TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c208991bb9
Sample: 5d2c208991bb9

Download results

Summary
ID: 5d2c208991bb9
Date: Mon Jul 15 07:46:20 2019
Strain: root
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.900
gyrB6115c.876A>G0.900
gyrB6121c.882C>T0.900
gyrB6127c.888G>C0.900
gyrB6133c.894G>C0.900
gyrB6136c.897G>A0.900
gyrB6151c.912C>T0.900
gyrB6172c.933C>T0.900
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T0.977
gyrB6763c.1524G>C0.976
gyrB6766c.1527G>A0.976
gyrB6772c.1533C>G0.977
gyrB6775c.1536G>C0.976
gyrB6793c.1554T>C0.974
gyrB6798p.Gly520Ala0.974
gyrB6808c.1569C>G0.939
gyrB6824c.1585C>T0.933
gyrB6841c.1602T>C0.964
gyrB6862c.1623C>G0.941
gyrB6865c.1626G>A0.938
gyrB6869c.1630T>C0.941
gyrB6872c.1633T>C0.882
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T0.917
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>C1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7078c.1839A>G1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7499c.198G>C0.981
gyrA7511c.210C>T0.982
gyrA7523c.222C>G0.983
gyrA7526c.225G>A0.983
gyrA7547c.246C>T0.987
gyrA7553c.252C>T0.988
gyrA7559c.258G>C0.988
gyrA7565c.264C>T0.988
gyrA7574c.273G>C0.988
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8783c.1482G>C1.000
gyrA8786c.1485T>G1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys0.983
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760193c.387C>G0.964
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.940
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760514c.708C>T0.968
rpoB760520c.714C>T0.961
rpoB760522p.Ser239Asn0.980
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760667c.861G>A1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C0.976
rpoB760679c.873A>G0.976
rpoB760683c.877T>C0.976
rpoB760703c.897C>T0.925
rpoB760721c.915C>G0.931
rpoB760727c.921C>G0.909
rpoB760730c.924T>C0.905
rpoB760736c.930C>G0.889
rpoB760805c.999G>C0.857
rpoB760817c.1011A>G0.895
rpoB760820c.1014T>C0.895
rpoB760826c.1020C>G0.947
rpoB760830c.1024T>C0.950
rpoB760841c.1035T>C0.963
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T0.960
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C0.987
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761219c.1413G>C1.000
rpoB761228c.1422C>T1.000
rpoB761234c.1428G>C1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C0.984
rpoB761264c.1458C>G0.959
rpoB761273c.1467T>C0.989
rpoB761318c.1512G>T0.985
rpoB761327c.1521A>G0.983
rpoB761333c.1527G>T0.983
rpoB761339c.1533C>G0.981
rpoB761345c.1539G>C0.941
rpoB761346p.Val514Ser0.938
rpoB761354c.1548C>A0.938
rpoB761357c.1551G>T0.938
rpoB761360c.1554T>C0.938
rpoB761362p.Ser519Thr0.938
rpoB761373p.Val523His0.938
rpoB761384c.1578C>G0.938
rpoB761393c.1587G>A0.938
rpoB761516c.1710G>C0.974
rpoB761528c.1722C>T0.977
rpoB761537c.1731C>G0.980
rpoB761555c.1749G>C0.983
rpoB761558c.1752C>G0.984
rpoB761564c.1758G>C0.985
rpoB761570c.1764T>C0.971
rpoB761573c.1767C>G0.946
rpoB761579c.1773G>C0.977
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T0.985
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761891c.2085G>C0.958
rpoB761909c.2103T>C0.966
rpoB761912c.2106T>C0.966
rpoB761915p.Asp703Glu0.966
rpoB761916p.Asp704Asn0.966
rpoB761924c.2118G>A0.969
rpoB761930c.2124G>C0.969
rpoB761933c.2127G>C0.969
rpoB761936c.2130C>T0.969
rpoB761948c.2142G>C0.980
rpoB761954c.2148C>A0.981
rpoB761955p.Ile717Val0.982
rpoB761969c.2163G>A0.985
rpoB761990c.2184G>C0.986
rpoB762008c.2202C>T0.986
rpoB762014c.2208C>G0.987
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G0.981
rpoB762114p.Ile770Val0.979
rpoB762122c.2316C>T0.979
rpoB762131c.2325C>G0.969
rpoB762134c.2328C>A0.968
rpoB762137c.2331C>T0.967
rpoB762140c.2334G>C0.967
rpoB762143c.2337T>C0.968
rpoB762149c.2343G>T0.979
rpoB762158c.2352G>C0.981
rpoB762167c.2361T>C0.982
rpoB762176c.2370T>C0.984
rpoB762185c.2379G>C0.986
rpoB762194c.2388G>C0.986
rpoB762233c.2427G>C0.988
rpoB762236c.2430G>C0.988
rpoB762242c.2436G>A0.961
rpoB762245c.2439G>C0.987
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C0.989
rpoB762470c.2664G>C0.988
rpoB762488c.2682G>C0.985
rpoB762491c.2685T>C0.985
rpoB762509c.2703T>G0.893
rpoB762510p.Ala902Pro0.891
rpoB762515c.2709C>T0.980
rpoB762533c.2727T>C0.943
rpoB762536c.2730T>C0.939
rpoB762537c.2731T>C0.939
rpoB762551c.2745C>T0.938
rpoB762557c.2751G>A0.889
rpoB762560c.2754A>C0.857
rpoB762563c.2757G>T0.857
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T0.979
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C0.985
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C0.978
rpoB763082c.3276C>T0.977
rpoB763088c.3282C>G0.977
rpoB763094c.3288G>C0.977
rpoB763115c.3309T>C0.978
rpoB763127c.3321G>C0.975
rpoB763136c.3330C>T0.972
rpoB763145c.3339G>A0.971
rpoB763157c.3351G>T0.967
rpoB763166c.3360A>G0.962
rpoB763172c.3366G>C0.962
rpoB763193c.3387C>G0.957
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp0.929
rpoC763430c.61A>C0.929
rpoC763433p.Gln22Asn0.929
rpoC763443p.Tyr25Phe0.941
rpoC763450c.81G>A0.967
rpoC763456c.87A>G0.969
rpoC763468c.99G>C0.973
rpoC763486c.117T>C0.977
rpoC763492c.123G>C0.978
rpoC763528c.159G>A0.961
rpoC763531c.162G>T0.957
rpoC763546c.177A>G0.960
rpoC763570c.201G>C0.962
rpoC763594c.225C>T0.980
rpoC763609c.240C>T0.942
rpoC763633c.264T>C0.981
rpoC763657c.288G>A0.980
rpoC763660c.291T>G0.980
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C0.963
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>T1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C0.941
rpoC763774c.405G>C0.923
rpoC763870c.501C>T0.800
rpoC763872p.Gly168Ala0.800
rpoC763876p.Glu169Asp0.800
rpoC763879c.510A>G0.846
rpoC763888c.519G>T0.846
rpoC763891c.522G>C0.857
rpoC763894c.525A>G0.867
rpoC763900c.531G>C0.959
rpoC763933c.564C>T0.980
rpoC763940p.Ala191Ser0.980
rpoC763947p.Ala193Val0.980
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T1.000
rpoC764098c.729A>G1.000
rpoC764110c.741C>T1.000
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln0.952
rpoC764311c.942C>G0.875
rpoC764317c.948C>G0.917
rpoC764320c.951C>G0.923
rpoC764338c.969G>A0.971
rpoC764353c.984G>T0.976
rpoC764365c.996C>T0.955
rpoC764371c.1002G>C0.955
rpoC764377c.1008C>G0.956
rpoC764380c.1011G>C0.957
rpoC764387c.1018T>C0.962
rpoC764405c.1036A>C0.967
rpoC764428c.1059G>C0.966
rpoC764431c.1062G>C0.964
rpoC764434c.1065A>G0.946
rpoC764435c.1066A>C0.964
rpoC764458c.1089G>C0.971
rpoC764461c.1092A>G0.970
rpoC764497c.1128A>G0.963
rpoC764510c.1141C>T0.978
rpoC764524c.1155C>G0.978
rpoC764530c.1161C>G0.976
rpoC764534c.1165C>A0.975
rpoC764539c.1170C>T0.975
rpoC764542c.1173C>T0.975
rpoC764545c.1176C>A0.975
rpoC764560c.1191T>C0.978
rpoC764575c.1206T>G0.978
rpoC764611c.1242G>T0.989
rpoC764626c.1257C>T0.989
rpoC764632c.1263T>C0.989
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C0.988
rpoC764746c.1377G>T0.988
rpoC764752c.1383G>C0.988
rpoC764758c.1389C>G0.988
rpoC764764c.1395T>C0.988
rpoC764791c.1422C>G0.988
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T0.984
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T1.000
rpoC765129p.Tyr587Phe1.000
rpoC765143p.Val592Ile1.000
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G0.984
rpoC765533p.Tyr722His0.980
rpoC765544c.2175C>G0.969
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T0.968
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T1.000
rpoC765826c.2457T>C0.974
rpoC765835c.2466C>T0.980
rpoC765841c.2472G>T0.981
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C0.974
rpoC766573c.3204T>G0.974
rpoC766588c.3219G>A0.974
rpoC766594c.3225G>T0.974
rpoC766607p.Ile1080Leu0.974
rpoC766618c.3249G>T0.971
rpoC766624c.3255G>C0.968
rpoC766630c.3261G>C0.964
rpoC766633c.3264G>C0.963
rpoC766642c.3273C>T0.917
rpoC766645c.3276A>G0.909
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C0.988
rpoC767104c.3735C>G0.987
rpoC767107c.3738C>T0.987
rpoC767119c.3750A>G0.987
rpoC767125c.3756G>C0.988
rpoC767134c.3765C>T0.988
rpoC767138c.3769C>T0.988
rpoC767149c.3780C>T0.988
rpoC767158c.3789T>C0.988
rpoC767179c.3810C>T0.986
rpoC767180p.Ala1271Ser0.986
rpoC767191c.3822C>G0.986
rpoC767197c.3828G>A0.986
rpoC767203c.3834C>G0.984
rpoC767206c.3837C>G0.983
rpoC767209c.3840T>C0.983
rpoC767212c.3843G>C0.984
rpoC767221c.3852C>G0.987
rpoC767230c.3861G>C0.988
rpoC767233c.3864T>C0.963
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G0.981
rpsL781559c.-1G>C0.955
rpsL781572p.Gln5Asn0.960
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a0.960
rrs1472108r.263c>t0.960
rrs1472113r.268t>c0.963
rrs1472150r.305t>a0.920
rrs1472251r.406g>a0.900
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t0.950
rrs1472847r.1002g>a0.950
rrs1472848r.1003t>c0.950
rrs1472860r.1015c>t0.944
rrs1472861r.1016g>a0.944
rrs1472956r.1111t>c0.900
rrs1472957r.1112c>t0.900
rrs1472969r.1124a>g0.900
rrs1472970r.1125c>g0.900
rrs1472977r.1132g>c0.909
rrs1472978r.1133t>c0.909
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.933
rrs1473088r.1243a>g0.933
rrs1473166r.1321g>a0.900
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.850
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.941
rrl1474497r.840g>c0.941
rrl1474506r.849c>g0.938
rrl1474507r.850g>c0.938
rrl1474626r.969t>c0.929
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475760r.2103ccg>c0.929
rrl1475764r.2107a>t0.929
rrl1475765r.2108a>t0.929
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1476214r.2557g>t0.900
rrl1476215r.2558c>t0.900
rrl1476221r.2564t>c0.900
rrl1476224r.2567a>g0.900
rrl1476251r.2594t>c0.909
rrl1476281r.2624t>c0.800
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t0.944
rrl1476597r.2940g>a0.944
rrl1476603r.2946g>a0.944
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a0.917
rrl1476666r.3009c>t0.917
rrl1476674r.3017t>c0.917
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C0.944
inhA1674966c.765T>C0.944
inhA1674975c.774C>T0.944
inhA1674977p.Tyr259Phe0.944
inhA1674993c.792G>T0.929
rpsA1833536c.-6A>C0.862
rpsA1833538c.-4CA>C0.862
rpsA1833541c.-1T>C0.862
rpsA1833547c.6G>A0.930
rpsA1833589c.48A>C0.947
rpsA1833595c.54T>G0.947
rpsA1833596p.Ser19Ala0.947
rpsA1833604c.63C>T0.943
rpsA1833616c.75A>T0.986
rpsA1833619c.78A>C0.986
rpsA1833625c.84A>G0.975
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A0.978
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C0.982
rpsA1833802c.261A>G0.983
rpsA1833811c.270G>T0.982
rpsA1833823c.282G>A0.981
rpsA1833832c.291G>A0.982
rpsA1833838c.297G>C0.981
rpsA1833841c.300C>G0.982
rpsA1833847c.306C>G0.983
rpsA1833856c.315A>G0.983
rpsA1833862c.321G>T0.983
rpsA1833874c.333T>G0.983
rpsA1833886c.345C>G0.984
rpsA1833894p.Ala118Glu0.984
rpsA1833928c.387G>C0.985
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C0.977
rpsA1834252c.711C>G0.978
rpsA1834261c.720A>G0.981
rpsA1834264c.723G>C0.981
rpsA1834279c.738C>T0.983
rpsA1834294c.753G>T0.983
rpsA1834297c.756C>T0.984
rpsA1834303c.762T>G0.984
rpsA1834306c.765T>C0.985
rpsA1834327c.786G>T0.987
rpsA1834357c.816T>C0.987
rpsA1834366c.825A>G0.988
rpsA1834375c.834G>C0.988
rpsA1834396c.855G>C0.989
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T0.982
rpsA1834609c.1068T>C0.981
rpsA1834619c.1078T>C0.978
rpsA1834622c.1081T>A0.977
rpsA1834633c.1092A>G0.984
rpsA1834639c.1098T>C0.985
rpsA1834645c.1104C>T0.986
rpsA1834666c.1125G>C0.971
rpsA1834667p.Ala376Ser0.971
rpsA1834690c.1149T>C0.969
rpsA1834700p.Gln387Ala0.962
rpsA1834705c.1164C>G0.981
rpsA1834720c.1179C>G0.971
rpsA1834732c.1191T>C0.970
rpsA1834738c.1197A>G0.971
rpsA1834753c.1212T>C0.969
rpsA1834759c.1218A>C0.968
rpsA1834765p.Glu408Asp0.967
rpsA1834774c.1233C>T0.932
rpsA1834776p.Ala412Glu0.932
rpsA1834780c.1239A>G0.932
rpsA1834789c.1248T>C0.932
rpsA1834813c.1272G>T0.921
rpsA1834830p.Ala430Val0.912
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T0.985
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
embC4240729c.867C>G0.986
embC4240735c.873C>G0.987
embC4240741c.879C>T0.988
embC4240756c.894G>C0.989
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C0.989
embC4240826p.Ala322Ser0.989
embC4240831c.969T>G0.987
embC4240856p.Ala332Thr0.983
embC4240859p.Leu333Ile0.983
embC4240876c.1014C>T0.981
embC4240879c.1017G>T0.981
embC4240885c.1023T>C0.979
embC4240886p.Ile342Val0.979
embC4240897c.1035C>G0.976
embC4240900c.1038A>G0.974
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T0.969
embB4248233p.Leu574Val0.969
embB4248236p.Met575Leu0.971
embB4248245p.Ile578Val0.977
embB4248250c.1737C>T0.978
embB4248259p.Met582Ile0.979
embB4248275p.Thr588Ala0.979
embB4248292c.1779G>A0.979

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;