TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2838d01a6b4
Sample: 5d2838d01a6b4

Download results

Summary
ID: 5d2838d01a6b4
Date: Fri Jul 12 08:41:02 2019
Strain: lineage2.2.2;lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.939
gyrB6115c.876A>G0.951
gyrB6121c.882C>T0.929
gyrB6127c.888G>C0.952
gyrB6133c.894G>C0.929
gyrB6136c.897G>A0.952
gyrB6151c.912C>T0.951
gyrB6172c.933C>T0.951
gyrB6184c.945C>T0.951
gyrB6193c.954G>A0.893
gyrB6196c.957C>T0.875
gyrB6202c.963C>T0.864
gyrB6203p.Ser322Ala0.864
gyrB6214c.975G>C0.905
gyrB6223c.984G>C0.905
gyrB6655c.1416T>C0.917
gyrB6664c.1425C>T0.875
gyrB6673c.1434A>C0.947
gyrB6676c.1437T>G0.947
gyrB6700c.1461T>C0.900
gyrB6703c.1464G>C0.950
gyrB6706c.1467G>A0.950
gyrB6709c.1470A>G0.950
gyrB6712c.1473G>C0.950
gyrB6727c.1488G>T0.952
gyrB6728c.1489C>T0.952
gyrB6739c.1500C>T0.974
gyrB6745c.1506T>C0.974
gyrB6754c.1515C>T0.977
gyrB6763c.1524G>C0.980
gyrB6775c.1536G>C0.981
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6838c.1599C>T0.978
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>C1.000
gyrB7006c.1767T>G0.941
gyrB7010p.Leu591Met0.947
gyrB7015c.1776G>A0.947
gyrB7018c.1779G>C0.947
gyrB7024c.1785G>A0.960
gyrB7033c.1794G>C0.962
gyrB7051p.Glu604Asp0.964
gyrB7060c.1821T>C0.964
gyrB7066c.1827G>T0.964
gyrB7081c.1842T>C0.964
gyrB7084c.1845A>G0.964
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7343c.42G>C0.974
gyrA7355c.54T>A1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7412c.111C>G1.000
gyrA7421c.120G>C0.969
gyrA7424c.123G>C1.000
gyrA7427c.126G>C1.000
gyrA7433c.132G>C1.000
gyrA7439c.138C>T1.000
gyrA7442c.141G>C1.000
gyrA7451c.150C>A1.000
gyrA7457c.156T>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7559c.258G>C0.977
gyrA7565c.264C>T0.988
gyrA7574c.273G>C0.989
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.989
gyrA7595c.294C>T0.989
gyrA7607c.306C>T0.987
gyrA7637c.336C>A0.969
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C0.955
gyrA8283p.Ile328Leu0.957
gyrA8288c.987T>C0.958
gyrA8294c.993T>C0.964
gyrA8327c.1026C>T0.968
gyrA8330c.1029C>G0.968
gyrA8339c.1038A>G0.947
gyrA8340p.Ala347Ser0.964
gyrA8354c.1053G>C0.959
gyrA8366c.1065G>A1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T0.875
gyrA8576c.1275C>G0.889
gyrA8580p.Ile427Val0.909
gyrA8603c.1302A>C0.952
gyrA8609c.1308G>C0.952
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>T1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8792c.1491G>C0.900
gyrA8799p.Ala500Ser0.929
gyrA8810c.1509A>G0.952
gyrA8817p.Ser506Ala0.952
gyrA8828c.1527T>C0.960
gyrA8829c.1528T>C0.960
gyrA8837c.1536C>G0.964
gyrA8840c.1539C>T0.966
gyrA8846c.1545C>T0.949
gyrA8852c.1551T>C0.956
gyrA8858c.1557T>C0.979
gyrA8870c.1569G>C0.982
gyrA8873c.1572A>G0.982
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8924c.1623C>T1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
gyrA9023c.1722A>C1.000
gyrA9026c.1725G>C0.909
gyrA9029c.1728T>C1.000
gyrA9032c.1731T>C0.909
gyrA9035c.1734G>C0.909
gyrA9044c.1743C>G0.900
rpoB760079c.273G>A0.970
rpoB760091c.285G>C0.975
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760142c.336C>T1.000
rpoB760181c.375T>C0.986
rpoB760184c.378A>G0.986
rpoB760196c.390C>G0.986
rpoB760235c.429T>C0.984
rpoB760244c.438G>C0.982
rpoB760256c.450C>T0.981
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C0.974
rpoB760298c.492G>C0.966
rpoB760307c.501T>C0.962
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.955
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>T1.000
rpoB760484c.678A>G1.000
rpoB760499c.693G>A0.986
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760553c.747C>G0.981
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T0.984
rpoB760611c.805T>C0.984
rpoB760634c.828T>C0.985
rpoB760646c.840C>G0.982
rpoB760655c.849A>G0.982
rpoB760661c.855A>G0.981
rpoB760668p.Thr288Ala0.978
rpoB760674c.868T>C0.978
rpoB760679c.873A>G0.978
rpoB760683c.877T>C0.978
rpoB760703c.897C>T0.976
rpoB760721c.915C>G0.967
rpoB760727c.921C>G0.964
rpoB760730c.924T>C0.960
rpoB760736c.930C>G0.957
rpoB760793c.987A>G1.000
rpoB760799c.993C>T1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C0.966
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760886p.Glu360Asp0.983
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T0.986
rpoB760916c.1110C>T0.986
rpoB760928c.1122G>C0.985
rpoB760946c.1140A>G0.968
rpoB760965p.Met387Leu0.929
rpoB760970c.1164G>C0.923
rpoB760973c.1167G>T0.912
rpoB760979c.1173G>A0.903
rpoB760982c.1176G>T0.933
rpoB760985c.1179G>C0.935
rpoB760988c.1182C>G0.903
rpoB760991c.1185G>C0.943
rpoB760997c.1191G>C0.939
rpoB761006c.1200C>G0.957
rpoB761015c.1209G>C0.957
rpoB761027c.1221A>C0.949
rpoB761036c.1230G>C0.949
rpoB761037c.1231T>C0.949
rpoB761051c.1245G>T0.955
rpoB761054c.1248G>C0.956
rpoB761060c.1254C>G0.959
rpoB761063c.1257C>G0.966
rpoB761084c.1278C>A0.985
rpoB761097c.1291A>T0.982
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>T1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>T1.000
rpoB761219c.1413G>C1.000
rpoB761231c.1425C>T0.984
rpoB761234c.1428G>T0.983
rpoB761249c.1443A>G0.983
rpoB761255c.1449T>G0.978
rpoB761258c.1452G>A0.978
rpoB761261c.1455G>C0.978
rpoB761264c.1458C>G0.979
rpoB761273c.1467T>C0.983
rpoB761297c.1491C>T0.980
rpoB761318c.1512G>C0.974
rpoB761327c.1521A>G0.946
rpoB761339c.1533C>G0.943
rpoB761345c.1539G>C0.818
rpoB761346p.Val514Ser0.818
rpoB761354c.1548C>A0.818
rpoB761357c.1551G>T0.818
rpoB761360c.1554T>C0.818
rpoB761362p.Ser519Thr0.818
rpoB761373p.Val523His0.818
rpoB761387c.1581C>T0.900
rpoB761393c.1587G>A0.900
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761573c.1767C>G1.000
rpoB761579c.1773G>C1.000
rpoB761606c.1800C>G1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761648c.1842T>C1.000
rpoB761657c.1851C>T1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>C1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761718638AEES>638AEKA1.000
rpoB761741c.1935G>A1.000
rpoB761750c.1944G>T1.000
rpoB761863p.Ala686Glu1.000
rpoB761868p.Asp688Gln1.000
rpoB761873c.2067A>G1.000
rpoB761891c.2085G>C1.000
rpoB761892p.Ile696Val1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C0.986
rpoB762185c.2379G>C0.987
rpoB762194c.2388G>C0.987
rpoB762233c.2427G>C0.974
rpoB762236c.2430G>C0.974
rpoB762239c.2433G>A0.963
rpoB762245c.2439G>C0.976
rpoB762254c.2448T>C0.963
rpoB762284c.2478G>T0.969
rpoB762293c.2487T>C0.964
rpoB762296c.2490G>C0.960
rpoB762314c.2508C>T0.929
rpoB762317c.2511A>G0.947
rpoB762323c.2517C>A0.972
rpoB762329c.2523G>C0.970
rpoB762362p.Glu852Asp0.941
rpoB762368p.Glu854Asp0.941
rpoB762374c.2568G>T0.944
rpoB762380c.2574T>C1.000
rpoB762383c.2577C>G1.000
rpoB762392c.2586G>C1.000
rpoB762395c.2589G>T1.000
rpoB762398c.2592T>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762507c.2702 2702del0.977
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763609c.240C>T1.000
rpoC763621c.252C>T0.988
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>G1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser0.976
rpoC763945c.576T>C0.977
rpoC763947p.Ala193Val0.977
rpoC763951c.582G>C0.977
rpoC763960c.591T>G0.977
rpoC763969c.600C>T0.977
rpoC763987c.618C>T0.964
rpoC763991p.Ile208Leu0.957
rpoC763996c.627T>C0.957
rpoC763999c.630C>T0.957
rpoC764002c.633C>G0.957
rpoC764003p.Ala212Ser0.957
rpoC764024c.655T>C0.960
rpoC764029p.Glu220Asp0.958
rpoC764032p.Asp221Glu0.960
rpoC764040p.Ser224Thr0.949
rpoC764044c.675T>C0.955
rpoC764054c.685C>T0.960
rpoC764059c.690G>T0.961
rpoC764083c.714A>G0.963
rpoC764084p.Asn239Val0.981
rpoC764098c.729A>G0.981
rpoC764110c.741C>T0.981
rpoC764143c.774G>C0.974
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764362c.993C>T0.969
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>T1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764452c.1083T>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764509c.1140G>A1.000
rpoC764510c.1141C>T1.000
rpoC764521c.1152T>C1.000
rpoC764527c.1158C>T1.000
rpoC764530c.1161C>T1.000
rpoC764533c.1164C>A1.000
rpoC764536c.1167G>T1.000
rpoC764539c.1170C>G1.000
rpoC764545c.1176C>A1.000
rpoC764575c.1206T>G1.000
rpoC764593c.1224C>T1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764683c.1314G>A1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765343c.1974G>A0.909
rpoC765352c.1983G>C0.917
rpoC765356p.Met663Val0.917
rpoC765370c.2001G>A0.950
rpoC765379c.2010G>C0.950
rpoC765382c.2013G>T0.950
rpoC765383p.Met672Leu0.950
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His0.966
rpoC765408c.2040 2040del1.000
rpoC765409r.2040t>g1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781742c.183C>G1.000
rpsL781751c.192G>C1.000
rpsL781754c.195G>T1.000
rpsL781760c.201T>C1.000
rpsL781763c.204C>G1.000
rpsL781766c.207C>T1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C0.982
rpsL781814c.255C>T0.964
rpsL781817c.258G>T0.965
rpsL781829c.270G>C0.967
rpsL781832c.273T>C0.968
rpsL781859c.300T>C0.964
rpsL781868c.309T>C0.958
rpsL781871c.312G>C0.958
rpsL781877c.318T>A0.956
rpsL781892c.333A>G0.971
rpsL781898c.339A>T0.970
rpsL781907c.348T>C0.964
rpsL781916c.357T>C0.960
rpsL781929p.Gly124Ser0.957
rpsL781933374G>A0.955
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472860r.1015c>t0.986
rrs1472861r.1016g>a0.986
rrs1472956r.1111t>c0.968
rrs1472957r.1112c>t0.968
rrs1472969r.1124a>g0.966
rrs1472970r.1125c>g0.964
rrs1472977r.1132g>c0.966
rrs1472978r.1133t>c0.966
rrs1472989r.1144g>a0.971
rrs1472990r.1145a>g0.971
rrs1473082r.1237g>a0.952
rrs1473088r.1243a>g0.950
rrs1473099r.1254t>a0.929
rrs1473104r.1259c>t0.951
rrs1473105r.1260g>a0.927
rrs1473110r.1265t>g0.952
rrs1473111r.1266a>g0.952
rrs1473121r.1276t>c0.902
rrs1473123r.1278a>t0.958
rrs1473129r.1284c>t0.943
rrs1473145r.1300c>t0.964
rrs1473166r.1321g>a0.982
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473697r.40c>a0.950
rrl1473707r.50t>a0.968
rrl1473717r.60g>a0.971
rrl1473731r.74t>a0.976
rrl1473746r.89t>c0.979
rrl1473756r.99g>t0.980
rrl1473758r.101g>t0.981
rrl1473770r.113t>c0.982
rrl1473806r.149c>t0.971
rrl1473812r.155g>a0.948
rrl1473814r.157a>t0.948
rrl1473815r.158t>g0.949
rrl1473829r.172g>c0.951
rrl1473831r.174g>t0.951
rrl1473832r.175c>t0.951
rrl1473839r.182g>a0.971
rrl1473876r.219g>a0.968
rrl1473887r.230t>c0.966
rrl1473888r.231t>c0.966
rrl1473898r.241c>t0.964
rrl1473899r.242a>g0.964
rrl1473916r.259c>a0.959
rrl1473923r.266c>g0.949
rrl1473937r.280c>t0.970
rrl1473943r.286g>t0.962
rrl1473945r.288t>a0.962
rrl1473946r.289a>t0.962
rrl1473950r.293g>t0.962
rrl1474051r.394t>c1.000
rrl1474054r.397t>c0.917
rrl1474056r.399t>c0.929
rrl1474061r.404t>c0.941
rrl1474074r.417c>t0.962
rrl1474089r.432c>t0.964
rrl1474093r.436g>a0.964
rrl1474100r.443c>t0.964
rrl1474103r.446a>c0.964
rrl1474130r.473c>t0.981
rrl1474140r.483c>t0.982
rrl1474151r.494c>t0.984
rrl1474181r.524c>ct0.821
rrl1474184r.527c>a0.964
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a0.981
rrl1474291r.634tttcctctccggagga>t1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c0.957
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.955
rrl1474496r.839c>g0.962
rrl1474497r.840g>c0.962
rrl1474506r.849c>g0.980
rrl1474507r.850g>c0.980
rrl1474626r.969t>c0.979
rrl1474632r.975g>t0.946
rrl1474636r.979a>t0.972
rrl1474637r.980c>t0.972
rrl1474638r.981c>g0.972
rrl1474639r.982g>t0.972
rrl1474640r.983c>t0.973
rrl1474717r.1060a>g0.971
rrl1474722r.1065t>c0.972
rrl1474743r.1086t>g0.983
rrl1474760r.1103a>g0.984
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c0.978
rrl1475209r.1552g>a0.976
rrl1475213r.1556c>t0.975
rrl1475220r.1563g>t0.950
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.976
rrl1475977r.2320a>g0.976
rrl1475988r.2331a>g0.972
rrl1475989r.2332t>c0.972
rrl1475993r.2336c>t0.972
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a0.938
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c0.938
rrl1476099r.2442a>g0.938
rrl1476103r.2446c>g0.938
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c0.938
rrl1476114r.2457t>c0.938
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t0.973
rrl1476160r.2503t>c0.981
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C0.984
rpsA1833595c.54T>G0.984
rpsA1833596p.Ser19Ala0.968
rpsA1833604c.63C>T0.987
rpsA1833616c.75A>T0.988
rpsA1833619c.78A>C0.988
rpsA1833625c.84A>G0.989
rpsA1833664c.123C>G0.989
rpsA1833676c.135A>G0.988
rpsA1833679c.138G>T0.987
rpsA1833685c.144G>C0.987
rpsA1833691c.150G>A0.986
rpsA1833694c.153G>T0.985
rpsA1833697c.156C>T0.985
rpsA1833700c.159C>T0.985
rpsA1833709c.168C>T0.987
rpsA1833724c.183C>T0.984
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.984
rpsA1833734p.Ala65Ser0.984
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T0.985
rpsA1833787c.246C>G0.985
rpsA1833790c.249T>C0.985
rpsA1833802c.261A>G0.984
rpsA1833811c.270G>T0.983
rpsA1833823c.282G>A0.983
rpsA1833832c.291G>A0.980
rpsA1833835c.294C>T0.979
rpsA1833838c.297G>C0.979
rpsA1833841c.300C>G0.980
rpsA1833847c.306C>G0.985
rpsA1833862c.321G>T0.986
rpsA1833874c.333T>G0.986
rpsA1833877c.336C>G0.959
rpsA1833886c.345C>G0.974
rpsA1833894p.Ala118Glu0.958
rpsA1833928c.387G>C0.976
rpsA1833949c.408T>C0.977
rpsA1833958c.417C>T0.953
rpsA1833961c.420C>G0.977
rpsA1833970c.429G>T0.977
rpsA1833979c.438T>C0.974
rpsA1833991c.450C>G0.965
rpsA1834000c.459G>C0.965
rpsA1834009c.468C>T0.963
rpsA1834012c.471G>C0.963
rpsA1834015c.474G>C0.963
rpsA1834021c.480C>T0.966
rpsA1834030c.489C>G0.976
rpsA1834073p.Lys178Arg0.983
rpsA1834096c.555G>C0.980
rpsA1834099c.558C>G0.960
rpsA1834108c.567C>G0.957
rpsA1834114c.573G>C0.956
rpsA1834177c.636A>C0.980
rpsA1834228c.687C>A0.981
rpsA1834231c.690T>G0.981
rpsA1834234c.693G>T0.981
rpsA1834240c.699T>C0.981
rpsA1834246c.705G>T0.981
rpsA1834249c.708T>C0.981
rpsA1834252c.711C>G0.981
rpsA1834261c.720A>G0.985
rpsA1834264c.723G>C0.985
rpsA1834279c.738C>T0.984
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T0.984
rpsA1834348c.807T>C0.985
rpsA1834357c.816T>C0.986
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>T0.986
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T0.984
rpsA1834417c.876G>C0.984
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T0.972
rpsA1834438c.897C>T0.986
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834516c.975G>A1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.982
rpsA1834705c.1164C>G0.982
rpsA1834720c.1179C>G0.986
rpsA1834732c.1191T>C0.987
rpsA1834738c.1197A>G0.987
rpsA1834747c.1206A>G0.987
rpsA1834759c.1218A>C0.986
rpsA1834765p.Glu408Asp0.986
rpsA1834774c.1233C>T0.980
rpsA1834776p.Ala412Glu0.980
rpsA1834780c.1239A>G0.980
rpsA1834789c.1248T>C0.980
rpsA1834813c.1272G>T0.976
rpsA1834830p.Ala430Val0.972
kasA2518738c.624G>C0.974
kasA2518756c.642G>C0.977
kasA2518768c.654C>G0.958
kasA2518771c.657C>G0.958
kasA2518774c.660C>T0.958
kasA2518783c.669T>G0.958
kasA2518787p.Arg225Lys0.958
kasA2518792c.678C>T0.958
kasA2518795c.681C>T0.959
kasA2518798c.684G>C0.961
kasA2518822c.708C>A0.972
kasA2518825c.711T>C0.972
kasA2518846c.732G>T0.967
kasA2518849c.735G>C0.966
kasA2518853p.Leu247Val0.982
kasA2518864c.750G>C0.980
panD4044150c.132T>G1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044240c.42C>G1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;