TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2bcfae04a06
Sample: 5d2bcfae04a06

Download results

Summary
ID: 5d2bcfae04a06
Date: Mon Jul 15 02:01:20 2019
Strain: root
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6202c.963C>T1.000
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C1.000
gyrB6223c.984G>C1.000
gyrB6229c.990G>A1.000
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T0.976
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.983
gyrB6775c.1536G>C0.967
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7078c.1839A>G1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrB7123c.1884C>G1.000
gyrB7126c.1887G>C1.000
gyrB7129c.1890T>G1.000
gyrB7135c.1896G>A1.000
gyrB7136c.1897T>C1.000
gyrB7141c.1902T>G1.000
gyrB7144c.1905A>G0.909
gyrB7150c.1911G>A0.909
gyrB7153c.1914G>C0.909
gyrB7168c.1929C>G0.909
gyrB7178c.1939T>C0.909
gyrA7499c.198G>C0.973
gyrA7511c.210C>T0.955
gyrA7523c.222C>G0.979
gyrA7526c.225G>A0.979
gyrA7547c.246C>T0.984
gyrA7553c.252C>T0.970
gyrA7559c.258G>C0.971
gyrA7565c.264C>T0.973
gyrA7574c.273G>C0.975
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.988
gyrA7595c.294C>T0.988
gyrA7607c.306C>T0.987
gyrA7637c.336C>A1.000
gyrA8121c.820T>C0.929
gyrA8129c.828T>C0.929
gyrA8156c.855T>C0.929
gyrA8159c.858G>C0.929
gyrA8168c.867A>G0.929
gyrA8174c.873C>G0.929
gyrA8177c.876A>C0.929
gyrA8187p.Leu296Ile0.929
gyrA8192c.891C>G0.929
gyrA8198c.897T>C0.867
gyrA8207c.906T>C0.867
gyrA8267c.966G>C0.949
gyrA8283p.Ile328Leu0.957
gyrA8288c.987T>C0.960
gyrA8294c.993T>C0.964
gyrA8327c.1026C>T0.966
gyrA8330c.1029C>G0.966
gyrA8339c.1038A>G0.964
gyrA8340p.Ala347Ser0.963
gyrA8354c.1053G>C0.980
gyrA8382c.1081C>T0.975
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C0.923
gyrA8696c.1395G>C0.917
gyrA8699c.1398A>G0.917
gyrA8792c.1491G>C0.917
gyrA8799p.Ala500Ser0.923
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala0.938
gyrA8828c.1527T>C0.944
gyrA8829c.1528T>C0.944
gyrA8837c.1536C>G0.963
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys0.976
gyrA8978c.1677C>T0.976
gyrA8987c.1686C>G0.938
gyrA8990c.1689C>G0.933
gyrA8993c.1692C>T0.933
gyrA8996c.1695T>C0.933
gyrA8998p.Leu566Trp0.933
rpoB760079c.273G>A0.939
rpoB760091c.285G>C0.976
rpoB760101c.295T>C0.977
rpoB760110c.304T>A0.977
rpoB760118c.312T>G0.977
rpoB760121c.315T>C0.978
rpoB760127c.321C>T0.958
rpoB760130p.Asp108Glu0.980
rpoB760139c.333A>G0.985
rpoB760181c.375T>C0.987
rpoB760184c.378A>G0.987
rpoB760196c.390C>G0.987
rpoB760235c.429T>C0.982
rpoB760244c.438G>C0.979
rpoB760256c.450C>T0.976
rpoB760274p.Glu156Asp0.971
rpoB760276p.Lys157Met0.970
rpoB760283c.477G>C0.968
rpoB760298c.492G>C0.963
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.962
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760567p.Ser254Trp0.968
rpoB760571c.765G>C0.970
rpoB760588p.Thr261Ile0.959
rpoB760591p.Val262Ala0.959
rpoB760595c.789C>T0.959
rpoB760596p.Thr264Pro0.960
rpoB760608c.802C>T0.968
rpoB760611c.805T>C0.969
rpoB760634c.828T>C0.958
rpoB760646c.840C>G0.969
rpoB760655c.849A>G0.966
rpoB760661c.855A>G0.963
rpoB760668p.Thr288Ala0.978
rpoB760674c.868T>C0.977
rpoB760679c.873A>G0.976
rpoB760683c.877T>C0.976
rpoB760703c.897C>T0.975
rpoB760721c.915C>G0.963
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala0.967
rpoB760862c.1056G>C0.967
rpoB760865c.1059C>T0.967
rpoB760886p.Glu360Asp0.970
rpoB760887p.Thr361Val0.970
rpoB760910c.1104C>T0.976
rpoB760916c.1110C>T0.976
rpoB760928c.1122G>C0.976
rpoB760943c.1137C>T0.971
rpoB760946c.1140A>G0.972
rpoB760965p.Met387Leu0.969
rpoB760970c.1164G>C0.968
rpoB760973c.1167G>T0.966
rpoB760982c.1176G>C0.947
rpoB760985c.1179G>C0.947
rpoB760988c.1182C>G0.950
rpoB760991c.1185G>T0.952
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761105c.1299C>T1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761219c.1413G>C1.000
rpoB761234c.1428G>C1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C0.968
rpoB761264c.1458C>G0.954
rpoB761273c.1467T>C1.000
rpoB761303c.1497G>C1.000
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761345c.1539G>C1.000
rpoB761346p.Val514Ser1.000
rpoB761354c.1548C>A1.000
rpoB761357c.1551G>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761373p.Val523His1.000
rpoB761384c.1578C>G1.000
rpoB761393c.1587G>A1.000
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761531c.1725C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C0.973
rpoB761573c.1767C>G0.950
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761891c.2085G>C0.964
rpoB761909c.2103T>C0.970
rpoB761912c.2106T>C0.970
rpoB761915p.Asp703Glu0.970
rpoB761916p.Asp704Asn0.970
rpoB761924c.2118G>A0.972
rpoB761930c.2124G>C0.973
rpoB761933c.2127G>C0.974
rpoB761936c.2130C>T0.974
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762507c.2702 2702del0.972
rpoC763402c.33C>T0.941
rpoC763408c.39T>C0.941
rpoC763411c.42T>C0.941
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser0.941
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A0.981
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C0.987
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.984
rpoC763660c.291T>G0.984
rpoC763666c.297G>C0.983
rpoC763669c.300C>G0.983
rpoC763675c.306C>G0.982
rpoC763696c.327T>C0.938
rpoC763699c.330G>T0.933
rpoC763702c.333C>G0.929
rpoC763708c.339G>C0.926
rpoC763711c.342G>C0.926
rpoC763714c.345G>C0.926
rpoC763717c.348T>C0.926
rpoC763723c.354G>C0.926
rpoC763732c.363C>A0.889
rpoC763741c.372C>T0.875
rpoC763744c.375G>C0.875
rpoC763747c.378G>A0.875
rpoC763765c.396T>C0.864
rpoC763774c.405G>C0.769
rpoC763781p.Ser138Ala0.600
rpoC763900c.531G>C0.800
rpoC763915c.546C>G0.857
rpoC763933c.564C>T0.923
rpoC763940p.Ala191Ser0.923
rpoC763947p.Ala193Val0.923
rpoC763951c.582G>C0.923
rpoC763960c.591T>G0.923
rpoC763969c.600C>T0.923
rpoC763987c.618C>T0.923
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C0.900
rpoC764029p.Glu220Asp0.900
rpoC764032p.Asp221Glu0.900
rpoC764040p.Ser224Thr0.929
rpoC764044c.675T>C0.933
rpoC764054c.685C>T0.929
rpoC764059c.690G>T0.935
rpoC764083c.714A>G0.938
rpoC764084p.Asn239Val0.938
rpoC764095c.726C>T0.938
rpoC764098c.729A>G0.938
rpoC764110c.741C>T0.938
rpoC764143c.774G>C0.938
rpoC764147p.Ser260Ala0.938
rpoC764150p.Ile261Val0.938
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764332c.963G>A1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C0.980
rpoC764428c.1059G>C0.981
rpoC764431c.1062G>C0.980
rpoC764434c.1065A>G0.980
rpoC764435c.1066A>C0.980
rpoC764458c.1089G>C0.983
rpoC764461c.1092A>G0.983
rpoC764497c.1128A>G0.985
rpoC764510c.1141C>T0.984
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T1.000
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T0.987
rpoC764632c.1263T>C0.976
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T0.987
rpoC764692c.1323C>T0.987
rpoC764713c.1344G>T0.986
rpoC764716c.1347G>C0.986
rpoC764746c.1377G>T0.986
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G0.987
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T0.917
rpoC765129p.Tyr587Phe0.917
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T0.952
rpoC765383p.Met672Leu0.952
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T1.000
rpoC765826c.2457T>C0.977
rpoC765835c.2466C>T0.979
rpoC765841c.2472G>T0.981
rpoC765861p.Phe831Tyr0.985
rpoC765875p.Val836Ile0.987
rpoC765907c.2538G>T0.985
rpoC765910c.2541G>C0.985
rpoC765928c.2559C>G0.983
rpoC765940c.2571A>T0.982
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C0.933
rpoC766507c.3138C>T0.933
rpoC766513c.3144C>T0.933
rpoC766522c.3153C>A0.933
rpoC766528c.3159T>G0.933
rpoC766531c.3162G>C0.933
rpoC766534c.3165C>G0.933
rpoC766537c.3168G>A0.933
rpoC766540p.Asp1057Glu0.941
rpoC766549c.3180G>C0.971
rpoC766570c.3201T>C0.971
rpoC766573c.3204T>G0.971
rpoC766594c.3225G>T0.971
rpoC766607p.Ile1080Leu0.972
rpoC766618c.3249G>T0.941
rpoC766624c.3255G>C0.938
rpoC766630c.3261G>C0.962
rpoC766633c.3264G>C0.920
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767095c.3726C>T1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.947
rpsL781572p.Gln5Asn0.958
rpsL781586c.27C>T0.974
rpsL781595c.36T>C0.978
rpsL781608p.Ser17Ala0.979
rpsL781616c.57C>G0.982
rpsL781628c.69T>C0.984
rpsL781649c.90T>C0.987
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C0.984
rpsL781715c.156T>G0.983
rpsL781766c.207C>T0.917
rpsL781772c.213C>T0.970
rpsL781802c.243G>C0.958
rpsL781814c.255C>T0.957
rpsL781817c.258G>T0.957
rpsL781829c.270G>C0.964
rpsL781832c.273T>C0.982
rpsL781859c.300T>C0.984
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g0.981
rrs1471925r.80t>c0.976
rrs1471931r.86ga>g0.976
rrs1471934r.89a>g0.975
rrs1471985r.140t>c0.980
rrs1471986r.141c>t0.980
rrs1472030r.185g>a0.917
rrs1472031r.186g>c0.917
rrs1472032r.187g>a0.917
rrs1472033r.188a>c0.917
rrs1472035r.190g>t0.917
rrs1472040r.195t>g0.917
rrs1472041r.196c>t0.917
rrs1472042r.197t>g0.917
rrs1472043r.198t>a0.917
rrs1472050r.205g>c0.929
rrs1472053r.208agc>a0.929
rrs1472061r.216a>t0.966
rrs1472106r.261g>a0.973
rrs1472108r.263c>t0.973
rrs1472150r.305t>a0.986
rrs1472251r.406g>a0.960
rrs1472286r.441c>g0.800
rrs1472287r.442c>t0.800
rrs1472289r.444t>g0.800
rrs1472290r.445c>g0.800
rrs1472337r.492c>g0.974
rrs1472380r.535g>c0.980
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c1.000
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac1.000
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t0.983
rrl1473812r.155g>a0.980
rrl1473814r.157a>t0.980
rrl1473815r.158t>g0.981
rrl1473829r.172g>c0.979
rrl1473831r.174g>t0.979
rrl1473832r.175c>t0.979
rrl1473839r.182g>a0.982
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474051r.394t>c1.000
rrl1474054r.397t>c1.000
rrl1474056r.399t>c1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t0.980
rrl1474181r.524c>ct0.808
rrl1474184r.527c>a0.977
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.984
rrl1474282r.625g>a0.984
rrl1474306r.649a>c0.978
rrl1474308r.651g>t0.978
rrl1474310r.653t>g0.978
rrl1474356r.699t>c0.961
rrl1474362r.705a>g0.973
rrl1474387r.730c>t0.953
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.981
rrl1474497r.840g>c0.981
rrl1474506r.849c>g0.981
rrl1474507r.850g>c0.981
rrl1474626r.969t>c0.984
rrl1474632r.975g>t0.978
rrl1474636r.979a>t0.977
rrl1474637r.980c>t0.977
rrl1474638r.981c>g0.977
rrl1474639r.982g>t0.977
rrl1474640r.983c>t0.977
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c0.977
rrl1474932r.1275c>t0.971
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c0.985
rrl1475076r.1419c>a0.986
rrl1475090r.1433a>t0.986
rrl1475114r.1457c>t0.985
rrl1475120r.1463g>t0.985
rrl1475129r.1472g>a0.986
rrl1475202r.1545g>c0.971
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a0.971
rrl1475443r.1786g>a0.973
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a0.978
rrl1475526r.1869c>a0.974
rrl1475531r.1874c>t0.974
rrl1475573r.1916g>a0.971
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.982
rrl1475977r.2320a>g0.981
rrl1475988r.2331a>g0.978
rrl1475989r.2332t>c0.976
rrl1475993r.2336c>t0.976
rrl1475997r.2340a>t0.976
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t0.984
rrl1476215r.2558c>t0.984
rrl1476221r.2564t>c0.984
rrl1476224r.2567a>g0.984
rrl1476251r.2594t>c0.984
rrl1476281r.2624t>c0.962
rrl1476297r.2640c>t0.979
rrl1476299r.2642c>t0.979
rrl1476584r.2927c>t0.985
rrl1476594r.2937c>t0.985
rrl1476597r.2940g>a0.984
rrl1476603r.2946g>a0.983
rrl1476608r.2951c>g0.983
rrl1476619r.2962c>t0.982
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T0.923
inhA1674879c.678T>C0.923
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C0.980
rpsA1833595c.54T>G0.980
rpsA1833596p.Ser19Ala0.980
rpsA1833604c.63C>T0.984
rpsA1833616c.75A>T0.985
rpsA1833619c.78A>C0.985
rpsA1833625c.84A>G0.986
rpsA1833664c.123C>G0.986
rpsA1833676c.135A>G0.983
rpsA1833679c.138G>T0.982
rpsA1833685c.144G>C0.982
rpsA1833691c.150G>A0.981
rpsA1833694c.153G>T0.980
rpsA1833697c.156C>T0.979
rpsA1833700c.159C>T0.979
rpsA1833709c.168C>T0.985
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T0.986
rpsA1833787c.246C>G0.986
rpsA1833790c.249T>C0.986
rpsA1833802c.261A>G0.973
rpsA1833811c.270G>T0.987
rpsA1833823c.282G>A0.986
rpsA1833832c.291G>A0.986
rpsA1833838c.297G>C0.986
rpsA1833841c.300C>G0.986
rpsA1833847c.306C>G0.987
rpsA1833856c.315A>G0.986
rpsA1833862c.321G>T0.972
rpsA1833874c.333T>G0.986
rpsA1833886c.345C>G0.973
rpsA1833894p.Ala118Glu0.974
rpsA1833928c.387G>C0.972
rpsA1833949c.408T>C0.971
rpsA1833961c.420C>G0.973
rpsA1833970c.429G>T0.971
rpsA1833979c.438T>C0.971
rpsA1833991c.450C>G0.951
rpsA1834000c.459G>C0.966
rpsA1834009c.468C>T0.963
rpsA1834012c.471G>C0.962
rpsA1834015c.474G>C0.962
rpsA1834021c.480C>T0.964
rpsA1834030c.489C>G0.982
rpsA1834033c.492C>T0.982
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C0.985
rpsA1834366c.825A>G0.986
rpsA1834375c.834G>C0.986
rpsA1834396c.855G>C0.987
rpsA1834411c.870T>G0.983
rpsA1834414c.873C>T0.982
rpsA1834417c.876G>C0.982
rpsA1834420c.879C>T0.983
rpsA1834423c.882G>C0.983
rpsA1834429c.888C>T0.986
rpsA1834438c.897C>T0.987
rpsA1834451c.910T>C0.988
rpsA1834456c.915T>G0.988
rpsA1834468c.927A>G0.988
rpsA1834477c.936C>T0.987
rpsA1834489c.948T>C0.988
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser0.977
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T0.985
rpsA1834609c.1068T>C0.984
rpsA1834619c.1078T>C0.978
rpsA1834622c.1081T>A0.978
rpsA1834633c.1092A>G0.986
rpsA1834639c.1098T>C0.986
rpsA1834645c.1104C>T0.986
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser0.987
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.984
rpsA1834705c.1164C>G0.984
rpsA1834720c.1179C>G0.985
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G0.986
rpsA1834753c.1212T>C0.986
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
katG2155608c.504G>C1.000
katG2155614c.498A>G1.000
katG2155617c.495A>G1.000
katG2155626c.486C>G1.000
katG2155632c.480T>G0.952
katG2155635c.477G>C0.952
katG2155641p.Lys157Asn0.952
katG2155644c.468G>T0.955
katG2155647c.465G>A0.960
katG2155653c.459C>T0.972
katG2155691c.421A>G0.974
katG2155692c.420G>A0.974
katG2155696p.Ala139Val0.974
katG2155698c.414G>A0.974
katG2155716c.396A>C0.974
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G0.971
kasA2518771c.657C>G0.971
kasA2518774c.660C>T0.971
kasA2518783c.669T>G0.971
kasA2518787p.Arg225Lys0.971
kasA2518792c.678C>T0.971
kasA2518795c.681C>T0.971
kasA2518798c.684G>C0.971
kasA2518822c.708C>A0.971
kasA2518825c.711T>C0.971
kasA2518846c.732G>T0.968
kasA2518849c.735G>C0.967
kasA2518853p.Leu247Val0.966
kasA2518864c.750G>C0.965
embC4240729c.867C>G0.984
embC4240735c.873C>G0.984
embC4240741c.879C>T0.984
embC4240756c.894G>C0.986
embC4240771c.909G>C0.980
embC4240772p.Ser304Ala0.980
embC4240778p.His306Gly0.980
embC4240781p.Ala307Ser0.961
embC4240789c.927T>C0.972
embC4240819c.957A>C0.958
embC4240826p.Ala322Ser0.955
embC4240831c.969T>G0.952
embC4240856p.Ala332Thr0.951
embC4240859p.Leu333Ile0.950
embC4240876c.1014C>T0.943
embC4240879c.1017G>T0.943
embC4240885c.1023T>C0.943
embC4240886p.Ile342Val0.943
embC4240897c.1035C>G0.939
embC4240900c.1038A>G0.933
embC4240909c.1047G>C0.926

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;