2430G>C0.986
rpoB762245c.2439G>C0.985
rpoB762275c.2469C>T0.985
rpoB762284c.2478G>C0.984
rpoB762293c.2487T>C0.981
rpoB762296c.2490G>C0.980
rpoB762317c.2511A>G0.975
rpoB762323c.2517C>A0.971
rpoB762329c.2523G>C0.971
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A0.977
rpoB762452c.2646G>C0.977
rpoB762470c.2664G>C0.977
rpoB762488c.2682G>C0.972
rpoB762491c.2685T>C0.943
rpoB762509c.2703T>G0.893
rpoB762510p.Ala902Pro0.893
rpoB762515c.2709C>T0.923
rpoB762533c.2727T>C0.875
rpoB762536c.2730T>C0.875
rpoB762537c.2731T>C0.875
rpoB762551c.2745C>T0.900
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G0.984
rpoB762920c.3114C>T0.966
rpoB762923c.3117C>G0.984
rpoB762929c.3123G>C0.985
rpoB762959c.3153G>C0.986
rpoB762962c.3156C>T0.986
rpoB762995c.3189G>T0.987
rpoB763031c.3225T>G0.986
rpoB763034c.3228C>G0.986
rpoB763040c.3234C>G0.985
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C0.971
rpoB763193c.3387C>G1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.984
rpoC763660c.291T>G0.967
rpoC763666c.297G>C0.981
rpoC763669c.300C>G0.944
rpoC763675c.306C>G0.979
rpoC763696c.327T>C0.944
rpoC763699c.330G>T0.944
rpoC763702c.333C>G0.944
rpoC763708c.339G>C0.941
rpoC763711c.342G>C0.941
rpoC763714c.345G>C0.941
rpoC763717c.348T>C0.941
rpoC763723c.354G>C0.941
rpoC763732c.363C>A0.941
rpoC763741c.372C>T0.941
rpoC763744c.375G>C0.941
rpoC763747c.378G>A0.933
rpoC763765c.396T>C0.923
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C0.938
rpoC764029p.Glu220Asp0.938
rpoC764032p.Asp221Glu0.941
rpoC764040p.Ser224Thr0.967
rpoC764044c.675T>C0.968
rpoC764054c.685C>T0.969
rpoC764059c.690G>T0.971
rpoC764083c.714A>G0.947
rpoC764084p.Asn239Val0.947
rpoC764095c.726C>T0.947
rpoC764098c.729A>G0.947
rpoC764110c.741C>T0.947
rpoC764143c.774G>C0.926
rpoC764147p.Ser260Ala0.958
rpoC764150p.Ile261Val0.957
rpoC764165p.Glu266Gln0.955
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C0.985
rpoC764461c.1092A>G0.986
rpoC764470c.1101C>T0.970
rpoC764497c.1128A>G0.974
rpoC764510c.1141C>T0.959
rpoC764524c.1155C>G0.974
rpoC764530c.1161C>G0.986
rpoC764534c.1165C>A0.985
rpoC764539c.1170C>T0.984
rpoC764542c.1173C>T0.984
rpoC764545c.1176C>A0.984
rpoC764560c.1191T>C0.987
rpoC764575c.1206T>G0.986
rpoC764611c.1242G>T0.986
rpoC764626c.1257C>T0.986
rpoC764632c.1263T>C0.985
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T0.970
rpoC765016c.1647C>G0.971
rpoC765019c.1650A>G0.971
rpoC765040c.1671T>C0.978
rpoC765041c.1672T>C0.978
rpoC765047c.1678T>C0.978
rpoC765055c.1686C>G0.978
rpoC765073c.1704G>C0.944
rpoC765076c.1707A>G0.941
rpoC765079c.1710T>G0.941
rpoC765082c.1713G>C0.941
rpoC765085c.1716T>C0.941
rpoC765089c.1720T>C0.941
rpoC765100c.1731G>C0.938
rpoC765103c.1734G>T0.938
rpoC765121c.1752G>T0.929
rpoC765129p.Tyr587Phe0.929
rpoC765143p.Val592Ile0.909
rpoC765343c.1974G>A0.929
rpoC765352c.1983G>C0.889
rpoC765356p.Met663Val0.889
rpoC765370c.2001G>C0.917
rpoC765379c.2010G>C0.920
rpoC765382c.2013G>T0.920
rpoC765383p.Met672Leu0.920
rpoC765403c.2034G>C0.921
rpoC765405p.Leu679His0.897
rpoC765409c.2040T>G0.923
rpoC765421c.2052C>G0.947
rpoC765449p.Ala694Ser0.955
rpoC765454c.2085C>G0.955
rpoC765469c.2100G>C0.958
rpoC765478c.2109T>G0.955
rpoC765480p.Tyr704Phe0.954
rpoC765499c.2130C>G0.968
rpoC765517c.2148C>G0.965
rpoC765533p.Tyr722His0.956
rpoC765544c.2175C>G0.957
rpoC765547c.2178C>T0.955
rpoC765548c.2179A>T0.955
rpoC765553c.2184C>T0.955
rpoC765556c.2187G>C0.955
rpoC765562c.2193G>T0.955
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr0.984
rpoC765875p.Val836Ile0.986
rpoC765886c.2517C>T0.988
rpoC765907c.2538G>T0.987
rpoC765910c.2541G>C0.986
rpoC765928c.2559C>G0.984
rpoC765940c.2571A>T0.984
rpoC765947c.2578T>C0.983
rpoC765962c.2593T>C0.972
rpoC765967c.2598C>T0.970
rpoC765973c.2604C>G0.938
rpoC765979c.2610C>G0.939
rpoC765982c.2613C>T0.969
rpoC765994c.2625A>T0.966
rpoC766003c.2634G>C0.958
rpoC766009c.2640G>C0.938
rpoC766012c.2643C>G0.938
rpoC766021c.2652G>C0.929
rpoC766321c.2952C>G0.960
rpoC766333c.2964G>T0.967
rpoC766345c.2976T>C0.967
rpoC766348c.2979A>G0.967
rpoC766351c.2982C>G0.967
rpoC766353p.Val995Ala0.967
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T0.985
rpoC766435p.Glu1022Asp0.971
rpoC766501c.3132G>C0.818
rpoC766507c.3138C>T0.875
rpoC766513c.3144C>T0.882
rpoC766522c.3153C>A0.882
rpoC766528c.3159T>G0.882
rpoC766531c.3162G>C0.882
rpoC766534c.3165C>G0.882
rpoC766537c.3168G>A0.882
rpoC766540p.Asp1057Glu0.882
rpoC766549c.3180G>C0.964
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766588c.3219G>A1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu0.964
rpoC766618c.3249G>T0.964
rpoC766624c.3255G>C0.960
rpoC766630c.3261G>C0.958
rpoC766633c.3264G>C0.958
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T0.984
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser0.977
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C0.984
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g0.977
rrs1471925r.80t>c0.973
rrs1471931r.86ga>g0.974
rrs1471934r.89a>g0.974
rrs1471985r.140t>c0.980
rrs1471986r.141c>t0.980
rrs1472030r.185g>a0.958
rrs1472031r.186g>c0.958
rrs1472032r.187g>a0.958
rrs1472033r.188a>c0.958
rrs1472035r.190g>t0.958
rrs1472040r.195t>g0.958
rrs1472041r.196c>t0.958
rrs1472042r.197t>g0.958
rrs1472043r.198t>a0.958
rrs1472050r.205g>c0.958
rrs1472061r.216a>t0.974
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a0.976
rrs1472251r.406g>a0.980
rrs1472337r.492c>g1.000
rrs1472380r.535g>c0.982
rrs1472446r.601t>a0.983
rrs1472452r.607g>a0.983
rrs1472464r.619a>g0.982
rrs1472612r.767g>t0.978
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.971
rrs1473088r.1243a>g0.971
rrs1473099r.1254t>a0.963
rrs1473104r.1259c>t0.963
rrs1473105r.1260g>a0.963
rrs1473110r.1265t>g0.963
rrs1473111r.1266a>g0.967
rrs1473121r.1276t>c0.949
rrs1473123r.1278a>t0.975
rrs1473129r.1284c>t0.976
rrs1473145r.1300c>t0.974
rrs1473166r.1321g>a0.974
rrs1473288r.1443c>t0.978
rrs1473290r.1445c>t0.978
rrs1473291r.1446g>t0.978
rrl1473684r.27g>a1.000
rrl1473697r.40c>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c0.968
rrl1473756r.99g>t0.970
rrl1473758r.101g>t0.970
rrl1473770r.113t>c0.971
rrl1473806r.149c>t0.974
rrl1473812r.155g>a0.970
rrl1473814r.157a>t0.970
rrl1473815r.158t>g0.970
rrl1473829r.172g>c0.970
rrl1473831r.174g>t0.968
rrl1473832r.175c>t0.968
rrl1473839r.182g>a0.976
rrl1473876r.219g>a0.974
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t0.958
rrl1473943r.286g>t0.947
rrl1473945r.288t>a0.941
rrl1473946r.289a>t0.941
rrl1473950r.293g>t0.941
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.861
rrl1474184r.527c>a1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a0.970
rrl1474306r.649a>c0.960
rrl1474308r.651g>t0.960
rrl1474310r.653t>g0.960
rrl1474356r.699t>c0.976
rrl1474362r.705a>g0.976
rrl1474387r.730c>t0.976
rrl1474413r.756a>c0.955
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.955
rrl1474496r.839c>g0.982
rrl1474497r.840g>c0.982
rrl1474506r.849c>g0.982
rrl1474507r.850g>c0.982
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g0.983
rrl1474760r.1103a>g0.983
rrl1474794r.1137c>t0.983
rrl1474803r.1146g>a0.983
rrl1474812r.1155g>a0.983
rrl1474830r.1173a>g0.983
rrl1474913r.1256t>c0.982
rrl1474932r.1275c>t0.979
rrl1475031r.1374g>c0.976
rrl1475061r.1404ca>c0.981
rrl1475076r.1419c>a0.982
rrl1475090r.1433a>t0.983
rrl1475114r.1457c>t0.985
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a0.974
rrl1475213r.1556c>t0.974
rrl1475220r.1563g>t0.974
rrl1475429r.1772g>a0.952
rrl1475443r.1786g>a0.957
rrl1475452r.1795c>a0.957
rrl1475475r.1818c>t0.920
rrl1475479r.1822c>t0.909
rrl1475480r.1823a>t0.909
rrl1475505r.1848g>a0.905
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a0.895
rrl1475649r.1992a>g0.900
rrl1475659r.2002g>a0.906
rrl1475760r.2103ccg>c0.979
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g0.944
rrl1476105r.2448g>a0.944
rrl1476106r.2449a>t0.944
rrl1476110r.2453g>c0.944
rrl1476114r.2457t>c0.944
rrl1476115r.2458t>c0.944
rrl1476131r.2474c>t0.971
rrl1476160r.2503t>c0.976
rrl1476214r.2557g>t0.975
rrl1476215r.2558c>t0.975
rrl1476221r.2564t>c0.975
rrl1476224r.2567a>g0.975
rrl1476251r.2594t>c0.960
rrl1476281r.2624t>c0.981
rrl1476297r.2640c>t0.981
rrl1476299r.2642c>t0.981
rrl1476584r.2927c>t0.979
rrl1476594r.2937c>t0.977
rrl1476597r.2940g>a0.975
rrl1476603r.2946g>a0.975
rrl1476608r.2951c>g0.976
rrl1476619r.2962c>t0.974
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C0.947
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G0.986
rpsA1833676c.135A>G0.966
rpsA1833679c.138G>T0.982
rpsA1833685c.144G>C0.982
rpsA1833691c.150G>A0.981
rpsA1833694c.153G>T0.980
rpsA1833697c.156C>T0.960
rpsA1833700c.159C>T0.962
rpsA1833709c.168C>T0.970
rpsA1833724c.183C>T0.980
rpsA1833727c.186G>C0.980
rpsA1833733c.192C>G0.957
rpsA1833734p.Ala65Ser0.957
rpsA1833742c.201A>G0.979
rpsA1833745c.204G>C0.979
rpsA1833748c.207C>G0.980
rpsA1833760c.219C>T0.965
rpsA1833787c.246C>G0.980
rpsA1833790c.249T>C0.980
rpsA1833802c.261A>G0.981
rpsA1833811c.270G>T0.983
rpsA1833823c.282G>A0.983
rpsA1833832c.291G>A0.982
rpsA1833838c.297G>C0.982
rpsA1833841c.300C>G0.982
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G0.985
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T0.987
rpsA1834297c.756C>T0.987
rpsA1834303c.762T>G0.986
rpsA1834306c.765T>C0.986
rpsA1834327c.786G>T0.987
rpsA1834357c.816T>C0.985
rpsA1834366c.825A>G0.986
rpsA1834375c.834G>C0.985
rpsA1834396c.855G>C0.986
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T0.979
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C0.984
rpsA1834667p.Ala376Ser0.985
rpsA1834690c.1149T>C0.986
rpsA1834700p.Gln387Ala0.982
rpsA1834705c.1164C>G0.982
rpsA1834720c.1179C>G0.987
rpsA1834732c.1191T>C0.988
rpsA1834738c.1197A>G0.987
rpsA1834753c.1212T>C0.962
rpsA1834759c.1218A>C0.974
rpsA1834765p.Glu408Asp0.974
rpsA1834774c.1233C>T0.969
rpsA1834776p.Ala412Glu0.969
rpsA1834780c.1239A>G0.969
rpsA1834789c.1248T>C0.969
rpsA1834813c.1272G>T0.962
rpsA1834830p.Ala430Val0.950
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240729c.867C>G0.982
embC4240735c.873C>G0.982
embC4240741c.879C>T0.983
embC4240756c.894G>C0.985
embC4240771c.909G>C0.978
embC4240772p.Ser304Ala0.978
embC4240778p.His306Gly0.978
embC4240781p.Ala307Ser0.978
embC4240789c.927T>C0.985
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr0.977
embC4240859p.Leu333Ile0.976
embC4240876c.1014C>T0.974
embC4240879c.1017G>T0.974
embC4240885c.1023T>C0.973
embC4240886p.Ile342Val0.973
embC4240897c.1035C>G0.970
embC4240900c.1038A>G0.967
embB4248208p.Ser565Arg0.900
embB4248220c.1707A>G0.968
embB4248226c.1713G>C0.971
embB4248232c.1719G>T0.971
embB4248233p.Leu574Val0.971
embB4248236p.Met575Leu0.972
embB4248245p.Ile578Val0.978
embB4248250c.1737C>T0.978
embB4248259p.Met582Ile0.978
embB4248275p.Thr588Ala0.978
embB4248292c.1779G>A0.978

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;