TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c29908c26d
Sample: 5d2c29908c26d

Download results

Summary
ID: 5d2c29908c26d
Date: Mon Jul 15 08:24:39 2019
Strain: lineage4.2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.960
gyrB6115c.876A>G0.968
gyrB6121c.882C>T0.903
gyrB6127c.888G>C0.966
gyrB6133c.894G>C0.968
gyrB6136c.897G>A0.903
gyrB6151c.912C>T0.933
gyrB6172c.933C>T0.933
gyrB6184c.945C>T1.000
gyrB6193c.954G>A0.933
gyrB6196c.957C>T1.000
gyrB6655c.1416T>C0.900
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C0.875
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T0.889
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T0.907
gyrB6763c.1524G>C0.917
gyrB6772c.1533C>G0.922
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T0.913
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G0.976
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7006c.1767T>G0.778
gyrB7010p.Leu591Ile0.778
gyrB7015c.1776G>A0.778
gyrB7018c.1779G>C0.778
gyrB7024c.1785G>C1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp0.933
gyrB7060c.1821T>C0.933
gyrB7066c.1827G>T0.933
gyrB7078c.1839A>G0.933
gyrB7081c.1842T>C0.933
gyrB7084c.1845A>G0.933
gyrB7090c.1851C>T0.933
gyrB7093c.1854T>C0.933
gyrB7100c.1861T>C0.933
gyrA7418c.117C>T1.000
gyrA7433c.132G>A1.000
gyrA7442c.141G>C1.000
gyrA7457c.156T>C1.000
gyrA7463c.162G>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T0.816
gyrA7523c.222C>G0.827
gyrA7526c.225G>C1.000
gyrA7532c.231T>G0.154
gyrA7541c.240C>G0.140
gyrA7547c.246C>T1.000
gyrA7553c.252C>T0.884
gyrA7559c.258G>C0.903
gyrA7565c.264C>T1.000
gyrA7574c.273G>C0.934
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.934
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C0.900
gyrA8129c.828T>C0.900
gyrA8156c.855T>C0.909
gyrA8159c.858G>C0.818
gyrA8168c.867A>G0.909
gyrA8174c.873C>G0.909
gyrA8177c.876A>C0.909
gyrA8187p.Leu296Ile0.750
gyrA8192c.891C>G0.750
gyrA8198c.897T>C0.833
gyrA8207c.906T>C0.833
gyrA8267c.966G>C0.976
gyrA8283p.Ile328Leu0.976
gyrA8288c.987T>C0.955
gyrA8294c.993T>C0.963
gyrA8324c.1023T>C0.175
gyrA8327c.1026C>G0.175
gyrA8330c.1029C>G0.804
gyrA8339c.1038A>G0.980
gyrA8340p.Ala347Ser0.980
gyrA8354c.1053G>C0.978
gyrA8366c.1065G>C0.171
gyrA8372c.1071G>T0.973
gyrA8382c.1081C>T0.765
gyrA8535p.Glu412Gln1.000
gyrA8546p.Asp415Glu1.000
gyrA8561c.1260A>C1.000
gyrA8571c.1270C>T1.000
gyrA8603c.1302A>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T1.000
gyrA8846c.1545C>T0.897
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A0.964
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A0.968
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.885
rpoB760274p.Glu156Asp0.884
rpoB760276p.Lys157Met0.881
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C0.900
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G0.808
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C0.821
rpoB760388c.582C>T0.833
rpoB760400c.594G>C0.825
rpoB760406c.600G>C0.886
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C0.860
rpoB760424c.618C>G0.140
rpoB760430c.624T>C1.000
rpoB760433c.627C>T0.145
rpoB760457c.651C>T0.134
rpoB760460c.654G>C0.873
rpoB760463c.657C>T0.127
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760585p.Asn260Ser0.195
rpoB760588p.Thr261Ile0.805
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T0.795
rpoB760611c.805T>C1.000
rpoB760634c.828T>C0.740
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G0.318
rpoB760668p.Thr288Ala0.641
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760724c.918T>C0.385
rpoB760727c.921C>G0.565
rpoB760730c.924T>C1.000
rpoB760736c.930C>G0.529
rpoB760793c.987A>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala0.875
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T0.875
rpoB760883c.1077G>C0.108
rpoB760886p.Glu360Asp0.108
rpoB760887p.Thr361Val1.000
rpoB760907c.1101C>T0.868
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T0.909
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T0.167
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G0.842
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761111c.1305C>T0.122
rpoB761132c.1326G>C0.981
rpoB761133c.1327T>C0.983
rpoB761147c.1341C>T0.984
rpoB761150c.1344A>T0.985
rpoB761165c.1359G>C0.985
rpoB761171c.1365C>T0.875
rpoB761178p.Ser458Thr0.839
rpoB761186p.Glu460Asp0.833
rpoB761189c.1383T>C0.981
rpoB761195c.1389G>C0.982
rpoB761198c.1392G>C0.127
rpoB761213c.1407G>C0.119
rpoB761217p.Pro471Ser0.115
rpoB761234c.1428G>C0.984
rpoB761246c.1440C>T0.771
rpoB761249c.1443A>G0.978
rpoB761255c.1449T>G0.795
rpoB761258c.1452G>A0.786
rpoB761261c.1455G>C0.195
rpoB761264c.1458C>G0.976
rpoB761273c.1467T>C0.836
rpoB761282c.1476C>T0.170
rpoB761288c.1482G>T0.170
rpoB761303c.1497G>C0.800
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G0.974
rpoB761330c.1524G>C0.211
rpoB761333c.1527G>T0.757
rpoB761339c.1533C>G0.778
rpoB761345c.1539G>C0.917
rpoB761346p.Val514Ser0.333
rpoB761354c.1548C>T0.333
rpoB761357c.1551G>T0.333
rpoB761360c.1554T>C0.909
rpoB761362p.Ser519Thr0.909
rpoB761367p.Glu521Gln0.545
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T0.808
rpoB761531c.1725C>T0.786
rpoB761537c.1731C>G1.000
rpoB761552c.1746G>C0.231
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C0.762
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.980
rpoB761579c.1773G>C1.000
rpoB761606c.1800C>G0.151
rpoB761612c.1806G>T0.972
rpoB761615c.1809A>C0.971
rpoB761636c.1830G>T0.969
rpoB761645c.1839C>G0.967
rpoB761648c.1842T>C0.213
rpoB761657c.1851C>T0.772
rpoB761666c.1860G>C0.932
rpoB761669c.1863C>T0.930
rpoB761675c.1869G>T0.929
rpoB761681c.1875G>A0.718
rpoB761682c.1876C>T0.947
rpoB761687c.1881C>T0.757
rpoB761690c.1884G>C0.946
rpoB761693c.1887G>C0.757
rpoB761705c.1899C>A0.818
rpoB761885c.2079T>C0.227
rpoB761891c.2085G>C0.920
rpoB761892p.Ile696Val0.120
rpoB761906c.2100C>G0.192
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761921c.2115C>T0.125
rpoB761924c.2118G>A0.743
rpoB761930c.2124G>C0.947
rpoB761933c.2127G>C0.718
rpoB761936c.2130C>T0.732
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A0.189
rpoB761955p.Ile717Val0.818
rpoB761969c.2163G>A0.983
rpoB761990c.2184G>C0.814
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G0.156
rpoB762038c.2232C>T0.812
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A0.846
rpoB762065c.2259T>G0.209
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T0.782
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A0.667
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T0.217
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C0.849
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C0.863
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T0.818
rpoB762284c.2478G>C0.190
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C0.750
rpoB762308c.2502G>C0.235
rpoB762314c.2508C>T0.258
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A0.692
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G0.120
rpoB762416c.2610A>G1.000
rpoB762434c.2628T>C0.148
rpoB762443c.2637G>C0.161
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C0.778
rpoB762491c.2685T>C1.000
rpoB762507c.2702 2702del1.000
rpoC763375c.6C>A0.529
rpoC763402c.33C>T0.400
rpoC763408c.39T>C0.947
rpoC763411c.42T>C0.944
rpoC763414c.45T>C0.444
rpoC763415p.Thr16Ser0.444
rpoC763423p.Glu18Asp0.444
rpoC763430c.61A>C0.938
rpoC763433p.Gln22Asn0.938
rpoC763443p.Tyr25Phe0.944
rpoC763450c.81G>A0.778
rpoC763456c.87A>G0.978
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C0.182
rpoC763528c.159G>A0.962
rpoC763531c.162G>T0.846
rpoC763546c.177A>G0.962
rpoC763570c.201G>C0.971
rpoC763594c.225C>T0.986
rpoC763603c.234C>T0.113
rpoC763633c.264T>C0.964
rpoC763657c.288G>A0.786
rpoC763660c.291T>G0.951
rpoC763666c.297G>C0.179
rpoC763669c.300C>G0.757
rpoC763675c.306C>G0.944
rpoC763699c.330G>T0.545
rpoC763702c.333C>G0.950
rpoC763705c.336G>A0.350
rpoC763708c.339G>C0.579
rpoC763709p.Leu114Phe0.368
rpoC763714c.345G>C0.944
rpoC763717c.348T>C0.947
rpoC763723c.354G>C0.950
rpoC763732c.363C>A0.476
rpoC763741c.372C>T0.941
rpoC763744c.375G>C0.294
rpoC763747c.378G>A0.941
rpoC763765c.396T>G0.312
rpoC763774c.405G>C0.214
rpoC763781p.Ser138Ala0.200
rpoC763792p.Glu141Asp1.000
rpoC763879c.510A>G0.900
rpoC763882c.513G>A0.167
rpoC763888c.519G>T0.769
rpoC763891c.522G>C0.923
rpoC763894c.525A>G0.923
rpoC763900c.531G>C0.968
rpoC763933c.564C>T0.969
rpoC763940p.Ala191Ser0.969
rpoC763945c.576T>C0.969
rpoC763947p.Ala193Val0.969
rpoC763951c.582G>C0.969
rpoC763960c.591T>G0.969
rpoC763969c.600C>T0.969
rpoC763987c.618C>T0.952
rpoC763991p.Ile208Leu0.944
rpoC763996c.627T>C0.941
rpoC763999c.630C>T0.941
rpoC764002c.633C>G0.941
rpoC764003p.Ala212Ser0.941
rpoC764024c.655T>C0.958
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T0.970
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T0.973
rpoC764098c.729A>G1.000
rpoC764143c.774G>C0.964
rpoC764147p.Ser260Ala0.960
rpoC764150p.Ile261Val0.960
rpoC764165p.Glu266Gln0.955
rpoC764227c.858G>C0.700
rpoC764239c.870T>G0.727
rpoC764242c.873C>T0.273
rpoC764254c.885G>T1.000
rpoC764257c.888G>C0.833
rpoC764263c.894G>T0.833
rpoC764266c.897T>C0.167
rpoC764272c.903G>C0.875
rpoC764278c.909A>G1.000
rpoC764293c.924G>C1.000
rpoC764297p.Met310Leu1.000
rpoC764311c.942C>G0.484
rpoC764317c.948C>G0.528
rpoC764320c.951C>G0.513
rpoC764338c.969G>A0.561
rpoC764344c.975C>T0.395
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G0.679
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C0.778
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764446c.1077T>C0.190
rpoC764449c.1080G>C0.190
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764485c.1116G>C0.186
rpoC764491c.1122G>T0.194
rpoC764497c.1128A>G0.984
rpoC764500c.1131C>G0.200
rpoC764510c.1141C>T0.767
rpoC764521c.1152T>C0.228
rpoC764524c.1155C>G0.750
rpoC764527c.1158C>T0.218
rpoC764530c.1161C>G0.755
rpoC764534p.Arg389Ser0.731
rpoC764539c.1170C>T0.235
rpoC764542c.1173C>T0.740
rpoC764545c.1176C>A0.740
rpoC764560c.1191T>C0.759
rpoC764575c.1206T>G0.982
rpoC764605c.1236G>C0.233
rpoC764611c.1242G>T0.983
rpoC764623c.1254C>G0.211
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T0.823
rpoC764692c.1323C>T0.806
rpoC764701c.1332C>G0.164
rpoC764713c.1344G>T0.984
rpoC764716c.1347G>C0.984
rpoC764746c.1377G>T0.984
rpoC764752c.1383G>C0.985
rpoC764758c.1389C>G0.984
rpoC764764c.1395T>C0.984
rpoC764791c.1422C>G0.800
rpoC764803c.1434C>T0.967
rpoC764809c.1440C>T0.962
rpoC764810p.Pro481Ala0.792
rpoC764815c.1446A>G0.961
rpoC764824c.1455T>C0.965
rpoC764827c.1458G>C0.982
rpoC764851c.1482C>T0.153
rpoC764858c.1489T>C0.982
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A0.155
rpoC764878c.1509C>G0.153
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764896c.1527C>T0.860
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764935c.1566T>C0.147
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C0.679
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G0.208
rpoC765019c.1650A>G0.800
rpoC765022c.1653G>T0.152
rpoC765034c.1665T>C0.152
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765361c.1992C>G0.400
rpoC765370c.2001G>C0.692
rpoC765379c.2010G>C0.692
rpoC765382c.2013G>T0.692
rpoC765383p.Met672Leu1.000
rpoC765400c.2031G>C0.121
rpoC765403c.2034G>C1.000
rpoC765404p.Leu679Asn0.121
rpoC765409c.2040T>G0.111
rpoC765421c.2052C>G0.875
rpoC765449p.Ala694Ser0.883
rpoC765454c.2085C>G0.967
rpoC765469c.2100G>C0.890
rpoC765478c.2109T>G0.968
rpoC765480p.Tyr704Phe0.970
rpoC765499c.2130C>G0.971
rpoC765517c.2148C>G0.909
rpoC765533p.Tyr722His0.963
rpoC765544c.2175C>G0.760
rpoC765547c.2178C>T0.750
rpoC765548c.2179A>T0.913
rpoC765553c.2184C>T0.917
rpoC765556c.2187G>C0.917
rpoC765562c.2193G>T0.125
rpoC765577c.2208G>T0.130
rpoC765823c.2454C>A0.138
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T0.800
rpoC765861p.Phe831Tyr0.795
rpoC765871c.2502T>C0.191
rpoC765875p.Val836Ile1.000
rpoC765886c.2517C>G0.148
rpoC765904c.2535C>G0.180
rpoC765907c.2538G>T0.800
rpoC765908p.Leu847Phe0.212
rpoC765928c.2559C>G0.745
rpoC765934c.2565C>T0.239
rpoC765940c.2571A>T0.977
rpoC765946c.2577C>T0.189
rpoC765947c.2578T>C0.973
rpoC765952c.2583G>C0.219
rpoC765961c.2592G>T0.233
rpoC765962c.2593T>C0.957
rpoC765967c.2598C>T0.957
rpoC765973c.2604C>G0.714
rpoC765979c.2610C>G0.952
rpoC765982c.2613C>T0.950
rpoC765994c.2625A>T0.944
rpoC766003c.2634G>C0.765
rpoC766009c.2640G>C0.733
rpoC766012c.2643C>G0.929
rpoC766021c.2652G>C0.846
rpoC766321c.2952C>G0.783
rpoC766333c.2964G>C0.800
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G0.800
rpoC766353p.Val995Ala0.800
rpoC766363c.2994G>C0.119
rpoC766369c.3000C>G0.896
rpoC766375c.3006C>G0.896
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T0.925
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C0.960
rpoC766633c.3264G>C0.952
rpoC766645c.3276A>G0.938
rpoC766651c.3282T>C0.938
rpoC766777c.3408C>G0.154
rpoC766792c.3423C>G0.750
rpoC766798c.3429C>G0.214
rpoC766799p.Ala1144Ser0.750
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G0.192
rpoC766846c.3477C>A0.160
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser0.974
rpoC766942c.3573C>T0.977
rpoC766945c.3576A>C0.977
rpoC766963c.3594T>C0.983
rpoC766996c.3627C>T0.987
rpoC767002c.3633G>C0.987
rpoC767008c.3639G>A0.987
rpoC767020c.3651C>G0.107
rpoC767023c.3654C>T0.986
rpoC767044c.3675G>C0.833
rpoC767080c.3711G>C0.776
rpoC767098c.3729T>C0.947
rpoC767100p.Lys1244Arg0.759
rpoC767104c.3735C>G0.948
rpoC767105p.Asn1246His0.155
rpoC767119c.3750A>G0.957
rpoC767125c.3756G>C0.797
rpoC767134c.3765C>T0.949
rpoC767138c.3769C>T0.947
rpoC767149c.3780C>T0.833
rpoC767158c.3789T>C0.964
rpoC767179c.3810C>T0.852
rpoC767180p.Ala1271Ser0.945
rpoC767191c.3822C>G0.969
rpoC767197c.3828G>A0.968
rpoC767203c.3834C>G0.828
rpoC767206c.3837C>G0.825
rpoC767209c.3840T>C0.842
rpoC767212c.3843G>C0.850
rpoC767221c.3852C>G0.986
rpoC767230c.3861G>C0.986
rpoC767233c.3864T>C0.986
rpoC767254c.3885G>C0.900
rpoC767264p.Ala1299Ser0.977
rpoC767267p.Ala1300Asn0.977
rpoC767281c.3912C>G0.976
rpoC767284c.3915C>G0.976
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T0.912
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G0.933
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C0.154
rpsL781670c.111G>C0.796
rpsL781682c.123T>C0.205
rpsL781706c.147T>C0.703
rpsL781709c.150G>C0.297
rpsL781715c.156T>G0.303
rpsL781751c.192G>C1.000
rpsL781760c.201T>C1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C0.733
rpsL781805c.246G>A0.723
rpsL781808c.249C>T0.235
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781838c.279G>C0.186
rpsL781841c.282C>T0.172
rpsL781859c.300T>C0.170
rpsL781865c.306G>C0.163
rpsL781868c.309T>C0.979
rpsL781871c.312G>C1.000
rpsL781877c.318T>A0.822
rpsL781892c.333A>G1.000
rpsL781898c.339A>T0.233
rpsL781901c.342C>T0.233
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933c.374G>A0.688
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g0.983
rrs1471985r.140t>c0.700
rrs1471986r.141c>t1.000
rrs1472019r.174g>a0.277
rrs1472023r.178g>t0.281
rrs1472030r.185g>a0.575
rrs1472031r.186g>c1.000
rrs1472032r.187g>a0.657
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a0.575
rrs1472050r.205g>c0.575
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472075r.230a>g0.309
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c0.739
rrs1472150r.305t>a0.985
rrs1472251r.406g>a0.966
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a0.964
rrs1472452r.607g>a0.964
rrs1472464r.619a>g0.968
rrs1472612r.767g>t0.557
rrs1472734r.889c>t0.608
rrs1472741r.896g>a0.657
rrs1472846r.1001c>a0.209
rrs1472847r.1002g>c0.209
rrs1472848r.1003t>c0.791
rrs1472849r.1004c>g0.191
rrs1472850r.1005t>c0.191
rrs1472857r.1012a>g0.188
rrs1472858r.1013g>t0.188
rrs1472860r.1015c>g0.188
rrs1472861r.1016g>t0.188
rrs1472956r.1111t>c0.698
rrs1472957r.1112c>t0.698
rrs1472969r.1124a>g0.654
rrs1472970r.1125c>g0.647
rrs1472973r.1128a>t0.320
rrs1472977r.1132g>c0.647
rrs1472978r.1133t>c0.647
rrs1472989r.1144g>a0.645
rrs1472990r.1145a>g0.651
rrs1473082r.1237g>a0.694
rrs1473088r.1243a>g0.703
rrs1473099r.1254t>a0.604
rrs1473104r.1259c>t0.980
rrs1473105r.1260g>a0.608
rrs1473110r.1265t>g0.980
rrs1473111r.1266a>g0.981
rrs1473121r.1276t>c0.651
rrs1473123r.1278a>c0.237
rrs1473129r.1284c>t0.750
rrs1473145r.1300c>t0.783
rrs1473166r.1321g>a0.785
rrs1473276r.1431a>g0.242
rrs1473288r.1443c>t0.754
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t0.782
rrs1473301r.1456t>c0.242
rrl1473668r.11c>t1.000
rrl1473684r.27g>a0.483
rrl1473696r.39t>c0.533
rrl1473697r.40c>a0.467
rrl1473699r.42a>g0.533
rrl1473707r.50t>a0.488
rrl1473717r.60g>t0.500
rrl1473731r.74t>a0.472
rrl1473746r.89t>c0.982
rrl1473756r.99g>t0.475
rrl1473758r.101g>t0.984
rrl1473770r.113t>g0.446
rrl1473788r.131a>g0.382
rrl1473806r.149c>t0.979
rrl1473807r.150t>c0.277
rrl1473812r.155g>a0.641
rrl1473814r.157a>t0.641
rrl1473815r.158t>g0.964
rrl1473823r.166t>c0.283
rrl1473829r.172g>t0.302
rrl1473830r.173t>g0.310
rrl1473831r.174g>t0.976
rrl1473832r.175c>a0.302
rrl1473839r.182g>a0.621
rrl1473876r.219g>a0.982
rrl1473887r.230t>a0.220
rrl1473888r.231t>c0.760
rrl1473898r.241c>t0.978
rrl1473899r.242a>g0.978
rrl1473916r.259c>a0.975
rrl1473922r.265a>g0.167
rrl1473923r.266c>g0.970
rrl1473935r.278c>t0.182
rrl1473937r.280c>t0.969
rrl1473943r.286g>t0.966
rrl1473945r.288t>a0.966
rrl1473946r.289a>t0.966
rrl1473950r.293g>t0.759
rrl1474044r.387c>t0.909
rrl1474045r.388c>t0.455
rrl1474051r.394t>c0.417
rrl1474053r.396g>a0.417
rrl1474054r.397t>c0.917
rrl1474056r.399t>c0.500
rrl1474061r.404t>c0.562
rrl1474074r.417c>t0.682
rrl1474083r.426c>t0.273
rrl1474089r.432c>t0.682
rrl1474091r.434c>t0.273
rrl1474093r.436g>a0.955
rrl1474096r.439c>t0.273
rrl1474099r.442g>a0.273
rrl1474100r.443c>t0.682
rrl1474103r.446a>c0.938
rrl1474108r.451c>g0.273
rrl1474130r.473c>t0.614
rrl1474135r.478g>a0.408
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474174r.517a>g0.339
rrl1474181r.524c>t0.316
rrl1474183r.526t>c0.315
rrl1474184r.527c>a0.685
rrl1474185r.528g>a0.315
rrl1474186r.529a>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.655
rrl1474266r.609t>c0.340
rrl1474269r.612c>t0.340
rrl1474282r.625g>a0.717
rrl1474289r.632c>t0.158
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.783
rrl1474362r.705a>g1.000
rrl1474387r.730c>t0.761
rrl1474413r.756a>c0.892
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.886
rrl1474446r.789c>t0.274
rrl1474496r.839c>g0.671
rrl1474497r.840g>c0.662
rrl1474506r.849c>g0.638
rrl1474507r.850g>c0.638
rrl1474626r.969t>c0.980
rrl1474627r.970g>a0.224
rrl1474629r.972g>a0.234
rrl1474632r.975g>t0.978
rrl1474636r.979a>t0.977
rrl1474637r.980c>t0.977
rrl1474638r.981c>g0.977
rrl1474639r.982g>t1.000
rrl1474640r.983c>t0.977
rrl1474673r.1016t>c0.292
rrl1474676r.1019t>a0.286
rrl1474677r.1020a>g0.286
rrl1474710r.1053t>a0.286
rrl1474711r.1054g>c1.000
rrl1474712r.1055g>a1.000
rrl1474713r.1056t>a1.000
rrl1474717r.1060a>g1.000
rrl1474720r.1063c>t0.273
rrl1474722r.1065t>c0.681
rrl1474743r.1086t>g0.750
rrl1474753r.1096a>g0.246
rrl1474760r.1103a>g0.986
rrl1474794r.1137c>t0.985
rrl1474803r.1146g>a0.986
rrl1474812r.1155g>a0.986
rrl1474830r.1173a>g0.986
rrl1474913r.1256t>c0.678
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>t0.211
rrl1475061r.1404c>a0.241
rrl1475061r.1404ca>c0.759
rrl1475062r.1405a>t1.000
rrl1475076r.1419c>a0.719
rrl1475090r.1433a>t0.754
rrl1475114r.1457c>t0.737
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a0.758
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475419r.1762c>t0.636
rrl1475429r.1772g>a0.395
rrl1475443r.1786g>a0.405
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t0.467
rrl1475479r.1822c>t0.465
rrl1475480r.1823a>t0.477
rrl1475483r.1826c>t0.489
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475544r.1887a>t0.367
rrl1475545r.1888t>g0.367
rrl1475573r.1916g>a0.553
rrl1475649r.1992a>g0.688
rrl1475659r.2002g>a1.000
rrl1475753r.2096c>t0.299
rrl1475760r.2103ccg>c0.773
rrl1475762r.2105g>t1.000
rrl1475763r.2106c>t0.266
rrl1475764r.2107a>c0.266
rrl1475765r.2108a>g0.273
rrl1475775r.2118g>a0.287
rrl1475975r.2318c>t0.683
rrl1475977r.2320a>g0.683
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c0.633
rrl1475991r.2334t>c0.377
rrl1475993r.2336c>t0.623
rrl1475995r.2338g>a0.377
rrl1475997r.2340a>t0.623
rrl1476030r.2373a>g0.933
rrl1476032r.2375c>a1.000
rrl1476033r.2376t>g1.000
rrl1476035r.2378g>c1.000
rrl1476044r.2387t>g1.000
rrl1476046r.2389g>t1.000
rrl1476047r.2390g>t1.000
rrl1476049r.2392c>t1.000
rrl1476056r.2399g>a0.176
rrl1476058r.2401t>c0.263
rrl1476085r.2428g>a0.471
rrl1476086r.2429g>a0.485
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c0.516
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t0.984
rrl1476215r.2558c>t0.984
rrl1476221r.2564t>c0.607
rrl1476224r.2567a>g0.984
rrl1476251r.2594t>g0.290
rrl1476256r.2599a>t0.271
rrl1476260r.2603a>g0.305
rrl1476281r.2624t>c0.984
rrl1476297r.2640c>t0.981
rrl1476299r.2642c>t0.982
rrl1476529r.2872a>g0.328
rrl1476540r.2883c>t0.315
rrl1476583r.2926g>a0.290
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g0.681
rrl1476619r.2962c>t0.671
rrl1476628r.2971t>a1.000
rrl1476664r.3007t>c0.283
rrl1476665r.3008t>c0.300
rrl1476666r.3009c>t0.700
rrl1476674r.3017t>c1.000
rrl1476679r.3022t>c0.311
rrl1476684r.3027c>t0.176
rrl1476689r.3032a>t1.000
rrl1476690r.3033c>t1.000
rrl1476693r.3036g>a1.000
rrl1476695r.3038t>a1.000
inhA1674876c.675C>T0.947
inhA1674879c.678T>C0.421
inhA1674892p.Asn231Asp0.526
inhA1674903c.702T>C0.526
inhA1674904p.Ala235Pro0.895
inhA1674909c.708G>A0.526
inhA1674912c.711G>C0.526
inhA1674915c.714C>G0.526
inhA1674924c.723G>T0.421
inhA1674930c.729C>T0.421
inhA1674934c.733C>T0.389
inhA1674942c.741T>C0.941
inhA1674949c.748C>T0.154
inhA1674954c.753G>C0.923
inhA1674957c.756G>C0.923
inhA1674963c.762G>C0.154
inhA1674966c.765T>C0.923
inhA1674967p.Asp256Thr0.154
inhA1674975c.774C>T0.769
inhA1674977p.Tyr259Phe0.769
rpsA1833536c.-6A>C0.944
rpsA1833538c.-4CA>C0.952
rpsA1833541c.-1T>C0.952
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T0.895
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G0.902
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G0.979
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A0.900
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T0.125
rpsA1833700c.159C>T0.884
rpsA1833709c.168C>T0.914
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833730c.189C>T0.107
rpsA1833733c.192C>G0.107
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G0.883
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G0.881
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833793c.252C>T0.119
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.893
rpsA1833829c.288A>G0.123
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C0.981
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G0.877
rpsA1833886c.345C>G0.852
rpsA1833894p.Ala118Glu1.000
rpsA1833904c.363G>A0.161
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G0.873
rpsA1833970c.429G>T1.000
rpsA1833976c.435C>T0.113
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G0.133
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C0.141
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T0.891
rpsA1834073p.Lys178Arg0.849
rpsA1834096c.555G>C0.840
rpsA1834097p.Ser186Arg0.143
rpsA1834102c.561T>C0.170
rpsA1834108c.567C>G0.795
rpsA1834114c.573G>C0.805
rpsA1834177c.636A>C0.976
rpsA1834189c.648G>C0.152
rpsA1834213c.672G>C0.140
rpsA1834228c.687C>A0.816
rpsA1834231c.690T>G0.809
rpsA1834234c.693G>T0.191
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T0.178
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T0.875
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T0.873
rpsA1834345c.804C>T0.104
rpsA1834348c.807T>C0.103
rpsA1834357c.816T>C0.871
rpsA1834361c.820T>C0.127
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C0.882
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G0.203
rpsA1834414c.873C>T0.797
rpsA1834417c.876G>C0.797
rpsA1834420c.879C>T0.806
rpsA1834423c.882G>C0.186
rpsA1834429c.888C>T0.816
rpsA1834438c.897C>T0.818
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T0.824
rpsA1834489c.948T>C0.971
rpsA1834513c.972C>G0.188
rpsA1834519c.978G>C0.750
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.731
rpsA1834540c.999G>C0.191
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T0.795
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly0.795
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T0.764
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.750
rpsA1834705c.1164C>G0.762
rpsA1834720c.1179C>G0.804
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834756c.1215G>A0.156
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T0.129
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T0.957
rpsA1834830p.Ala430Val1.000
kasA2518732c.618C>G0.222
kasA2518738c.624G>C0.714
kasA2518747c.633C>G0.306
kasA2518756c.642G>C1.000
kasA2518768c.654C>G0.732
kasA2518771c.657C>A0.718
kasA2518774c.660C>T0.732
kasA2518780p.Glu222Asp0.250
kasA2518783c.669T>G0.250
kasA2518785p.Glu224Ala0.250
kasA2518787p.Arg225Asn0.250
kasA2518792c.678C>T0.250
kasA2518795c.681C>T1.000
kasA2518798c.684G>C0.652
kasA2518813c.699C>T0.250
kasA2518816c.702C>T0.260
kasA2518822c.708C>A0.730
kasA2518825c.711T>C1.000
kasA2518843c.729T>C0.315
kasA2518846c.732G>T0.672
kasA2518847p.Leu245Ile0.328
kasA2518853p.Leu247Val0.318
kasA2518864c.750G>C1.000
kasA2518877p.Lys255Leu0.264
kasA2518898c.784T>C1.000
kasA2518903c.789C>T1.000
kasA2518906c.792A>G1.000
kasA2518907c.793T>C1.000
kasA2518910p.Leu266Met1.000
thyX3067334c.612G>T0.818
thyX3067340c.606C>T0.818
thyX3067346c.600G>C0.818
thyX3067349c.597C>G0.833
thyX3067355c.591T>C0.833
thyX3067376c.570C>G0.833
thyX3067403c.543G>C0.909
thyX3067406c.540T>C0.909
thyX3067415c.531G>A0.909
thyX3067423c.523G>A0.900
thyX3067424c.522C>T0.900
thyX3067427c.519C>G0.900
thyX3067430c.516G>C0.900
thyX3067436c.510G>C0.900
thyX3067442c.504G>C0.900
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240717c.855T>C0.114
embC4240729c.867C>G0.795
embC4240735c.873C>G0.804
embC4240741c.879C>T0.816
embC4240756c.894G>C0.789
embC4240768c.906G>A0.211
embC4240771c.909G>C0.750
embC4240772p.Ser304Ala0.745
embC4240777c.915G>A0.239
embC4240778p.His306Gly0.756
embC4240781p.Ala307Ser0.756
embC4240786c.924C>T0.196
embC4240789c.927T>C1.000
embC4240819c.957A>C0.984
embC4240826p.Ala322Ser0.763
embC4240831c.969T>G0.982
embC4240856p.Ala332Thr0.711
embC4240859p.Leu333Ile0.711
embC4240876c.1014C>T0.964
embC4240879c.1017G>T0.962
embC4240885c.1023T>C0.958
embC4240886p.Ile342Val0.958
embC4240897c.1035C>G0.952
embC4240900c.1038A>G0.947
embB4247449c.936C>T1.000
embB4247464c.951C>G1.000
embB4247470c.957T>C1.000
embB4247491c.978G>C1.000
embB4247497c.984T>C1.000
embB4247511p.Tyr333Phe1.000
embB4247527c.1014G>C1.000
embB4247536c.1023C>G1.000
embB4248206p.Ser565Gly1.000
embB4248220c.1707A>G1.000
embB4248225p.Ala571Val0.464
embB4248232c.1719G>T0.517
embB4248233p.Leu574Val0.483
embB4248236p.Met575Leu0.533
embB4248242p.Val577Ile0.417
embB4248245p.Ile578Val0.583
embB4248250c.1737C>T0.595
embB4248252p.Gly580Ala0.405
embB4248259p.Met582Ile0.595
embB4248264p.Phe584Cys0.436
embB4248275p.Thr588Ala0.564
embB4248292c.1779G>A0.564
embB4248304c.1791G>C0.405
embB4248317p.Val602Leu0.188
embB4248322c.1809G>T1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;