TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2bf8c46283d
Sample: 5d2bf8c46283d

Download results

Summary
ID: 5d2bf8c46283d
Date: Mon Jul 15 04:56:39 2019
Strain: lineage2.2;lineage4.3.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage4.3.2.1Euro-American (LAM)LAM3RD761

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.960
gyrB6115c.876A>G0.967
gyrB6121c.882C>T0.967
gyrB6127c.888G>C0.967
gyrB6133c.894G>C0.968
gyrB6136c.897G>A0.968
gyrB6151c.912C>T0.935
gyrB6172c.933C>T0.938
gyrB6184c.945C>T0.938
gyrB6193c.954G>A0.875
gyrB6196c.957C>T0.867
gyrB6202c.963C>T0.846
gyrB6203p.Ser322Ala0.846
gyrB6214c.975G>C0.846
gyrB6223c.984G>C0.846
gyrB6664c.1425C>T1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C0.984
gyrB6798p.Gly520Ala0.984
gyrB6808c.1569C>G0.984
gyrB6824c.1585C>T0.982
gyrB6838c.1599C>T0.981
gyrB6841c.1602T>C0.981
gyrB6862c.1623C>G0.980
gyrB6869c.1630T>C0.971
gyrB6872c.1633T>C0.971
gyrB6878c.1639T>C0.971
gyrB6889c.1650G>A0.966
gyrB6898c.1659G>C0.962
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met0.929
gyrB7015c.1776G>A0.947
gyrB7018c.1779G>C0.947
gyrB7024c.1785G>A0.957
gyrB7033c.1794G>C0.957
gyrB7051p.Glu604Asp0.926
gyrB7060c.1821T>C0.926
gyrB7066c.1827G>T0.889
gyrB7081c.1842T>C0.926
gyrB7084c.1845A>G0.926
gyrB7090c.1851C>T0.926
gyrB7093c.1854T>C0.926
gyrB7100c.1861T>C0.926
gyrA7343c.42G>C0.939
gyrA7355c.54T>A0.939
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T0.969
gyrA7394c.93T>C0.969
gyrA7397c.96G>C0.969
gyrA7412c.111C>G0.969
gyrA7421c.120G>C0.962
gyrA7424c.123G>C0.958
gyrA7427c.126G>C0.958
gyrA7433c.132G>C0.955
gyrA7439c.138C>T0.938
gyrA7442c.141G>C0.938
gyrA7451c.150C>A0.938
gyrA7457c.156T>C0.933
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C0.933
gyrA8283p.Ile328Leu0.944
gyrA8288c.987T>C0.950
gyrA8294c.993T>C0.958
gyrA8327c.1026C>T0.960
gyrA8330c.1029C>G0.960
gyrA8339c.1038A>G0.920
gyrA8340p.Ala347Ser0.920
gyrA8354c.1053G>C0.909
gyrA8366c.1065G>A0.900
gyrA8372c.1071G>T0.882
gyrA8382c.1081C>T0.882
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>T1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8810c.1509A>G0.929
gyrA8817p.Ser506Ala0.929
gyrA8828c.1527T>C0.933
gyrA8829c.1528T>C0.933
gyrA8837c.1536C>G0.938
gyrA8840c.1539C>T0.938
gyrA8846c.1545C>T0.966
gyrA8852c.1551T>C0.939
gyrA8858c.1557T>C0.951
gyrA8870c.1569G>C0.918
gyrA8873c.1572A>G0.958
gyrA8897c.1596T>C0.986
gyrA8903c.1602T>C0.986
gyrA8915c.1614A>G0.987
gyrA8924c.1623C>T0.987
gyrA8942c.1641G>C0.984
gyrA8945c.1644G>C0.984
gyrA8946c.1645T>C0.984
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C0.946
gyrA8998p.Leu566Trp0.946
gyrA9018p.Gln573Lys0.857
gyrA9023c.1722A>C0.833
gyrA9026c.1725G>C0.818
gyrA9029c.1728T>C0.818
gyrA9032c.1731T>C0.818
gyrA9035c.1734G>C0.818
rpoB760079c.273G>A0.939
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A0.952
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760142c.336C>T0.984
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.935
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C0.986
rpoB760475c.669A>G1.000
rpoB760481c.675G>T1.000
rpoB760484c.678A>G1.000
rpoB760499c.693G>A0.984
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760553c.747C>G0.980
rpoB760567p.Ser254Trp1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C0.981
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala0.974
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T0.972
rpoB760721c.915C>G0.962
rpoB760727c.921C>G0.958
rpoB760730c.924T>C1.000
rpoB760736c.930C>G0.955
rpoB760799c.993C>T1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val0.980
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760979c.1173G>A1.000
rpoB760982c.1176G>T1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>C1.000
rpoB760997c.1191G>C0.972
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T0.977
rpoB761054c.1248G>C0.978
rpoB761060c.1254C>G0.980
rpoB761063c.1257C>G0.981
rpoB761084c.1278C>A0.984
rpoB761097c.1291A>T0.982
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>T1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T0.983
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T0.983
rpoB761178p.Ser458Thr0.982
rpoB761186p.Glu460Asp0.980
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>T0.981
rpoB761219c.1413G>C0.984
rpoB761231c.1425C>T0.948
rpoB761234c.1428G>T0.966
rpoB761249c.1443A>G0.981
rpoB761255c.1449T>G0.980
rpoB761258c.1452G>A0.959
rpoB761261c.1455G>C0.958
rpoB761264c.1458C>G0.942
rpoB761273c.1467T>C0.967
rpoB761297c.1491C>T0.937
rpoB761318c.1512G>C0.946
rpoB761327c.1521A>G0.979
rpoB761339c.1533C>G0.950
rpoB761345c.1539G>C0.889
rpoB761346p.Val514Ser0.889
rpoB761354c.1548C>A0.941
rpoB761357c.1551G>T0.889
rpoB761360c.1554T>C0.944
rpoB761362p.Ser519Thr0.944
rpoB761373p.Val523His1.000
rpoB761387c.1581C>T0.941
rpoB761393c.1587G>A0.941
rpoB761414c.1608A>G1.000
rpoB761516c.1710G>C0.971
rpoB761528c.1722C>T0.974
rpoB761537c.1731C>G0.978
rpoB761555c.1749G>C0.964
rpoB761558c.1752C>G0.964
rpoB761564c.1758G>C0.964
rpoB761573c.1767C>G0.984
rpoB761579c.1773G>C0.985
rpoB761606c.1800C>G1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761648c.1842T>C1.000
rpoB761657c.1851C>T0.984
rpoB761669c.1863C>T0.967
rpoB761675c.1869G>C0.983
rpoB761687c.1881C>T0.955
rpoB761690c.1884G>C0.975
rpoB761693c.1887G>C0.975
rpoB761705c.1899C>A0.973
rpoB761720c.1914C>G0.200
rpoB761722p.Glu639Gly0.882
rpoB761727p.Ser641Gly0.938
rpoB761741c.1935G>A0.938
rpoB761750c.1944G>T0.938
rpoB761863p.Ala686Glu1.000
rpoB761868p.Asp688Gln1.000
rpoB761873c.2067A>G1.000
rpoB761891c.2085G>C1.000
rpoB761892p.Ile696Val1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G0.981
rpoB762134c.2328C>A1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C0.981
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762239c.2433G>A1.000
rpoB762245c.2439G>C1.000
rpoB762254c.2448T>C1.000
rpoB762284c.2478G>T1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762314c.2508C>T0.974
rpoB762317c.2511A>G0.974
rpoB762323c.2517C>A0.973
rpoB762329c.2523G>C0.972
rpoB762338c.2532T>C0.900
rpoB762362p.Glu852Asp0.938
rpoB762368p.Glu854Asp0.952
rpoB762374c.2568G>T0.952
rpoB762380c.2574T>C0.960
rpoB762383c.2577C>G0.963
rpoB762392c.2586G>C0.962
rpoB762395c.2589G>T0.966
rpoB762398c.2592T>C0.966
rpoB762404c.2598T>C0.974
rpoB762410c.2604T>G0.977
rpoB762416c.2610A>G0.978
rpoB762449c.2643C>A0.981
rpoB762452c.2646G>C0.981
rpoB762470c.2664G>C0.981
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G0.941
rpoB762510p.Ala902Pro0.941
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762827c.3021G>C0.974
rpoB762857c.3051C>G0.980
rpoB762860c.3054G>C0.980
rpoB762863c.3057T>C0.980
rpoB762866c.3060C>T0.980
rpoB762879p.Met1025Leu0.981
rpoB762894c.3088C>T0.985
rpoB762899c.3093G>C0.985
rpoB762917c.3111C>G0.983
rpoB762920c.3114C>T0.983
rpoB762923c.3117C>G0.984
rpoB762929c.3123G>C0.985
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763179c.3373C>T1.000
rpoB763193c.3387C>G1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763609c.240C>T1.000
rpoC763621c.252C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>G1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763774c.405G>C1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G0.971
rpoC764084p.Asn239Val0.971
rpoC764098c.729A>G0.971
rpoC764110c.741C>T0.971
rpoC764143c.774G>C0.944
rpoC764147p.Ser260Ala0.944
rpoC764150p.Ile261Val0.941
rpoC764165p.Glu266Gln0.938
rpoC764311c.942C>G1.000
rpoC764317c.948C>G0.952
rpoC764320c.951C>G0.955
rpoC764338c.969G>A0.968
rpoC764353c.984G>T0.974
rpoC764362c.993C>T0.975
rpoC764365c.996C>T0.975
rpoC764371c.1002G>C0.978
rpoC764377c.1008C>G0.978
rpoC764380c.1011G>C0.978
rpoC764387c.1018T>C0.978
rpoC764405c.1036A>C0.982
rpoC764428c.1059G>T0.982
rpoC764431c.1062G>C0.982
rpoC764434c.1065A>G0.981
rpoC764435c.1066A>C0.963
rpoC764452c.1083T>C0.984
rpoC764458c.1089G>C0.984
rpoC764461c.1092A>G0.984
rpoC764497c.1128A>G1.000
rpoC764509c.1140G>A0.968
rpoC764510c.1141C>T1.000
rpoC764521c.1152T>C0.983
rpoC764527c.1158C>T0.980
rpoC764530c.1161C>T0.980
rpoC764533c.1164C>A0.961
rpoC764536c.1167G>T0.980
rpoC764539c.1170C>G1.000
rpoC764545c.1176C>A0.985
rpoC764575c.1206T>G1.000
rpoC764593c.1224C>T0.985
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T0.984
rpoC764683c.1314G>A1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.984
rpoC764803c.1434C>T0.983
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.982
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C0.984
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.984
rpoC764875c.1506C>A0.969
rpoC764887c.1518G>C0.983
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln0.982
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C0.981
rpoC765343c.1974G>A0.818
rpoC765352c.1983G>C0.818
rpoC765356p.Met663Val0.818
rpoC765370c.2001G>A0.882
rpoC765379c.2010G>C0.882
rpoC765382c.2013G>T0.882
rpoC765383p.Met672Leu0.882
rpoC765403c.2034G>C0.939
rpoC765405p.Leu679His0.939
rpoC765409c.2040T>G0.944
rpoC765421c.2052C>G0.977
rpoC765449p.Ala694Ser0.980
rpoC765454c.2085C>G0.981
rpoC765469c.2100G>C0.984
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G0.963
rpoC765529c.2160C>T1.000
rpoC765533p.Tyr722His0.978
rpoC765544c.2175C>G0.923
rpoC765547c.2178C>T0.913
rpoC765548c.2179A>T0.957
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>C0.917
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765895c.2526G>A1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G0.980
rpoC765940c.2571A>T0.980
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C0.870
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G0.857
rpoC765979c.2610C>G0.842
rpoC765982c.2613C>T0.941
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C0.700
rpoC766321c.2952C>G0.875
rpoC766333c.2964G>T0.895
rpoC766345c.2976T>C0.895
rpoC766348c.2979A>G0.895
rpoC766351c.2982C>G0.895
rpoC766353p.Val995Ala0.895
rpoC766369c.3000C>G0.938
rpoC766375c.3006C>G0.939
rpoC766381c.3012C>T0.941
rpoC766384c.3015A>G0.943
rpoC766390c.3021C>T0.946
rpoC766393c.3024C>T0.947
rpoC766408c.3039C>T0.977
rpoC766435p.Glu1022Asp0.977
rpoC766501c.3132G>C0.900
rpoC766507c.3138C>T0.909
rpoC766513c.3144C>T0.933
rpoC766522c.3153C>A0.938
rpoC766528c.3159T>G0.938
rpoC766531c.3162G>C0.938
rpoC766534c.3165C>G0.938
rpoC766537c.3168G>A0.938
rpoC766540p.Asp1057Glu0.944
rpoC766549c.3180G>C0.960
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766975c.3606C>T0.981
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C0.985
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G0.984
rpoC767107c.3738C>T0.985
rpoC767119c.3750A>G0.987
rpoC767125c.3756G>C0.973
rpoC767134c.3765C>T0.986
rpoC767138c.3769C>T0.986
rpoC767149c.3780C>T0.985
rpoC767158c.3789T>C0.984
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C0.982
rpoC767264p.Ala1299Ser0.943
rpoC767267p.Ala1300Asn0.943
rpoC767281c.3912C>G0.943
rpoC767284c.3915C>G0.943
rpsL781559c.-1G>C0.947
rpsL781572p.Gln5Asn0.947
rpsL781586c.27C>T0.957
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G0.983
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C0.985
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c0.976
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g0.906
rrs1472380r.535g>c0.940
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t0.977
rrs1472741r.896g>a0.977
rrs1472846r.1001c>t0.979
rrs1472847r.1002g>a0.979
rrs1472860r.1015c>t0.976
rrs1472861r.1016g>a0.976
rrs1472956r.1111t>c0.971
rrs1472957r.1112c>t0.971
rrs1472969r.1124a>g0.963
rrs1472970r.1125c>g0.963
rrs1472977r.1132g>c0.963
rrs1472978r.1133t>c0.966
rrs1472989r.1144g>a0.971
rrs1472990r.1145a>g0.972
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.949
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g0.969
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t0.974
rrl1474151r.494c>t0.974
rrl1474184r.527c>a0.971
rrl1474249r.592g>t0.971
rrl1474263r.606g>a0.958
rrl1474282r.625g>a0.950
rrl1474291r.634tttcctctccggagga>t1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.974
rrl1474497r.840g>c0.976
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474710r.1053tggtg>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t0.971
rrl1474803r.1146g>a0.971
rrl1474812r.1155g>a0.969
rrl1474830r.1173a>g0.973
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c0.973
rrl1475076r.1419c>a0.978
rrl1475090r.1433a>t0.981
rrl1475114r.1457c>t0.978
rrl1475120r.1463g>t0.978
rrl1475129r.1472g>a0.978
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a0.929
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a0.950
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t0.960
rrl1475765r.2108a>t0.960
rrl1475954r.2297a>g1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c0.974
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t0.971
rrl1476299r.2642c>t0.972
rrl1476584r.2927c>t0.974
rrl1476594r.2937c>t0.974
rrl1476597r.2940g>a0.974
rrl1476603r.2946g>a0.975
rrl1476608r.2951c>g0.976
rrl1476619r.2962c>t0.902
rrl1476628r.2971t>a0.973
rrl1476665r.3008t>a0.913
rrl1476666r.3009c>t0.917
rrl1476674r.3017t>c0.882
rpsA1833536c.-6A>C0.931
rpsA1833538c.-4CA>C0.931
rpsA1833541c.-1T>C0.931
rpsA1833547c.6G>A0.956
rpsA1833589c.48A>C0.983
rpsA1833595c.54T>G0.983
rpsA1833596p.Ser19Ala0.949
rpsA1833604c.63C>T0.958
rpsA1833616c.75A>T0.987
rpsA1833619c.78A>C0.987
rpsA1833625c.84A>G0.988
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T0.980
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T0.981
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.981
rpsA1833734p.Ala65Ser0.981
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.986
rpsA1833832c.291G>A0.984
rpsA1833835c.294C>T0.984
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833862c.321G>T0.987
rpsA1833874c.333T>G1.000
rpsA1833877c.336C>G0.988
rpsA1833886c.345C>G0.988
rpsA1833894p.Ala118Glu0.988
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C0.989
rpsA1833958c.417C>T0.963
rpsA1833961c.420C>G0.976
rpsA1833970c.429G>T0.988
rpsA1833979c.438T>C0.989
rpsA1833991c.450C>G0.975
rpsA1834000c.459G>C0.987
rpsA1834009c.468C>T0.986
rpsA1834012c.471G>C0.986
rpsA1834015c.474G>C0.987
rpsA1834021c.480C>T0.988
rpsA1834030c.489C>G0.977
rpsA1834073p.Lys178Arg0.949
rpsA1834096c.555G>C0.942
rpsA1834099c.558C>G0.962
rpsA1834108c.567C>G0.960
rpsA1834114c.573G>C0.884
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A0.962
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C0.959
rpsA1834246c.705G>T0.959
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G0.962
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834348c.807T>C1.000
rpsA1834357c.816T>C0.985
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>T0.985
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T0.983
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C0.983
rpsA1834429c.888C>T0.967
rpsA1834438c.897C>T0.964
rpsA1834451c.910T>C0.982
rpsA1834456c.915T>G0.947
rpsA1834468c.927A>G0.969
rpsA1834477c.936C>T0.949
rpsA1834489c.948T>C0.967
rpsA1834516c.975G>A0.933
rpsA1834519c.978G>C0.927
rpsA1834520p.Ala327Ser0.951
rpsA1834528c.987T>C0.962
rpsA1834543c.1002C>G0.941
rpsA1834546c.1005T>C0.956
rpsA1834552c.1011G>T0.955
rpsA1834555c.1014T>G0.955
rpsA1834557p.Ala339Gly0.955
rpsA1834606c.1065C>T0.964
rpsA1834609c.1068T>C0.981
rpsA1834619c.1078T>C0.949
rpsA1834622c.1081T>A0.949
rpsA1834633c.1092A>G0.980
rpsA1834639c.1098T>C0.980
rpsA1834645c.1104C>T0.964
rpsA1834666c.1125G>C0.979
rpsA1834667p.Ala376Ser0.979
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834747c.1206A>G1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C0.958
kasA2518756c.642G>C0.962
kasA2518768c.654C>G0.963
kasA2518771c.657C>G0.963
kasA2518774c.660C>T0.963
kasA2518783c.669T>G0.963
kasA2518787p.Arg225Lys0.963
kasA2518792c.678C>T0.963
kasA2518795c.681C>T0.964
kasA2518798c.684G>C0.966
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044150c.132T>G0.917
panD4044167c.115G>A0.846
panD4044171c.111G>A0.846
panD4044174c.108G>A0.917
panD4044180p.Asp34Glu0.846
panD4044188c.94C>G0.923
panD4044189c.93G>A0.923
panD4044194p.Ala30Pro0.846
panD4044195c.87A>G0.923
panD4044219c.63G>A0.917
panD4044233p.Cys17His0.917
panD4044234c.48G>C0.917
panD4044240c.42C>G0.917
panD4044249c.33G>A0.917
embC4240729c.867C>G0.979
embC4240735c.873C>G0.980
embC4240741c.879C>T0.981
embC4240756c.894G>C0.982
embC4240771c.909G>C0.977
embC4240772p.Ser304Ala0.977
embC4240778p.His306Gly0.976
embC4240781p.Ala307Ser0.976
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;