TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c2604ea5c4
Sample: 5d2c2604ea5c4

Download results

Summary
ID: 5d2c2604ea5c4
Date: Mon Jul 15 08:09:41 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6655c.1416T>C0.952
gyrB6673c.1434A>C0.964
gyrB6676c.1437T>G0.967
gyrB6703c.1464G>C0.972
gyrB6706c.1467G>A0.972
gyrB6709c.1470A>G0.972
gyrB6712c.1473G>C0.973
gyrB6727c.1488G>T0.974
gyrB6728c.1489C>T0.974
gyrB6739c.1500C>T0.830
gyrB6745c.1506T>C0.979
gyrB6754c.1515C>T0.982
gyrB6763c.1524G>C0.982
gyrB6766c.1527G>A0.316
gyrB6772c.1533C>G0.945
gyrB6775c.1536G>C0.946
gyrB6793c.1554T>C0.982
gyrB6798p.Gly520Ala0.982
gyrB6808c.1569C>G0.980
gyrB6824c.1585C>T0.976
gyrB6841c.1602T>C0.974
gyrB6862c.1623C>G1.000
gyrB6865c.1626G>A0.406
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T0.981
gyrA7523c.222C>G0.984
gyrA7526c.225G>A0.983
gyrA7547c.246C>T0.988
gyrA7553c.252C>T0.988
gyrA7559c.258G>C0.989
gyrA7565c.264C>T0.989
gyrA7574c.273G>C0.989
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.990
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C0.933
gyrA8129c.828T>C0.933
gyrA8156c.855T>C0.933
gyrA8159c.858G>C0.933
gyrA8168c.867A>G0.933
gyrA8174c.873C>G0.933
gyrA8177c.876A>C0.933
gyrA8187p.Leu296Ile0.933
gyrA8192c.891C>G0.933
gyrA8198c.897T>C0.933
gyrA8207c.906T>C0.933
gyrA8267c.966G>C0.968
gyrA8283p.Ile328Leu0.970
gyrA8288c.987T>C0.971
gyrA8294c.993T>C0.977
gyrA8327c.1026C>T0.717
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T0.262
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T0.833
gyrA8576c.1275C>G0.846
gyrA8580p.Ile427Val0.867
gyrA8603c.1302A>C0.867
gyrA8609c.1308G>C0.867
gyrA8619c.1318T>C0.867
gyrA8624c.1323G>T0.867
gyrA8633c.1332C>G0.867
gyrA8636c.1335A>C0.867
gyrA8642c.1341A>G0.867
gyrA8645c.1344C>G0.867
gyrA8649p.Arg450Lys0.867
gyrA8666c.1365G>C0.867
gyrA8672c.1371A>G0.867
gyrA8693c.1392T>C0.833
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8783c.1482G>C1.000
gyrA8786c.1485T>G1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760193c.387C>G0.625
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C0.933
rpoB760307c.501T>C0.933
rpoB760357p.Thr184Ser0.960
rpoB760361c.555T>C0.926
rpoB760370c.564C>G0.968
rpoB760376p.Asp190Glu0.977
rpoB760382c.576G>C0.958
rpoB760388c.582C>T0.960
rpoB760400c.594G>C0.967
rpoB760406c.600G>C0.938
rpoB760407p.Ser201Gly0.968
rpoB760415c.609C>T0.971
rpoB760418c.612G>C0.986
rpoB760430c.624T>C0.986
rpoB760460c.654G>C0.989
rpoB760475c.669A>G0.977
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760514c.708C>T0.549
rpoB760520c.714C>T0.521
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760567p.Ser254Trp0.958
rpoB760571c.765G>C0.960
rpoB760588p.Thr261Ile0.976
rpoB760591p.Val262Ala0.976
rpoB760595c.789C>T0.976
rpoB760596p.Thr264Pro0.976
rpoB760608c.802C>T0.979
rpoB760611c.805T>C0.979
rpoB760634c.828T>C0.978
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760667c.861G>A0.452
rpoB760668p.Thr288Ala0.966
rpoB760674c.868T>C0.966
rpoB760679c.873A>G0.966
rpoB760683c.877T>C0.966
rpoB760703c.897C>T0.962
rpoB760721c.915C>G0.952
rpoB760727c.921C>G0.933
rpoB760730c.924T>C0.909
rpoB760736c.930C>G0.900
rpoB760805c.999G>C0.929
rpoB760817c.1011A>G0.944
rpoB760820c.1014T>C0.950
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760907c.1101C>T0.250
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T0.983
rpoB761165c.1359G>C0.986
rpoB761171c.1365C>T0.986
rpoB761178p.Ser458Thr0.984
rpoB761186p.Glu460Asp0.984
rpoB761189c.1383T>C0.984
rpoB761195c.1389G>C0.985
rpoB761198c.1392G>C0.985
rpoB761219c.1413G>C0.988
rpoB761228c.1422C>T0.617
rpoB761234c.1428G>C0.987
rpoB761246c.1440C>T0.263
rpoB761249c.1443A>G0.986
rpoB761255c.1449T>G0.985
rpoB761258c.1452G>A0.985
rpoB761261c.1455G>C0.985
rpoB761264c.1458C>G0.970
rpoB761273c.1467T>C0.987
rpoB761303c.1497G>C0.267
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T0.961
rpoB761339c.1533C>G1.000
rpoB761345c.1539G>C1.000
rpoB761346p.Val514Ser1.000
rpoB761354c.1548C>A1.000
rpoB761357c.1551G>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761373p.Val523His1.000
rpoB761384c.1578C>G1.000
rpoB761393c.1587G>A1.000
rpoB761414c.1608A>G0.857
rpoB761423c.1617T>C0.800
rpoB761516c.1710G>C0.955
rpoB761528c.1722C>T0.960
rpoB761531c.1725C>T0.481
rpoB761537c.1731C>G0.970
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C0.980
rpoB761573c.1767C>G0.947
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C0.967
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A0.960
rpoB761682c.1876C>T0.958
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761891c.2085G>C0.963
rpoB761909c.2103T>C0.967
rpoB761912c.2106T>C0.967
rpoB761915p.Asp703Glu0.967
rpoB761916p.Asp704Asn0.967
rpoB761924c.2118G>A0.970
rpoB761930c.2124G>C0.970
rpoB761933c.2127G>C0.970
rpoB761936c.2130C>T0.970
rpoB761948c.2142G>C0.981
rpoB761954c.2148C>A0.981
rpoB761955p.Ile717Val0.982
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A0.985
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G0.982
rpoB762114p.Ile770Val0.962
rpoB762122c.2316C>T0.960
rpoB762131c.2325C>G0.943
rpoB762134c.2328C>A0.941
rpoB762137c.2331C>T0.941
rpoB762140c.2334G>C0.941
rpoB762143c.2337T>C0.921
rpoB762149c.2343G>T0.958
rpoB762158c.2352G>C0.964
rpoB762167c.2361T>C0.964
rpoB762176c.2370T>C0.969
rpoB762185c.2379G>C0.971
rpoB762194c.2388G>C0.971
rpoB762233c.2427G>C0.970
rpoB762236c.2430G>C0.970
rpoB762242c.2436G>A0.485
rpoB762245c.2439G>C0.971
rpoB762275c.2469C>T0.982
rpoB762284c.2478G>C0.980
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C0.373
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A0.986
rpoB762452c.2646G>C0.972
rpoB762470c.2664G>C0.972
rpoB762488c.2682G>C0.962
rpoB762491c.2685T>C0.961
rpoB762509c.2703T>G0.860
rpoB762510p.Ala902Pro0.860
rpoB762515c.2709C>T0.923
rpoB762533c.2727T>C0.885
rpoB762536c.2730T>C0.875
rpoB762537c.2731T>C0.875
rpoB762551c.2745C>T0.824
rpoB762557c.2751G>A0.727
rpoB762560c.2754A>C0.700
rpoB762563c.2757G>T0.700
rpoB762827c.3021G>C0.947
rpoB762830c.3024C>G0.368
rpoB762857c.3051C>G0.969
rpoB762860c.3054G>C0.969
rpoB762863c.3057T>C0.970
rpoB762866c.3060C>T0.971
rpoB762879p.Met1025Leu0.977
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C0.982
rpoB762917c.3111C>G0.944
rpoB762920c.3114C>T0.963
rpoB762923c.3117C>G0.944
rpoB762929c.3123G>C0.966
rpoB762959c.3153G>C0.953
rpoB762962c.3156C>T0.952
rpoB762995c.3189G>T0.970
rpoB763031c.3225T>G0.985
rpoB763034c.3228C>G0.985
rpoB763040c.3234C>G0.985
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G0.975
rpoB763172c.3366G>C1.000
rpoB763193c.3387C>G1.000
rpoC763450c.81G>A0.958
rpoC763456c.87A>G0.964
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A0.983
rpoC763531c.162G>T0.983
rpoC763546c.177A>G0.982
rpoC763570c.201G>C0.984
rpoC763594c.225C>T0.986
rpoC763609c.240C>T0.586
rpoC763633c.264T>C0.986
rpoC763657c.288G>A0.984
rpoC763660c.291T>G0.983
rpoC763666c.297G>C0.965
rpoC763669c.300C>G0.982
rpoC763675c.306C>G1.000
rpoC763696c.327T>C0.425
rpoC763699c.330G>T1.000
rpoC763702c.333C>G0.973
rpoC763708c.339G>C0.971
rpoC763711c.342G>C0.471
rpoC763714c.345G>C0.971
rpoC763717c.348T>C0.971
rpoC763723c.354G>C0.971
rpoC763732c.363C>A0.970
rpoC763741c.372C>T0.966
rpoC763744c.375G>C0.964
rpoC763747c.378G>A0.958
rpoC763765c.396T>C0.947
rpoC763891c.522G>C0.900
rpoC763894c.525A>G0.917
rpoC763900c.531G>C0.947
rpoC763933c.564C>T0.975
rpoC763940p.Ala191Ser0.950
rpoC763945c.576T>C0.487
rpoC763947p.Ala193Val0.974
rpoC763951c.582G>C0.974
rpoC763960c.591T>G1.000
rpoC763969c.600C>T0.974
rpoC763987c.618C>T0.923
rpoC763991p.Ile208Leu0.905
rpoC763996c.627T>C0.952
rpoC763999c.630C>T0.905
rpoC764002c.633C>G0.905
rpoC764003p.Ala212Ser0.909
rpoC764024c.655T>C0.955
rpoC764029p.Glu220Asp0.952
rpoC764032p.Asp221Glu0.958
rpoC764040p.Ser224Thr0.970
rpoC764044c.675T>C0.971
rpoC764054c.685C>T0.974
rpoC764059c.690G>T0.977
rpoC764083c.714A>G0.978
rpoC764084p.Asn239Val0.978
rpoC764095c.726C>T0.956
rpoC764098c.729A>G0.978
rpoC764110c.741C>T0.756
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G0.917
rpoC764317c.948C>G0.933
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C0.984
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T1.000
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.970
rpoC764875c.1506C>A0.971
rpoC764887c.1518G>C0.958
rpoC764888c.1519T>C0.972
rpoC764896c.1527C>T0.333
rpoC764911c.1542A>G0.968
rpoC764912p.Met515Gln0.951
rpoC764932c.1563C>A0.973
rpoC764948c.1579T>C0.973
rpoC764968c.1599T>C0.971
rpoC765004c.1635G>C0.939
rpoC765007c.1638T>G0.939
rpoC765008c.1639T>C0.939
rpoC765011c.1642A>T0.969
rpoC765016c.1647C>G0.969
rpoC765019c.1650A>G0.969
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C0.962
rpoC765076c.1707A>G0.962
rpoC765079c.1710T>G0.958
rpoC765082c.1713G>C0.958
rpoC765085c.1716T>C0.958
rpoC765089c.1720T>C0.958
rpoC765100c.1731G>C0.958
rpoC765103c.1734G>T0.958
rpoC765121c.1752G>T0.938
rpoC765129p.Tyr587Phe0.938
rpoC765143p.Val592Ile1.000
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G0.985
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G0.982
rpoC765533p.Tyr722His0.979
rpoC765544c.2175C>G0.960
rpoC765547c.2178C>T0.957
rpoC765548c.2179A>T0.957
rpoC765553c.2184C>T0.957
rpoC765556c.2187G>C0.957
rpoC765562c.2193G>T0.957
rpoC765826c.2457T>C0.974
rpoC765835c.2466C>T0.977
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile0.984
rpoC765907c.2538G>T0.983
rpoC765910c.2541G>C0.982
rpoC765928c.2559C>G0.980
rpoC765940c.2571A>T0.978
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C0.944
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G0.923
rpoC765979c.2610C>G0.923
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T0.294
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C0.968
rpoC766570c.3201T>C0.971
rpoC766573c.3204T>G0.971
rpoC766588c.3219G>A0.471
rpoC766594c.3225G>T0.971
rpoC766607p.Ile1080Leu0.971
rpoC766618c.3249G>T0.969
rpoC766624c.3255G>C0.966
rpoC766630c.3261G>C0.960
rpoC766633c.3264G>C0.960
rpoC766645c.3276A>G0.929
rpoC766651c.3282T>C0.929
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C0.988
rpoC767080c.3711G>C0.988
rpoC767098c.3729T>C0.987
rpoC767100p.Lys1244Arg0.147
rpoC767104c.3735C>G0.986
rpoC767107c.3738C>T0.986
rpoC767119c.3750A>G0.987
rpoC767125c.3756G>C0.987
rpoC767134c.3765C>T0.988
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T0.986
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C0.986
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781805c.246G>A0.308
rpsL781814c.255C>T1.000
rpsL781817c.258G>T0.976
rpsL781829c.270G>C0.977
rpsL781832c.273T>C0.978
rpsL781859c.300T>C0.976
rpsL781868c.309T>C0.973
rpsL781871c.312G>C0.972
rpsL781877c.318T>A0.971
rpsL781892c.333A>G0.971
rpsL781898c.339A>T0.969
rpsL781907c.348T>C0.967
rpsL781916c.357T>C0.964
rpsL781929p.Gly124Ser0.952
rpsL781933374G>A0.950
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g0.952
rrs1472380r.535g>c0.964
rrs1472446r.601t>a0.964
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.957
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c0.955
rrs1472957r.1112c>t0.955
rrs1472969r.1124a>g0.957
rrs1472970r.1125c>g0.957
rrs1472977r.1132g>c0.958
rrs1472978r.1133t>c0.958
rrs1472989r.1144g>a0.963
rrs1472990r.1145a>g0.963
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c1.000
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t0.960
rrs1473166r.1321g>a0.950
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473731r.74t>a0.909
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a0.933
rrl1473814r.157a>t0.933
rrl1473815r.158t>g0.933
rrl1473829r.172g>c0.938
rrl1473831r.174g>t0.923
rrl1473832r.175c>t0.923
rrl1473839r.182g>a0.933
rrl1473876r.219g>a0.882
rrl1473887r.230t>c0.824
rrl1473888r.231t>c0.824
rrl1473898r.241c>t0.812
rrl1473899r.242a>g0.800
rrl1473916r.259c>a0.800
rrl1473923r.266c>g0.769
rrl1473937r.280c>t0.727
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.769
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474290r.633ttttcctctccggagg>t1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.967
rrl1474362r.705a>g0.966
rrl1474387r.730c>t0.960
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475443r.1786g>a0.917
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t0.933
rrl1475479r.1822c>t0.933
rrl1475480r.1823a>t0.933
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c0.952
rrl1475764r.2107a>t0.947
rrl1475765r.2108a>t0.947
rrl1475975r.2318c>t0.933
rrl1475977r.2320a>g0.933
rrl1475988r.2331a>g0.909
rrl1475989r.2332t>c0.909
rrl1475993r.2336c>t0.909
rrl1475997r.2340a>t0.909
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T0.867
inhA1674879c.678T>C0.867
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
inhA1674993c.792G>T1.000
rpsA1833536c.-6A>C0.929
rpsA1833538c.-4CA>C0.929
rpsA1833541c.-1T>C0.929
rpsA1833547c.6G>A0.952
rpsA1833589c.48A>C0.977
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T0.974
rpsA1833727c.186G>C0.974
rpsA1833733c.192C>G0.919
rpsA1833734p.Ala65Ser0.919
rpsA1833742c.201A>G0.975
rpsA1833745c.204G>C0.976
rpsA1833748c.207C>G0.976
rpsA1833760c.219C>T0.981
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A0.982
rpsA1833838c.297G>C0.980
rpsA1833841c.300C>G0.980
rpsA1833847c.306C>G0.981
rpsA1833856c.315A>G0.981
rpsA1833862c.321G>T0.981
rpsA1833874c.333T>G0.983
rpsA1833886c.345C>G0.982
rpsA1833894p.Ala118Glu0.981
rpsA1833928c.387G>C0.984
rpsA1833949c.408T>C0.982
rpsA1833961c.420C>G0.983
rpsA1833970c.429G>T0.982
rpsA1833979c.438T>C0.981
rpsA1833991c.450C>G0.982
rpsA1834000c.459G>C0.983
rpsA1834009c.468C>T0.980
rpsA1834012c.471G>C0.980
rpsA1834015c.474G>C0.982
rpsA1834021c.480C>T0.984
rpsA1834030c.489C>G0.984
rpsA1834033c.492C>T0.984
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C0.980
rpsA1834228c.687C>A0.981
rpsA1834231c.690T>G0.981
rpsA1834234c.693G>T0.981
rpsA1834240c.699T>C0.981
rpsA1834246c.705G>T0.980
rpsA1834249c.708T>C0.980
rpsA1834252c.711C>G0.961
rpsA1834261c.720A>G0.969
rpsA1834264c.723G>C0.985
rpsA1834279c.738C>T0.986
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G0.989
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.976
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C0.964
kasA2518756c.642G>C0.973
kasA2518768c.654C>G0.974
kasA2518771c.657C>G0.974
kasA2518774c.660C>T0.974
kasA2518783c.669T>G0.974
kasA2518787p.Arg225Lys0.974
kasA2518792c.678C>T0.974
kasA2518795c.681C>T0.974
kasA2518798c.684G>C0.974
kasA2518822c.708C>A0.982
kasA2518825c.711T>C0.982
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518861c.747G>A0.196
kasA2518864c.750G>C1.000
panD4044219c.63G>A0.211
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embC4240909c.1047G>C0.348
embB4248220c.1707A>G0.974
embB4248226c.1713G>C0.974
embB4248232c.1719G>T0.974
embB4248233p.Leu574Val0.974
embB4248236p.Met575Leu0.976
embB4248245p.Ile578Val0.984
embB4248250c.1737C>T0.984
embB4248259p.Met582Ile0.985
embB4248275p.Thr588Ala0.985
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;