TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d26cbdadfbe1
Sample: 5d26cbdadfbe1

Download results

Summary
ID: 5d26cbdadfbe1
Date: Thu Jul 11 06:43:36 2019
Strain: lineage2;lineage4.3.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage4.3.2.1Euro-American (LAM)LAM3RD761

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T0.920
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A0.920
gyrB6151c.912C>T0.920
gyrB6172c.933C>T0.920
gyrB6184c.945C>T0.960
gyrB6193c.954G>A0.867
gyrB6196c.957C>T1.000
gyrB6202c.963C>T0.833
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C1.000
gyrB6223c.984G>C1.000
gyrB6229c.990G>A1.000
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C0.960
gyrB6673c.1434A>C0.941
gyrB6676c.1437T>G0.941
gyrB6703c.1464G>C0.951
gyrB6706c.1467G>A0.951
gyrB6709c.1470A>G0.951
gyrB6712c.1473G>C0.952
gyrB6727c.1488G>T0.955
gyrB6728c.1489C>T0.955
gyrB6739c.1500C>T0.946
gyrB6745c.1506T>C0.964
gyrB6754c.1515C>T0.947
gyrB6763c.1524G>C0.947
gyrB6772c.1533C>G0.933
gyrB6775c.1536G>C0.930
gyrB6793c.1554T>C0.949
gyrB6798p.Gly520Ala0.951
gyrB6808c.1569C>G0.982
gyrB6824c.1585C>T0.962
gyrB6841c.1602T>C0.978
gyrB6862c.1623C>G0.977
gyrB6869c.1630T>C0.971
gyrB6872c.1633T>C0.970
gyrB6878c.1639T>C0.970
gyrB6889c.1650G>A0.968
gyrB6898c.1659G>T0.967
gyrB7006c.1767T>G0.923
gyrB7010p.Leu591Met0.923
gyrB7015c.1776G>A0.923
gyrB7018c.1779G>C0.923
gyrB7024c.1785G>C1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7078c.1839A>G1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T0.953
gyrA7523c.222C>G0.979
gyrA7526c.225G>A1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T0.985
gyrA7559c.258G>C0.986
gyrA7565c.264C>T1.000
gyrA7574c.273G>C0.987
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.987
gyrA7595c.294C>T0.987
gyrA7607c.306C>T0.986
gyrA7637c.336C>A0.983
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C0.969
gyrA8283p.Ile328Leu0.971
gyrA8288c.987T>C0.971
gyrA8294c.993T>C0.976
gyrA8330c.1029C>G0.935
gyrA8339c.1038A>G0.950
gyrA8340p.Ala347Ser0.950
gyrA8354c.1053G>C0.950
gyrA8372c.1071G>T0.941
gyrA8382c.1081C>T0.920
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C0.975
gyrA8873c.1572A>G0.977
gyrA8897c.1596T>C0.983
gyrA8903c.1602T>C0.984
gyrA8915c.1614A>G0.984
gyrA8942c.1641G>C0.946
gyrA8945c.1644G>C0.944
gyrA8946c.1645T>C0.945
gyrA8967p.Ala556Lys0.940
gyrA8978c.1677C>T0.918
gyrA8987c.1686C>G0.921
gyrA8990c.1689C>G0.889
gyrA8993c.1692C>T0.889
gyrA8996c.1695T>C0.889
gyrA8998p.Leu566Trp0.917
gyrA9018p.Gln573Lys0.857
gyrA9023c.1722A>C0.900
rpoB760079c.273G>A0.955
rpoB760091c.285G>C0.962
rpoB760101c.295T>C0.962
rpoB760110c.304T>A0.962
rpoB760118c.312T>G0.964
rpoB760121c.315T>C0.964
rpoB760130p.Asp108Glu0.973
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.959
rpoB760274p.Glu156Asp0.955
rpoB760276p.Lys157Met0.953
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C0.970
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G0.975
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C0.980
rpoB760388c.582C>T0.981
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.984
rpoB760406r.600ga>g1.000
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T0.980
rpoB760611c.805T>C1.000
rpoB760634c.828T>C0.980
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala0.909
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C0.971
rpoB760703c.897C>T0.971
rpoB760721c.915C>G0.958
rpoB760724c.918T>C0.125
rpoB760727c.921C>G0.818
rpoB760730c.924T>C0.955
rpoB760736c.930C>G0.800
rpoB760793c.987A>G0.909
rpoB760805c.999G>C0.944
rpoB760817c.1011A>G0.947
rpoB760820c.1014T>C0.900
rpoB760826c.1020C>G0.957
rpoB760830c.1024T>C0.960
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T0.967
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760907c.1101C>T0.949
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T0.969
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G0.962
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C0.967
rpoB761036c.1230G>C0.971
rpoB761037c.1231T>C0.971
rpoB761051c.1245G>T0.976
rpoB761054c.1248G>C0.976
rpoB761057c.1251G>C0.976
rpoB761060c.1254C>G0.976
rpoB761063c.1257C>G0.978
rpoB761084c.1278C>A0.981
rpoB761097c.1291A>T0.980
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C0.986
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C0.987
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr0.985
rpoB761186p.Glu460Asp0.985
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761219c.1413G>C0.987
rpoB761234c.1428G>C1.000
rpoB761246c.1440C>T0.982
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G0.981
rpoB761258c.1452G>A0.962
rpoB761261c.1455G>C0.981
rpoB761264c.1458C>G0.946
rpoB761273c.1467T>C0.986
rpoB761303c.1497G>C0.984
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761345c.1539G>C1.000
rpoB761346p.Val514Ser1.000
rpoB761354c.1548C>A1.000
rpoB761357c.1551G>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761373p.Val523His1.000
rpoB761384c.1578C>G1.000
rpoB761393c.1587G>A1.000
rpoB761414c.1608A>G1.000
rpoB761482p.Ala559Gly0.917
rpoB761497p.Tyr564Phe0.938
rpoB761502p.Pro566Ser0.938
rpoB761505p.Ser567Ala0.938
rpoB761508p.Ser568Thr0.938
rpoB761516c.1710G>C0.966
rpoB761528c.1722C>T0.941
rpoB761531c.1725C>T0.947
rpoB761537c.1731C>G0.977
rpoB761555c.1749G>C0.981
rpoB761558c.1752C>G0.982
rpoB761564c.1758G>C0.966
rpoB761570c.1764T>C0.921
rpoB761573c.1767C>G0.866
rpoB761579c.1773G>C0.986
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T0.965
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A0.914
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T0.939
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C0.939
rpoB761705c.1899C>A0.926
rpoB761891c.2085G>C1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A0.971
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C0.971
rpoB761936c.2130C>T0.972
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val0.982
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C0.944
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T0.946
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A0.940
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T0.878
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A0.929
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C0.960
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C0.974
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A0.909
rpoB762329c.2523G>C0.968
rpoB762404c.2598T>C0.975
rpoB762410c.2604T>G0.951
rpoB762416c.2610A>G0.978
rpoB762449c.2643C>A0.983
rpoB762452c.2646G>C0.983
rpoB762470c.2664G>C0.983
rpoB762488c.2682G>C0.980
rpoB762491c.2685T>C1.000
rpoB762507c.2702 2702del1.000
rpoC763375c.6C>A0.231
rpoC763402c.33C>T0.800
rpoC763408c.39T>C0.938
rpoC763411c.42T>C0.933
rpoC763414c.45T>G0.923
rpoC763415p.Thr16Ser0.800
rpoC763423p.Glu18Asp0.923
rpoC763430c.61A>C0.933
rpoC763433p.Gln22Asn0.933
rpoC763443p.Tyr25Phe0.947
rpoC763450c.81G>A0.917
rpoC763456c.87A>G0.980
rpoC763468c.99G>C0.982
rpoC763486c.117T>C0.984
rpoC763492c.123G>C0.985
rpoC763528c.159G>A0.986
rpoC763531c.162G>T0.932
rpoC763546c.177A>G0.986
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.940
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G0.938
rpoC763675c.306C>G1.000
rpoC763699c.330G>T0.879
rpoC763702c.333C>G0.935
rpoC763708c.339G>C0.852
rpoC763711c.342G>C0.846
rpoC763714c.345G>C0.923
rpoC763717c.348T>C0.923
rpoC763723c.354G>C0.923
rpoC763732c.363C>A0.900
rpoC763741c.372C>T0.944
rpoC763744c.375G>C0.833
rpoC763747c.378G>A0.938
rpoC763765c.396T>C0.900
rpoC763774c.405G>C0.727
rpoC763781p.Ser138Ala0.727
rpoC763888c.519G>T1.000
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T1.000
rpoC764098c.729A>G1.000
rpoC764143c.774G>C0.939
rpoC764147p.Ser260Ala0.935
rpoC764150p.Ile261Val0.935
rpoC764165p.Glu266Gln0.933
rpoC764311c.942C>G0.947
rpoC764317c.948C>G0.960
rpoC764320c.951C>G0.962
rpoC764338c.969G>A0.969
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G0.957
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C0.965
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T0.969
rpoC764524c.1155C>G0.966
rpoC764530c.1161C>G0.962
rpoC764534c.1165C>A0.962
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T0.959
rpoC764545c.1176C>A0.959
rpoC764560c.1191T>C0.968
rpoC764575c.1206T>G0.984
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T0.986
rpoC764692c.1323C>T0.986
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.970
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.965
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C0.984
rpoC764827c.1458G>C0.985
rpoC764858c.1489T>C0.986
rpoC764869c.1500C>T0.986
rpoC764875c.1506C>A0.986
rpoC764887c.1518G>C0.986
rpoC764888c.1519T>C0.986
rpoC764896c.1527C>T0.961
rpoC764911c.1542A>G0.986
rpoC764912p.Met515Gln0.986
rpoC764932c.1563C>A0.986
rpoC764948c.1579T>C0.987
rpoC764968c.1599T>C0.987
rpoC765004c.1635G>C0.865
rpoC765007c.1638T>G0.971
rpoC765008c.1639T>C0.971
rpoC765011c.1642A>T0.971
rpoC765016c.1647C>G0.114
rpoC765019c.1650A>G0.857
rpoC765040c.1671T>C0.960
rpoC765041c.1672T>C0.980
rpoC765047c.1678T>C0.979
rpoC765055c.1686C>G0.980
rpoC765073c.1704G>C0.962
rpoC765076c.1707A>G0.960
rpoC765079c.1710T>G0.958
rpoC765082c.1713G>C0.958
rpoC765085c.1716T>C0.958
rpoC765089c.1720T>C0.958
rpoC765100c.1731G>C0.957
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T1.000
rpoC765129p.Tyr587Phe1.000
rpoC765143p.Val592Ile1.000
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C0.933
rpoC765356p.Met663Val0.933
rpoC765370c.2001G>C0.957
rpoC765379c.2010G>C0.957
rpoC765382c.2013G>T0.957
rpoC765383p.Met672Leu0.957
rpoC765403c.2034G>C0.974
rpoC765405p.Leu679His0.949
rpoC765409c.2040T>G0.974
rpoC765421c.2052C>G0.980
rpoC765449p.Ala694Ser0.984
rpoC765454c.2085C>G0.984
rpoC765469c.2100G>C0.957
rpoC765478c.2109T>G0.953
rpoC765480p.Tyr704Phe0.985
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G0.946
rpoC765533p.Tyr722His0.980
rpoC765544c.2175C>G0.875
rpoC765547c.2178C>T0.870
rpoC765548c.2179A>T0.957
rpoC765553c.2184C>T0.957
rpoC765556c.2187G>C0.957
rpoC765562c.2193G>T0.952
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765904c.2535C>G1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G0.962
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C0.944
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G0.923
rpoC766021c.2652G>C1.000
rpoC766321c.2952C>G0.850
rpoC766333c.2964G>C0.870
rpoC766345c.2976T>C0.960
rpoC766348c.2979A>G0.960
rpoC766351c.2982C>G0.880
rpoC766353p.Val995Ala0.880
rpoC766369c.3000C>G0.936
rpoC766375c.3006C>G0.935
rpoC766381c.3012C>T0.979
rpoC766384c.3015A>G0.979
rpoC766390c.3021C>T0.980
rpoC766393c.3024C>T0.980
rpoC766408c.3039C>T0.983
rpoC766435p.Glu1022Asp0.983
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T0.968
rpoC766607p.Ile1080Leu0.968
rpoC766618c.3249G>T0.968
rpoC766624c.3255G>C0.967
rpoC766630c.3261G>C0.966
rpoC766633c.3264G>C0.966
rpoC766645c.3276A>G0.960
rpoC766651c.3282T>C0.957
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser0.972
rpoC766942c.3573C>T0.974
rpoC766945c.3576A>C0.976
rpoC766963c.3594T>C0.984
rpoC766996c.3627C>T0.973
rpoC767002c.3633G>C0.974
rpoC767008c.3639G>A0.975
rpoC767023c.3654C>T0.977
rpoC767044c.3675G>C0.964
rpoC767080c.3711G>C0.960
rpoC767098c.3729T>C1.000
rpoC767100p.Lys1244Arg0.938
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G0.966
rpoC767125c.3756G>C0.931
rpoC767134c.3765C>T0.966
rpoC767138c.3769C>T0.966
rpoC767149c.3780C>T0.938
rpoC767158c.3789T>C0.957
rpoC767179c.3810C>T0.906
rpoC767180p.Ala1271Ser0.961
rpoC767191c.3822C>G0.964
rpoC767197c.3828G>A0.962
rpoC767203c.3834C>G0.911
rpoC767206c.3837C>G0.909
rpoC767209c.3840T>C0.909
rpoC767212c.3843G>C0.913
rpoC767221c.3852C>G0.968
rpoC767230c.3861G>C0.967
rpoC767233c.3864T>C0.967
rpoC767254c.3885G>C0.951
rpoC767264p.Ala1299Ser0.951
rpoC767267p.Ala1300Asn0.951
rpoC767281c.3912C>G0.975
rpoC767284c.3915C>G0.975
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G0.980
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C0.982
rpsL781706c.147T>C0.972
rpsL781715c.156T>G1.000
rpsL781766c.207C>T0.909
rpsL781772c.213C>T1.000
rpsL781802c.243G>C0.980
rpsL781805c.246G>A0.980
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A0.962
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A0.944
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.946
rrs1471986r.141c>t1.000
rrs1472030r.185g>a0.867
rrs1472031r.186g>c1.000
rrs1472032r.187g>a0.897
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a0.897
rrs1472050r.205g>c0.903
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c0.944
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.981
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.964
rrs1472734r.889c>t0.909
rrs1472741r.896g>a0.940
rrs1472846r.1001c>t0.970
rrs1472847r.1002g>a0.970
rrs1472848r.1003t>c0.917
rrs1472860r.1015c>t0.973
rrs1472861r.1016g>a0.973
rrs1472956r.1111t>c0.950
rrs1472957r.1112c>t0.948
rrs1472969r.1124a>g0.945
rrs1472970r.1125c>g0.945
rrs1472977r.1132g>c0.930
rrs1472978r.1133t>c0.934
rrs1472989r.1144g>a0.944
rrs1472990r.1145a>g0.944
rrs1473082r.1237g>a0.974
rrs1473088r.1243a>g0.973
rrs1473099r.1254t>a0.960
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a0.953
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.906
rrs1473123r.1278a>t0.983
rrs1473129r.1284c>t0.971
rrs1473145r.1300c>t0.957
rrs1473166r.1321g>a0.939
rrs1473288r.1443c>t0.962
rrs1473290r.1445c>t0.974
rrs1473291r.1446g>t0.974
rrl1473684r.27g>a0.833
rrl1473696r.39t>c0.200
rrl1473697r.40c>t0.200
rrl1473699r.42a>g0.200
rrl1473707r.50t>a0.871
rrl1473717r.60g>t0.125
rrl1473731r.74t>a0.895
rrl1473746r.89t>c1.000
rrl1473756r.99g>t0.951
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a0.967
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c0.967
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474044r.387c>t1.000
rrl1474051r.394t>c1.000
rrl1474054r.397t>c1.000
rrl1474056r.399t>c1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t0.952
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.822
rrl1474184r.527c>a0.925
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.925
rrl1474282r.625g>a0.938
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.986
rrl1474362r.705a>g1.000
rrl1474387r.730c>t0.974
rrl1474413r.756a>c0.977
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.977
rrl1474417r.760acacgcgc>a1.000
rrl1474437r.780gaa>g1.000
rrl1474496r.839c>g0.942
rrl1474497r.840g>c0.941
rrl1474506r.849c>g0.941
rrl1474507r.850g>c0.942
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g0.962
rrl1474722r.1065t>c0.945
rrl1474743r.1086t>g0.968
rrl1474760r.1103a>g0.966
rrl1474794r.1137c>t0.962
rrl1474803r.1146g>a0.962
rrl1474812r.1155g>a0.965
rrl1474830r.1173a>g0.962
rrl1474913r.1256t>c0.964
rrl1474932r.1275c>t0.978
rrl1475031r.1374g>t0.128
rrl1475061r.1404ca>c0.898
rrl1475076r.1419c>a0.875
rrl1475090r.1433a>t0.883
rrl1475114r.1457c>t0.902
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a0.919
rrl1475202r.1545g>c0.977
rrl1475209r.1552g>a0.974
rrl1475213r.1556c>t0.974
rrl1475220r.1563g>t0.972
rrl1475419r.1762c>t0.158
rrl1475429r.1772g>t0.167
rrl1475443r.1786g>a0.840
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t0.912
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t0.909
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475544r.1887a>t0.119
rrl1475545r.1888t>g0.119
rrl1475573r.1916g>a0.848
rrl1475649r.1992a>g0.943
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c0.922
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.959
rrl1475977r.2320a>g0.959
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c0.938
rrl1475993r.2336c>t0.938
rrl1475997r.2340a>t0.938
rrl1476085r.2428g>a0.952
rrl1476086r.2429g>a0.952
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g0.955
rrl1476103r.2446c>g0.955
rrl1476105r.2448g>a0.955
rrl1476106r.2449a>t0.955
rrl1476110r.2453g>c0.955
rrl1476114r.2457t>c0.909
rrl1476115r.2458t>c0.957
rrl1476131r.2474c>t0.981
rrl1476160r.2503t>c0.984
rrl1476214r.2557g>t0.981
rrl1476215r.2558c>t0.981
rrl1476221r.2564t>c0.980
rrl1476224r.2567a>g0.961
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t0.985
rrl1476594r.2937c>t0.986
rrl1476597r.2940g>a0.986
rrl1476603r.2946g>a0.986
rrl1476608r.2951c>g0.942
rrl1476619r.2962c>t0.939
rrl1476628r.2971t>a0.984
rrl1476665r.3008t>a0.971
rrl1476666r.3009c>t0.919
rrl1476674r.3017t>c0.972
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A0.964
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T0.966
rpsA1833709c.168C>T0.969
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G0.961
rpsA1833745c.204G>C0.980
rpsA1833748c.207C>G0.961
rpsA1833760c.219C>T0.982
rpsA1833787c.246C>G0.981
rpsA1833790c.249T>C0.980
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G0.980
rpsA1833862c.321G>T0.980
rpsA1833874c.333T>G0.958
rpsA1833886c.345C>G0.962
rpsA1833894p.Ala118Glu0.981
rpsA1833928c.387G>C0.981
rpsA1833949c.408T>C0.981
rpsA1833961c.420C>G0.965
rpsA1833970c.429G>T0.982
rpsA1833979c.438T>C0.982
rpsA1833991c.450C>G0.982
rpsA1834000c.459G>C0.983
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T0.968
rpsA1834073p.Lys178Arg0.949
rpsA1834096c.555G>C0.938
rpsA1834099c.558C>G0.936
rpsA1834108c.567C>G0.932
rpsA1834114c.573G>C0.932
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C0.982
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C0.985
rpsA1834366c.825A>G0.986
rpsA1834375c.834G>C0.970
rpsA1834396c.855G>C0.986
rpsA1834411c.870T>G0.982
rpsA1834414c.873C>T0.964
rpsA1834417c.876G>C0.964
rpsA1834420c.879C>T0.946
rpsA1834423c.882G>C0.983
rpsA1834429c.888C>T0.971
rpsA1834438c.897C>T0.961
rpsA1834451c.910T>C0.988
rpsA1834456c.915T>G0.987
rpsA1834468c.927A>G0.987
rpsA1834477c.936C>T0.962
rpsA1834489c.948T>C0.986
rpsA1834519c.978G>C0.961
rpsA1834520p.Ala327Ser0.980
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.980
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T0.978
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly0.956
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.980
rpsA1834704c.1164 1164del1.000
rpsA1834705r.1164c>g1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G0.969
kasA2518771c.657C>A0.969
kasA2518774c.660C>T0.969
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T0.969
kasA2518795c.681C>T0.970
kasA2518798c.684G>C0.943
kasA2518822c.708C>A0.950
kasA2518825c.711T>C0.983
kasA2518846c.732G>T0.965
kasA2518849c.735G>C0.964
kasA2518853p.Leu247Val0.964
kasA2518864c.750G>C0.980
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240729c.867C>G0.965
embC4240735c.873C>G0.966
embC4240741c.879C>T0.966
embC4240756c.894G>C0.954
embC4240771c.909G>C0.930
embC4240772p.Ser304Ala0.929
embC4240778p.His306Gly0.974
embC4240781p.Ala307Ser0.974
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser0.981
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr0.972
embC4240859p.Leu333Ile0.972
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embC4240909c.1047G>C1.000
embB4248208p.Ser565Arg0.200
embB4248220c.1707A>G0.971
embB4248226c.1713G>C0.968
embB4248232c.1719G>T0.882
embB4248233p.Leu574Val0.968
embB4248236p.Met575Leu0.882
embB4248245p.Ile578Val0.905
embB4248250c.1737C>T0.907
embB4248259p.Met582Ile0.909
embB4248275p.Thr588Ala0.909
embB4248292c.1779G>A0.909

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;