TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c221798382
Sample: 5d2c221798382

Download results

Summary
ID: 5d2c221798382
Date: Mon Jul 15 07:52:42 2019
Strain: lineage2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6202c.963C>T1.000
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C1.000
gyrB6223c.984G>C1.000
gyrB6229c.990G>A1.000
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C0.829
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T0.190
gyrB6745c.1506T>C0.976
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6766c.1527G>A0.143
gyrB6772c.1533C>G0.958
gyrB6775c.1536G>C0.938
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C0.114
gyrA7547c.246C>T0.982
gyrA7553c.252C>T0.983
gyrA7559c.258G>C0.984
gyrA7565c.264C>T0.985
gyrA7574c.273G>C0.986
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.987
gyrA7595c.294C>T0.986
gyrA7607c.306C>T0.985
gyrA7637c.336C>A0.979
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile0.929
gyrA8192c.891C>G0.929
gyrA8198c.897T>C0.929
gyrA8207c.906T>C0.929
gyrA8267c.966G>C0.967
gyrA8283p.Ile328Leu0.975
gyrA8288c.987T>C0.976
gyrA8294c.993T>C0.978
gyrA8327c.1026C>T0.981
gyrA8330c.1029C>G0.962
gyrA8339c.1038A>G0.981
gyrA8340p.Ala347Ser0.981
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T0.895
gyrA8382c.1081C>T1.000
gyrA8799p.Ala500Ser0.900
gyrA8804c.1503C>G0.500
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala0.900
gyrA8828c.1527T>C0.917
gyrA8829c.1528T>C0.917
gyrA8837c.1536C>G0.917
gyrA8840c.1539C>T0.600
gyrA8846c.1545C>T0.125
gyrA8852c.1551T>C0.938
gyrA8858c.1557T>C0.944
gyrA8870c.1569G>C0.947
gyrA8873c.1572A>G0.951
gyrA8897c.1596T>C0.956
gyrA8903c.1602T>C0.956
gyrA8915c.1614A>G0.955
gyrA8921c.1620C>T0.857
gyrA8942c.1641G>C0.969
gyrA8945c.1644G>C0.964
gyrA8946c.1645T>C0.964
gyrA8957c.1656C>T0.923
gyrA8967p.Ala556Lys0.952
gyrA8978c.1677C>T0.947
gyrA8987c.1686C>G0.900
rpoB760079c.273G>A0.933
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C0.952
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C0.977
rpoB760256c.450C>T0.974
rpoB760274p.Glu156Asp0.968
rpoB760276p.Lys157Met0.968
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser0.952
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.957
rpoB760406r.600ga>g1.000
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760514c.708C>T0.133
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760805c.999G>C0.917
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala0.960
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T0.962
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val0.968
rpoB760910c.1104C>T0.978
rpoB760916c.1110C>T0.978
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C0.964
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T0.983
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761219c.1413G>C0.985
rpoB761228c.1422C>T0.119
rpoB761234c.1428G>C1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G0.983
rpoB761258c.1452G>A0.983
rpoB761261c.1455G>C0.949
rpoB761264c.1458C>G0.949
rpoB761273c.1467T>C0.984
rpoB761318c.1512G>T0.978
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G1.000
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A0.947
rpoB761682c.1876C>T0.947
rpoB761687c.1881C>T0.941
rpoB761690c.1884G>C0.941
rpoB761693c.1887G>C0.941
rpoB761705c.1899C>A0.933
rpoB761891c.2085G>C0.895
rpoB761909c.2103T>C0.962
rpoB761912c.2106T>C0.962
rpoB761915p.Asp703Glu0.962
rpoB761916p.Asp704Asn0.962
rpoB761924c.2118G>A0.966
rpoB761930c.2124G>C0.966
rpoB761933c.2127G>C0.968
rpoB761936c.2130C>T0.969
rpoB761948c.2142G>C0.976
rpoB761954c.2148C>A0.978
rpoB761955p.Ile717Val0.978
rpoB761969c.2163G>A0.982
rpoB761990c.2184G>C0.986
rpoB762008c.2202C>T0.986
rpoB762014c.2208C>G0.986
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C0.979
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C0.986
rpoB762236c.2430G>C0.986
rpoB762245c.2439G>C0.987
rpoB762275c.2469C>T0.982
rpoB762284c.2478G>C0.979
rpoB762293c.2487T>C0.975
rpoB762296c.2490G>C0.976
rpoB762317c.2511A>G0.944
rpoB762323c.2517C>A0.939
rpoB762329c.2523G>C0.933
rpoB762404c.2598T>C0.865
rpoB762410c.2604T>G0.974
rpoB762416c.2610A>G0.974
rpoB762449c.2643C>A0.979
rpoB762452c.2646G>C0.979
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C0.975
rpoB762491c.2685T>C0.971
rpoB762509c.2703T>G0.864
rpoB762510p.Ala902Pro0.864
rpoB762515c.2709C>T0.950
rpoB762533c.2727T>C0.909
rpoB762536c.2730T>C0.909
rpoB762537c.2731T>C0.909
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G0.983
rpoB762920c.3114C>T0.983
rpoB762923c.3117C>G0.984
rpoB762929c.3123G>C0.985
rpoB762959c.3153G>C0.984
rpoB762962c.3156C>T0.984
rpoB762995c.3189G>T0.981
rpoB763031c.3225T>G0.983
rpoB763034c.3228C>G0.966
rpoB763040c.3234C>G0.966
rpoB763070c.3264T>C0.979
rpoB763082c.3276C>T0.976
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C0.973
rpoB763127c.3321G>C0.970
rpoB763136c.3330C>T0.968
rpoB763145c.3339G>A0.967
rpoB763157c.3351G>T0.952
rpoB763166c.3360A>G0.944
rpoB763172c.3366G>C0.941
rpoB763193c.3387C>G0.933
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C0.982
rpoC763492c.123G>C1.000
rpoC763528c.159G>A0.984
rpoC763531c.162G>T0.983
rpoC763546c.177A>G0.982
rpoC763570c.201G>C0.966
rpoC763594c.225C>T0.966
rpoC763633c.264T>C0.966
rpoC763657c.288G>A0.957
rpoC763660c.291T>G0.955
rpoC763666c.297G>C0.977
rpoC763669c.300C>G0.976
rpoC763675c.306C>G0.976
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C0.222
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763900c.531G>C0.967
rpoC763933c.564C>T0.969
rpoC763940p.Ala191Ser0.939
rpoC763945c.576T>C0.848
rpoC763947p.Ala193Val0.939
rpoC763951c.582G>C0.939
rpoC763960c.591T>G0.939
rpoC763969c.600C>T0.939
rpoC763987c.618C>T0.900
rpoC763991p.Ile208Leu0.895
rpoC763996c.627T>C0.895
rpoC763999c.630C>T0.895
rpoC764002c.633C>G0.895
rpoC764003p.Ala212Ser0.895
rpoC764024c.655T>C0.958
rpoC764029p.Glu220Asp0.955
rpoC764032p.Asp221Glu0.957
rpoC764040p.Ser224Thr0.969
rpoC764044c.675T>C0.970
rpoC764054c.685C>T0.971
rpoC764059c.690G>T0.971
rpoC764083c.714A>G0.971
rpoC764084p.Asn239Val0.971
rpoC764095c.726C>T0.971
rpoC764098c.729A>G1.000
rpoC764143c.774G>C0.950
rpoC764147p.Ser260Ala0.944
rpoC764150p.Ile261Val0.941
rpoC764165p.Glu266Gln0.941
rpoC764311c.942C>G0.923
rpoC764317c.948C>G0.923
rpoC764320c.951C>G0.933
rpoC764332c.963G>A0.952
rpoC764338c.969G>A0.962
rpoC764353c.984G>T0.966
rpoC764365c.996C>T0.969
rpoC764371c.1002G>C0.970
rpoC764377c.1008C>G0.971
rpoC764380c.1011G>C0.971
rpoC764387c.1018T>C0.974
rpoC764405c.1036A>C0.978
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G0.982
rpoC764510c.1141C>T0.983
rpoC764524c.1155C>G0.982
rpoC764530c.1161C>G0.982
rpoC764534c.1165C>A0.982
rpoC764539c.1170C>T0.980
rpoC764542c.1173C>T0.979
rpoC764545c.1176C>A0.979
rpoC764560c.1191T>C0.980
rpoC764575c.1206T>G0.981
rpoC764611c.1242G>T0.982
rpoC764626c.1257C>T0.981
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.966
rpoC764803c.1434C>T0.982
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.962
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C0.983
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.972
rpoC764875c.1506C>A0.972
rpoC764887c.1518G>C0.969
rpoC764888c.1519T>C0.985
rpoC764911c.1542A>G0.982
rpoC764912p.Met515Gln0.965
rpoC764932c.1563C>A0.985
rpoC764948c.1579T>C0.984
rpoC764968c.1599T>C0.984
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G0.955
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C0.941
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C0.933
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T0.929
rpoC765129p.Tyr587Phe0.929
rpoC765143p.Val592Ile0.917
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T1.000
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G1.000
rpoC766021c.2652G>C1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T0.970
rpoC766384c.3015A>G0.971
rpoC766390c.3021C>T0.971
rpoC766393c.3024C>T0.971
rpoC766408c.3039C>T0.974
rpoC766435p.Glu1022Asp0.974
rpoC766501c.3132G>C0.929
rpoC766507c.3138C>T0.929
rpoC766513c.3144C>T0.941
rpoC766522c.3153C>A0.941
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T0.969
rpoC766945c.3576A>C0.970
rpoC766963c.3594T>C0.976
rpoC766996c.3627C>T0.964
rpoC767002c.3633G>C0.965
rpoC767008c.3639G>A0.965
rpoC767023c.3654C>T0.962
rpoC767044c.3675G>C0.964
rpoC767080c.3711G>C0.962
rpoC767098c.3729T>C0.982
rpoC767104c.3735C>G0.981
rpoC767107c.3738C>T0.982
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A0.985
rpoC767203c.3834C>G0.983
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C0.985
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn0.980
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.933
rpsL781572p.Gln5Asn0.947
rpsL781586c.27C>T0.966
rpsL781595c.36T>C0.969
rpsL781608p.Ser17Ala0.971
rpsL781616c.57C>G0.977
rpsL781628c.69T>C0.978
rpsL781649c.90T>C0.980
rpsL781655c.96T>C1.000
rpsL781658c.99A>C0.980
rpsL781670c.111G>C0.979
rpsL781706c.147T>C0.973
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T0.981
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A0.947
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.983
rrs1471986r.141c>t0.983
rrs1472030r.185g>a0.968
rrs1472031r.186g>c0.967
rrs1472032r.187g>a0.935
rrs1472033r.188a>c0.967
rrs1472035r.190g>t0.967
rrs1472040r.195t>g0.967
rrs1472041r.196c>t0.967
rrs1472042r.197t>g0.967
rrs1472043r.198t>a0.967
rrs1472050r.205g>c0.969
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a0.984
rrs1472108r.263c>t1.000
rrs1472113r.268t>c0.984
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c0.982
rrs1472446r.601t>a0.964
rrs1472452r.607g>a0.963
rrs1472464r.619a>g0.963
rrs1472612r.767g>t1.000
rrs1472734r.889c>t0.984
rrs1472741r.896g>a0.985
rrs1472846r.1001c>t0.959
rrs1472847r.1002g>a0.959
rrs1472848r.1003t>c0.939
rrs1472860r.1015c>t0.962
rrs1472861r.1016g>a0.962
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.944
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473697r.40c>a0.938
rrl1473707r.50t>a0.966
rrl1473717r.60g>a0.971
rrl1473731r.74t>a0.950
rrl1473746r.89t>c0.976
rrl1473756r.99g>t0.977
rrl1473758r.101g>t0.977
rrl1473770r.113t>c0.979
rrl1473806r.149c>t0.979
rrl1473812r.155g>a0.976
rrl1473814r.157a>t0.974
rrl1473815r.158t>g0.929
rrl1473829r.172g>c0.929
rrl1473831r.174g>t0.927
rrl1473832r.175c>t0.927
rrl1473839r.182g>a0.941
rrl1473876r.219g>a0.960
rrl1473887r.230t>c0.960
rrl1473888r.231t>c0.959
rrl1473898r.241c>t0.957
rrl1473899r.242a>g0.957
rrl1473916r.259c>a0.952
rrl1473923r.266c>g0.944
rrl1473937r.280c>t0.941
rrl1473943r.286g>t0.938
rrl1473945r.288t>a0.935
rrl1473946r.289a>t0.935
rrl1473950r.293g>t1.000
rrl1474044r.387c>t0.917
rrl1474051r.394t>c0.929
rrl1474054r.397t>c0.929
rrl1474056r.399t>c0.929
rrl1474061r.404t>c0.929
rrl1474074r.417c>t0.964
rrl1474089r.432c>t0.966
rrl1474093r.436g>a0.966
rrl1474100r.443c>t0.966
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474180r.523tc>t1.000
rrl1474184r.527c>a0.980
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474290r.633ttttcctctccggagg>t1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g0.969
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g0.969
rrl1474722r.1065t>c0.970
rrl1474743r.1086t>g0.962
rrl1474760r.1103a>g0.957
rrl1474794r.1137c>t0.939
rrl1474803r.1146g>a0.941
rrl1474812r.1155g>a0.940
rrl1474830r.1173a>g0.940
rrl1474913r.1256t>c0.939
rrl1474932r.1275c>t0.938
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a0.983
rrl1475202r.1545g>c0.956
rrl1475209r.1552g>a0.952
rrl1475213r.1556c>t0.951
rrl1475220r.1563g>t0.951
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a0.967
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a0.964
rrl1475649r.1992a>g0.983
rrl1475659r.2002g>a0.983
rrl1475760r.2103ccg>c0.984
rrl1475764r.2107a>t0.982
rrl1475765r.2108a>t0.982
rrl1475975r.2318c>t0.961
rrl1475977r.2320a>g0.961
rrl1475988r.2331a>g0.949
rrl1475989r.2332t>c0.949
rrl1475993r.2336c>t0.949
rrl1475997r.2340a>t0.949
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T0.909
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp0.909
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A0.909
inhA1674912c.711G>C0.909
inhA1674915c.714C>G0.909
inhA1674942c.741T>C0.909
inhA1674949c.748C>T0.909
inhA1674954c.753G>C0.909
inhA1674957c.756G>C0.909
inhA1674963c.762G>C0.909
inhA1674966c.765T>C0.909
inhA1674975c.774C>T0.909
inhA1674977p.Tyr259Phe0.909
rpsA1833536c.-6A>C0.944
rpsA1833538c.-4CA>C0.944
rpsA1833541c.-1T>C0.944
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.978
rpsA1833734p.Ala65Ser0.978
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.981
rpsA1833832c.291G>A0.982
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T0.981
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G0.983
rpsA1833894p.Ala118Glu0.984
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A0.935
rpsA1834231c.690T>G0.967
rpsA1834234c.693G>T0.966
rpsA1834240c.699T>C0.935
rpsA1834246c.705G>T0.935
rpsA1834249c.708T>C0.969
rpsA1834252c.711C>G0.939
rpsA1834261c.720A>G0.977
rpsA1834264c.723G>C0.977
rpsA1834279c.738C>T0.959
rpsA1834294c.753G>T0.962
rpsA1834297c.756C>T0.962
rpsA1834303c.762T>G0.980
rpsA1834306c.765T>C0.943
rpsA1834327c.786G>T0.969
rpsA1834357c.816T>C0.984
rpsA1834366c.825A>G0.984
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T0.980
rpsA1834489c.948T>C0.979
rpsA1834519c.978G>C0.970
rpsA1834520p.Ala327Ser0.970
rpsA1834528c.987T>C0.970
rpsA1834534c.993C>T0.970
rpsA1834543c.1002C>G0.970
rpsA1834546c.1005T>C0.970
rpsA1834552c.1011G>T0.969
rpsA1834555c.1014T>G0.969
rpsA1834557p.Ala339Gly0.969
rpsA1834606c.1065C>T0.974
rpsA1834609c.1068T>C0.974
rpsA1834619c.1078T>C0.933
rpsA1834622c.1081T>A0.931
rpsA1834633c.1092A>G0.977
rpsA1834639c.1098T>C0.978
rpsA1834645c.1104C>T0.980
rpsA1834666c.1125G>C0.980
rpsA1834667p.Ala376Ser0.980
rpsA1834690c.1149T>C0.963
rpsA1834700p.Gln387Ala0.111
rpsA1834720c.1179C>G0.963
rpsA1834732c.1191T>C0.965
rpsA1834738c.1197A>G0.963
rpsA1834753c.1212T>C0.962
rpsA1834759c.1218A>C0.960
rpsA1834765p.Glu408Asp0.957
rpsA1834774c.1233C>T0.938
rpsA1834776p.Ala412Glu0.935
rpsA1834780c.1239A>G0.938
rpsA1834789c.1248T>C0.938
rpsA1834813c.1272G>T0.913
rpsA1834830p.Ala430Val0.895
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C0.958
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G0.923
panD4044150c.132T>G0.929
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
embC4240729c.867C>G0.963
embC4240735c.873C>G0.964
embC4240741c.879C>T0.982
embC4240756c.894G>C0.984
embC4240771c.909G>C0.977
embC4240772p.Ser304Ala0.977
embC4240778p.His306Gly0.977
embC4240781p.Ala307Ser0.977
embC4240789c.927T>C0.981
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G0.964
embB4248226c.1713G>C0.964
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala0.978
embB4248292c.1779G>A0.978

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;