TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c372b205ba
Sample: 5d2c372b205ba

Download results

Summary
ID: 5d2c372b205ba
Date: Mon Jul 15 09:23:02 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6086p.Thr283Pro0.947
gyrB6097c.858G>A0.792
gyrB6100c.861G>C0.160
gyrB6109c.870G>C0.808
gyrB6115c.876A>G0.962
gyrB6121c.882C>T0.154
gyrB6123p.Ala295Gly0.808
gyrB6127c.888G>T0.160
gyrB6130c.891T>C0.840
gyrB6133c.894G>C1.000
gyrB6136c.897G>A0.160
gyrB6151c.912C>T0.154
gyrB6172c.933C>T0.154
gyrB6175c.936G>A0.769
gyrB6181c.942C>A0.714
gyrB6184c.945C>T0.905
gyrB6196c.957C>T0.875
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C0.312
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6745c.1506T>C1.000
gyrB6751c.1512G>C0.808
gyrB6754c.1515C>T0.192
gyrB6760c.1521G>C0.808
gyrB6763c.1524G>C0.192
gyrB6769c.1530C>T0.808
gyrB6772c.1533C>G0.192
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C0.962
gyrB6797p.Gly520Thr0.808
gyrB6808c.1569C>T0.185
gyrB6811c.1572C>T0.778
gyrB6824c.1585C>T0.120
gyrB6838c.1599C>G0.800
gyrB6841c.1602T>C0.941
gyrB6844c.1605T>G0.750
gyrB6853c.1614A>G0.714
gyrB6856c.1617T>C0.714
gyrB6859c.1620T>C0.714
gyrB6862c.1623C>G0.214
gyrB6955c.1716G>A1.000
gyrB6970p.Asp577Glu1.000
gyrB6982c.1743A>C1.000
gyrB7012c.1773G>C0.913
gyrB7108c.1869G>A0.800
gyrB7123c.1884C>G1.000
gyrB7126c.1887G>A1.000
gyrB7129c.1890T>G1.000
gyrB7132c.1893T>G1.000
gyrB7153c.1914G>T1.000
gyrB7156c.1917C>T1.000
gyrB7159c.1920C>T1.000
gyrB7162c.1923C>T1.000
gyrB7165c.1926C>T1.000
gyrB7168c.1929C>G1.000
gyrB7178c.1939T>C1.000
gyrB7210p.Asp657Glu1.000
gyrB7213c.1974G>A1.000
gyrB7225c.1986T>C0.967
gyrB7234c.1995C>T0.963
gyrB7243c.2004G>A0.960
gyrB7246c.2007T>C0.957
gyrA7343c.42G>T0.933
gyrA7355c.54T>C0.957
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7406c.105G>C1.000
gyrA7412c.111C>G1.000
gyrA7418c.117C>T1.000
gyrA7433c.132G>A1.000
gyrA7442c.141G>C1.000
gyrA7457c.156T>C1.000
gyrA7463c.162G>C1.000
gyrA7472c.171T>C1.000
gyrA7475c.174A>G1.000
gyrA7480p.Phe60Tyr1.000
gyrA7484c.183T>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T0.141
gyrA7523c.222C>G0.150
gyrA7526c.225G>C1.000
gyrA7532c.231T>G0.842
gyrA7541c.240C>G0.830
gyrA7547c.246C>T1.000
gyrA7553c.252C>T0.192
gyrA7559c.258G>C0.212
gyrA7565c.264C>T1.000
gyrA7569p.Ala90Ser0.760
gyrA7574c.273G>C0.260
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.333
gyrA7592c.291G>C0.694
gyrA7595c.294C>G0.306
gyrA7601c.300C>T0.694
gyrA7607c.306C>G0.286
gyrA7613c.312G>A0.688
gyrA7622c.321C>T0.625
gyrA7631c.330G>C0.588
gyrA7637c.336C>T0.438
gyrA7728c.427A>C1.000
gyrA7763c.462T>G1.000
gyrA7775c.474C>T1.000
gyrA7784c.483A>G1.000
gyrA7790c.489G>C1.000
gyrA7796c.495G>T1.000
gyrA7799c.498A>G1.000
gyrA7802c.501C>G1.000
gyrA7832c.531G>T0.977
gyrA7835c.534A>G0.977
gyrA7841c.540C>T0.976
gyrA7847c.546G>C0.973
gyrA7859c.558A>C0.972
gyrA7865c.564T>C0.971
gyrA7886c.585T>G0.968
gyrA7898p.Asp199Glu0.917
gyrA8156c.855T>C0.909
gyrA8168c.867A>G0.909
gyrA8174c.873C>G0.909
gyrA8177c.876A>C0.909
gyrA8191p.Ala297Gly0.864
gyrA8198c.897T>C0.952
gyrA8207c.906T>C0.952
gyrA8210c.909G>A0.905
gyrA8219c.918T>C1.000
gyrA8222c.921C>T1.000
gyrA8225c.924T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8324c.1023T>C0.818
gyrA8327c.1026C>G0.182
gyrA8330c.1029C>G0.182
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8366c.1065G>C0.838
gyrA8372c.1071G>T0.939
gyrA8382c.1081C>T0.138
gyrA8390c.1089C>G1.000
gyrA8391p.Tyr364Leu1.000
gyrA8399c.1098T>G1.000
gyrA8408c.1107A>G1.000
gyrA8414c.1113C>T1.000
gyrA8420c.1119T>C1.000
gyrA8480c.1179C>T1.000
gyrA8486c.1185T>C1.000
gyrA8504c.1203G>C1.000
gyrA8510c.1209G>A1.000
gyrA8513c.1212C>G1.000
gyrA8516c.1215T>C1.000
gyrA8519c.1218A>G1.000
gyrA8520c.1219C>T1.000
gyrA8535p.Glu412Gln1.000
gyrA8546p.Asp415Glu1.000
gyrA8561c.1260A>C1.000
gyrA8571c.1270C>T1.000
gyrA8603c.1302A>C1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>G0.182
gyrA8867c.1566A>G0.783
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8876c.1575C>T0.783
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8921c.1620C>T0.161
gyrA8939c.1638T>C0.538
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C0.500
gyrA8946c.1645T>C1.000
gyrA8952p.Gln551Ala0.500
gyrA8957c.1656C>T0.500
gyrA8967p.Ala556Asn1.000
gyrA8978c.1677C>T0.455
gyrA8981c.1680G>C0.600
gyrA9650c.2349G>C1.000
gyrA9656c.2355C>G1.000
gyrA9662c.2361G>C1.000
gyrA9668c.2367C>T1.000
gyrA9683c.2382G>T1.000
gyrA9689c.2388G>T1.000
gyrA9701c.2400T>C1.000
gyrA9707c.2406G>C1.000
gyrA9716c.2415T>C1.000
gyrA9738p.Leu813Ile1.000
gyrA9743c.2442C>G1.000
gyrA9746c.2445C>T1.000
rpoB760112c.306T>C1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760136c.330G>A0.880
rpoB760139c.333A>T1.000
rpoB760142c.336C>G0.880
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.167
rpoB760274p.Glu156Asp0.149
rpoB760276p.Lys157Met0.152
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C0.115
rpoB760310c.504G>C0.882
rpoB760316c.510C>G1.000
rpoB760325c.519G>C1.000
rpoB760331c.525G>C1.000
rpoB760334c.528G>T0.980
rpoB760340c.534G>T1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760376p.Asp190Glu1.000
rpoB760406c.600G>C0.952
rpoB760407p.Ser201Gly0.984
rpoB760415c.609C>T0.985
rpoB760424c.618C>G0.912
rpoB760430c.624T>C0.985
rpoB760433c.627C>T0.909
rpoB760457c.651C>T0.883
rpoB760463c.657C>T0.879
rpoB760475c.669A>G0.978
rpoB760478c.672C>T0.844
rpoB760481c.675G>T0.974
rpoB760484c.678A>G0.976
rpoB760502c.696C>G0.962
rpoB760522p.Ser239Asn0.958
rpoB760532c.726T>C0.935
rpoB760533p.Val243Thr0.742
rpoB760541c.735G>C0.938
rpoB760547c.741G>C0.788
rpoB760567p.Ser254Trp0.958
rpoB760571c.765G>C0.962
rpoB760585p.Asn260Ser0.864
rpoB760588p.Thr261Ile0.114
rpoB760591p.Val262Ala0.977
rpoB760595c.789C>T0.956
rpoB760596p.Thr264Pro0.956
rpoB760611c.805T>C0.981
rpoB760634c.828T>C0.121
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>C1.000
rpoB760670c.864G>C1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T0.976
rpoB760721c.915C>G0.969
rpoB760724c.918T>C0.897
rpoB760730c.924T>C1.000
rpoB760736c.930C>G0.130
rpoB760748c.942C>G1.000
rpoB760751c.945G>C1.000
rpoB760755p.His317Asn1.000
rpoB760759p.Val318Ala1.000
rpoB760764p.Glu320Gln1.000
rpoB760769c.963C>G1.000
rpoB760784c.978G>T1.000
rpoB760793c.987A>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala0.226
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T0.226
rpoB760877c.1071G>T0.774
rpoB760883c.1077G>C0.774
rpoB760886c.1080A>G0.226
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760919c.1113C>T0.765
rpoB760925c.1119T>C0.788
rpoB760928c.1122G>C1.000
rpoB760931c.1125C>G0.793
rpoB760943c.1137C>T0.156
rpoB760946c.1140A>G0.971
rpoB760965p.Met387Leu0.967
rpoB760970c.1164G>C0.966
rpoB760973c.1167G>C0.960
rpoB760982c.1176G>C0.957
rpoB760985c.1179G>C0.950
rpoB760988c.1182C>G0.947
rpoB760991c.1185G>T0.947
rpoB760997c.1191G>C0.947
rpoB761015c.1209G>C0.952
rpoB761027c.1221A>C0.933
rpoB761036c.1230G>C0.917
rpoB761037c.1231T>C0.900
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761102c.1296A>G1.000
rpoB761111c.1305C>T0.757
rpoB761132c.1326G>T0.256
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T0.184
rpoB761178p.Ser458Thr0.179
rpoB761186p.Glu460Asp0.167
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>T0.154
rpoB761213c.1407G>C0.658
rpoB761217p.Pro471Ser0.684
rpoB761234c.1428G>C1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G0.279
rpoB761258c.1452G>A0.273
rpoB761261c.1455G>T0.279
rpoB761264c.1458C>G1.000
rpoB761273c.1467T>C0.294
rpoB761282c.1476C>T0.750
rpoB761288c.1482G>T0.781
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761330c.1524G>C0.859
rpoB761333c.1527G>T0.139
rpoB761339c.1533C>G0.145
rpoB761345c.1539G>C1.000
rpoB761354c.1548C>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761367p.Glu521Gln0.959
rpoB761374p.Val523Asp1.000
rpoB761408c.1602G>C0.917
rpoB761414c.1608A>G0.970
rpoB761423c.1617T>C0.968
rpoB761528c.1722C>T0.208
rpoB761537c.1731C>G1.000
rpoB761552c.1746G>C0.794
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C0.163
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.978
rpoB761579c.1773G>C1.000
rpoB761606c.1800C>G0.847
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761648c.1842T>C0.880
rpoB761657c.1851C>T0.125
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761682c.1876C>T1.000
rpoB761690c.1884G>C1.000
rpoB761705c.1899C>A0.125
rpoB761747c.1941G>C0.952
rpoB761765c.1959T>C0.952
rpoB761772p.His656Ala0.952
rpoB761778p.Asn658Asp1.000
rpoB761785p.Thr660Ser1.000
rpoB761791p.Arg662His1.000
rpoB761813c.2007T>C1.000
rpoB761834c.2028T>C1.000
rpoB761847p.Cys681Arg1.000
rpoB761852c.2046C>G1.000
rpoB761885c.2079T>C0.895
rpoB761891c.2085G>C1.000
rpoB761892p.Ile696Val0.889
rpoB761906c.2100C>G0.833
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761921c.2115C>T0.842
rpoB761930c.2124G>C1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>G0.125
rpoB761955p.Ile717Val0.119
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C0.148
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>T0.170
rpoB762038c.2232C>T0.174
rpoB762047c.2241G>A0.978
rpoB762053c.2247T>C0.978
rpoB762056c.2250G>A0.149
rpoB762065c.2259T>C0.128
rpoB762083c.2277T>C0.950
rpoB762086c.2280G>C0.951
rpoB762101c.2295C>G0.962
rpoB762114p.Ile770Val0.967
rpoB762131c.2325C>G0.964
rpoB762137c.2331C>T0.962
rpoB762140c.2334G>C0.962
rpoB762143c.2337T>C0.981
rpoB762149c.2343G>C0.131
rpoB762158c.2352G>C0.968
rpoB762167c.2361T>C0.968
rpoB762176c.2370T>C0.970
rpoB762185c.2379G>C0.971
rpoB762194c.2388G>C0.125
rpoB762224c.2418C>G0.831
rpoB762233c.2427G>C0.986
rpoB762236c.2430G>C0.143
rpoB762245c.2439G>C0.984
rpoB762275c.2469C>T0.167
rpoB762284c.2478G>T0.135
rpoB762293c.2487T>C0.980
rpoB762308c.2502G>C0.920
rpoB762314c.2508C>T0.936
rpoB762317c.2511A>G1.000
rpoB762329c.2523G>C1.000
rpoB762338c.2532T>C1.000
rpoB762341c.2535G>C1.000
rpoB762347c.2541T>C1.000
rpoB762350c.2544C>T1.000
rpoB762362p.Glu852Asp1.000
rpoB762369c.2563T>C1.000
rpoB762374c.2568G>C1.000
rpoB762395c.2589G>C1.000
rpoB762398c.2592T>C1.000
rpoB762401c.2595G>C0.864
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>C0.122
rpoB762416c.2610A>G1.000
rpoB762434c.2628T>C0.887
rpoB762443c.2637G>C0.883
rpoB762449c.2643C>A0.983
rpoB762452c.2646G>C0.983
rpoB762470c.2664G>C0.984
rpoB762491c.2685T>C0.984
rpoB762509c.2703T>G0.925
rpoB762510p.Ala902Pro0.925
rpoB762515c.2709C>T0.961
rpoB762527c.2721G>C0.889
rpoB762533c.2727T>C0.944
rpoB762536c.2730T>C0.944
rpoB762537c.2731T>C0.944
rpoB762551c.2745C>T0.938
rpoB762560c.2754A>T0.933
rpoB762563c.2757G>T0.926
rpoB762812c.3006C>G1.000
rpoB762814p.Met1003Thr1.000
rpoB762816c.3010C>T1.000
rpoB762827c.3021G>T1.000
rpoB762830c.3024C>G0.111
rpoB762833c.3027C>T0.889
rpoB762839c.3033G>A0.902
rpoB762857c.3051C>G1.000
rpoB762863c.3057T>C1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T0.141
rpoB762899c.3093G>C0.136
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G0.156
rpoB762929c.3123G>T0.159
rpoB762959c.3153G>C0.983
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763004c.3198G>A0.857
rpoB763007c.3201C>T0.875
rpoB763022c.3216C>G0.873
rpoB763028c.3222T>C0.870
rpoB763031c.3225T>G1.000
rpoB763040c.3234C>G0.122
rpoB763053c.3247T>C0.848
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T0.156
rpoB763085c.3279C>G0.841
rpoB763088c.3282C>G0.119
rpoB763094c.3288G>C0.122
rpoB763103c.3297G>C0.897
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763130c.3324G>A0.875
rpoB763133c.3327G>C0.875
rpoB763136c.3330C>T1.000
rpoB763142c.3336C>G0.875
rpoB763145c.3339G>A0.125
rpoB763157c.3351G>T0.143
rpoB763160c.3354G>T0.842
rpoB763166c.3360A>G1.000
rpoB763169c.3363A>G0.867
rpoB763172c.3366G>C0.133
rpoB763190c.3384C>T0.923
rpoC763375c.6C>A0.977
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>C1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C0.971
rpoC763433p.Gln22Asn0.970
rpoC763443p.Tyr25Phe0.971
rpoC763456c.87A>G0.980
rpoC763468c.99G>C0.982
rpoC763486c.117T>C0.982
rpoC763492c.123G>T0.981
rpoC763528c.159G>A0.965
rpoC763531c.162G>T0.125
rpoC763546c.177A>G0.982
rpoC763558c.189C>T0.828
rpoC763570c.201G>C0.982
rpoC763573c.204G>C0.871
rpoC763594c.225C>T1.000
rpoC763603c.234C>T0.864
rpoC763615c.246G>C0.846
rpoC763618c.249C>T0.866
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.130
rpoC763660c.291T>G1.000
rpoC763666c.297G>A0.129
rpoC763669c.300C>G0.127
rpoC763675c.306C>G1.000
rpoC763702c.333C>G0.973
rpoC763705c.336G>A0.838
rpoC763708c.339G>C0.132
rpoC763709p.Leu114Phe0.842
rpoC763714c.345G>C0.974
rpoC763717c.348T>C0.975
rpoC763723c.354G>C0.978
rpoC763732c.363C>T0.977
rpoC763741c.372C>T0.978
rpoC763747c.378G>A0.978
rpoC763765c.396T>G0.972
rpoC763792p.Glu141Asp0.941
rpoC763807c.438T>C1.000
rpoC763813c.444C>G1.000
rpoC763831c.462A>G1.000
rpoC763837c.468G>C1.000
rpoC763840c.471G>C1.000
rpoC763855c.486C>G0.944
rpoC763858c.489A>G0.944
rpoC763861c.492C>T0.944
rpoC763872p.Gly168Ala0.909
rpoC763876p.Glu169Asp0.909
rpoC763879c.510A>G0.917
rpoC763882c.513G>A0.923
rpoC763891c.522G>C0.944
rpoC763894c.525A>G0.947
rpoC763900c.531G>C0.952
rpoC763921c.552G>C0.692
rpoC763924c.555G>A0.667
rpoC763930c.561G>A0.667
rpoC763933c.564C>T0.917
rpoC763940p.Ala191Ser0.909
rpoC763945c.576T>C0.909
rpoC763947p.Ala193Val0.909
rpoC763951c.582G>C0.909
rpoC763960c.591T>G0.909
rpoC763969c.600C>T0.909
rpoC763978c.609C>T0.636
rpoC764005c.636G>C1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T0.214
rpoC764059c.690G>T1.000
rpoC764071c.702G>C0.786
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764089c.720C>G0.786
rpoC764098c.729A>G1.000
rpoC764101c.732C>G0.786
rpoC764102p.Val245Gln0.786
rpoC764134c.765C>G0.917
rpoC764153p.Gln262Lys0.882
rpoC764161c.792G>C0.879
rpoC764182p.Asp271Glu0.964
rpoC764188c.819A>G0.960
rpoC764227c.858G>C0.931
rpoC764239c.870T>G0.944
rpoC764254c.885G>T0.950
rpoC764257c.888G>C0.952
rpoC764263c.894G>T0.956
rpoC764266c.897T>C0.956
rpoC764272c.903G>C0.957
rpoC764278c.909A>G0.957
rpoC764293c.924G>C0.962
rpoC764297p.Met310Leu0.982
rpoC764344c.975C>T0.890
rpoC764353c.984G>T0.971
rpoC764365c.996C>T0.985
rpoC764371c.1002G>C0.985
rpoC764377c.1008C>G0.106
rpoC764380c.1011G>C0.984
rpoC764387c.1018T>C0.984
rpoC764405c.1036A>C0.968
rpoC764431c.1062G>C0.957
rpoC764434c.1065A>G0.957
rpoC764435c.1066A>C0.957
rpoC764446c.1077T>C0.885
rpoC764449c.1080G>C0.887
rpoC764458c.1089G>C0.963
rpoC764461c.1092A>G0.963
rpoC764485c.1116G>C0.903
rpoC764491c.1122G>T0.915
rpoC764497c.1128A>G0.982
rpoC764500c.1131C>G0.931
rpoC764521c.1152T>C0.935
rpoC764527c.1158C>T0.919
rpoC764536c.1167G>T0.918
rpoC764539c.1170C>G0.982
rpoC764575c.1206T>G1.000
rpoC764605c.1236G>C0.865
rpoC764611c.1242G>T0.982
rpoC764623c.1254C>G0.907
rpoC764626c.1257C>T0.981
rpoC764632c.1263T>C0.981
rpoC764650c.1281G>T0.962
rpoC764701c.1332C>G0.870
rpoC764713c.1344G>T0.965
rpoC764716c.1347G>C0.965
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.133
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764851c.1482C>T0.859
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>T0.158
rpoC764878c.1509C>G0.828
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764935c.1566T>C0.862
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>A1.000
rpoC765019c.1650A>G0.182
rpoC765022c.1653G>T0.818
rpoC765034c.1665T>C0.818
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765338p.Gln657Lys0.917
rpoC765352c.1983G>C1.000
rpoC765357p.Met663Thr0.941
rpoC765361c.1992C>G0.944
rpoC765383p.Met672Leu1.000
rpoC765400c.2031G>C0.923
rpoC765403c.2034G>C1.000
rpoC765404p.Leu679Lys0.923
rpoC765409c.2040T>C1.000
rpoC765412c.2043T>C0.926
rpoC765421c.2052C>G0.119
rpoC765425p.Lys686Glu0.889
rpoC765445c.2076G>C0.896
rpoC765451c.2082C>G0.109
rpoC765452p.Ala695Arg0.878
rpoC765466c.2097C>T0.891
rpoC765478c.2109T>C0.981
rpoC765480p.Tyr704Phe0.983
rpoC765496c.2127C>G0.860
rpoC765499c.2130C>G0.982
rpoC765517c.2148C>G0.135
rpoC765529c.2160C>T0.840
rpoC765533p.Tyr722His0.979
rpoC765548c.2179A>T0.969
rpoC765553c.2184C>T0.969
rpoC765556c.2187G>C0.969
rpoC765562c.2193G>C0.966
rpoC765577c.2208G>T0.867
rpoC765591p.Arg741Gln0.944
rpoC765596p.Lys743Gln0.944
rpoC765772c.2403C>G0.895
rpoC765778c.2409C>G0.944
rpoC765779p.Asp804Lys0.944
rpoC765793c.2424C>G0.964
rpoC765796c.2427C>T0.964
rpoC765800p.Phe811Leu0.966
rpoC765811c.2442T>G0.971
rpoC765814c.2445A>C0.971
rpoC765817c.2448G>C0.971
rpoC765823c.2454C>A0.919
rpoC765826c.2457T>C0.973
rpoC765835c.2466C>T0.979
rpoC765871c.2502T>C0.887
rpoC765875p.Val836Ile0.985
rpoC765886c.2517C>G0.889
rpoC765904c.2535C>G0.881
rpoC765908c.2539C>T0.892
rpoC765934c.2565C>T0.870
rpoC765940c.2571A>T0.981
rpoC765946c.2577C>T0.857
rpoC765947c.2578T>C1.000
rpoC765952c.2583G>C0.854
rpoC765961c.2592G>T0.842
rpoC765962c.2593T>C0.973
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G0.108
rpoC765979c.2610C>G0.971
rpoC765982c.2613C>T0.971
rpoC765994c.2625A>T1.000
rpoC766012c.2643C>G1.000
rpoC766021c.2652G>C1.000
rpoC766027c.2658G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766363c.2994G>C0.935
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766408c.3039C>T1.000
rpoC766726c.3357T>C1.000
rpoC766738c.3369G>T1.000
rpoC766741c.3372G>C1.000
rpoC766765c.3396A>C1.000
rpoC766771c.3402G>C1.000
rpoC766774c.3405T>C1.000
rpoC766775p.Arg1136Lys1.000
rpoC766798c.3429C>G0.917
rpoC766804c.3435A>G0.972
rpoC766837c.3468G>C0.969
rpoC766843c.3474T>C0.966
rpoC766846c.3477C>G0.963
rpoC766931p.Ala1188Thr0.167
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766948c.3579G>C0.824
rpoC766963c.3594T>C1.000
rpoC766978c.3609C>T0.827
rpoC766981c.3612T>C0.827
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767020c.3651C>G0.781
rpoC767023c.3654C>T0.986
rpoC767044c.3675G>C0.151
rpoC767080c.3711G>C0.140
rpoC767098c.3729T>C0.948
rpoC767104c.3735C>G0.941
rpoC767105p.Asn1246Gln0.765
rpoC767119c.3750A>G0.947
rpoC767125c.3756G>C0.155
rpoC767134c.3765C>T0.948
rpoC767138c.3769C>T0.949
rpoC767149c.3780C>T0.136
rpoC767158c.3789T>C0.940
rpoC767162p.Asn1265Ala0.800
rpoC767167c.3798C>T0.816
rpoC767174p.Asn1269Asp0.870
rpoC767180p.Ala1271Gln0.952
rpoC767191c.3822C>G0.982
rpoC767197c.3828G>A1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C0.136
rpoC767263c.3894T>C0.500
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T0.143
rpsL781595c.36T>C1.000
rpsL781598c.39G>C0.818
rpsL781605p.Ile16Val0.818
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G0.146
rpsL781628c.69T>C1.000
rpsL781631c.72G>C0.857
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>G1.000
rpsL781670c.111G>C0.113
rpsL781682c.123T>C0.890
rpsL781706c.147T>C0.122
rpsL781709c.150G>C0.905
rpsL781715c.156T>C1.000
rpsL781728c.169T>C1.000
rpsL781739c.181 182insCGGC0.950
rplC800796c.-13ATTGG>A1.000
rplC800904c.96G>C0.933
rplC800916c.108A>G0.933
rplC800921p.Arg38Leu0.933
rplC800928c.120C>T0.933
rplC800931c.123G>C0.933
rplC800937c.129A>G0.933
rplC800946c.138T>C0.933
rplC800949c.141T>C0.933
rplC800964c.156G>C0.933
rplC800985c.177A>G1.000
rplC801171c.363A>G1.000
rplC801174c.366T>C1.000
rplC801195c.387G>T1.000
rplC801205p.Arg133Ala1.000
rplC801210c.402T>C1.000
rplC801220p.Ser138Ala1.000
rplC801237c.429G>A0.966
rplC801252c.444G>C0.966
rplC801264c.456C>T0.966
rplC801267c.459A>C0.966
rplC801276c.468G>C0.966
rplC801281p.Ala158Gly0.964
rplC801285c.477G>C0.931
rplC801307p.Ala167Ser0.909
rplC801312c.504G>C0.909
rplC801315c.507G>T0.909
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471986r.141c>t1.000
rrs1472019r.174g>a0.909
rrs1472023r.178g>t0.906
rrs1472031r.186g>c1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472075r.230a>g0.931
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.989
rrs1472286r.441c>a0.909
rrs1472287r.442c>t0.909
rrs1472289r.444t>g0.909
rrs1472290r.445c>g0.909
rrs1472313r.468g>a1.000
rrs1472315r.470t>g1.000
rrs1472324r.479g>c1.000
rrs1472325r.480g>c1.000
rrs1472327r.482g>a1.000
rrs1472328r.483g>t1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g0.990
rrs1472846r.1001c>a0.982
rrs1472847r.1002g>c0.982
rrs1472849r.1004c>g0.885
rrs1472850r.1005t>c0.885
rrs1472857r.1012a>g0.885
rrs1472858r.1013g>t0.885
rrs1472860r.1015c>g0.982
rrs1472861r.1016g>t0.982
rrs1472973r.1128a>t0.922
rrs1473104r.1259c>t0.981
rrs1473110r.1265t>g0.979
rrs1473111r.1266a>g0.979
rrs1473120r.1275c>ct0.825
rrs1473123r.1278a>c0.964
rrs1473276r.1431a>g0.925
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>gt0.928
rrs1473301r.1456t>c0.935
rrl1473668r.11c>t1.000
rrl1473696r.39t>c0.924
rrl1473697r.40c>t1.000
rrl1473699r.42a>g0.924
rrl1473717r.60g>t1.000
rrl1473746r.89t>c1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>g1.000
rrl1473788r.131a>g0.922
rrl1473806r.149c>t1.000
rrl1473807r.150t>c0.915
rrl1473823r.166t>c0.915
rrl1473829r.172g>t1.000
rrl1473830r.173t>g0.947
rrl1473831r.174g>t1.000
rrl1473832r.175c>a0.982
rrl1473876r.219g>a0.990
rrl1473884r.227c>ca0.879
rrl1473887r.230t>a0.989
rrl1473898r.241c>t0.988
rrl1473899r.242a>g0.988
rrl1473916r.259c>a0.974
rrl1473922r.265a>g0.915
rrl1473923r.266c>g0.957
rrl1473935r.278c>t0.913
rrl1473937r.280c>t0.956
rrl1473943r.286g>t0.956
rrl1473945r.288t>a0.956
rrl1473946r.289a>t0.956
rrl1474044r.387c>t1.000
rrl1474045r.388c>t0.917
rrl1474053r.396g>a0.938
rrl1474054r.397t>c1.000
rrl1474061r.404t>c0.150
rrl1474074r.417c>t0.261
rrl1474083r.426c>t0.739
rrl1474089r.432c>t0.261
rrl1474091r.434c>t0.739
rrl1474093r.436g>a1.000
rrl1474096r.439c>t0.739
rrl1474099r.442g>a0.739
rrl1474100r.443c>t0.261
rrl1474108r.451c>g0.739
rrl1474130r.473c>t0.200
rrl1474135r.478g>a0.831
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474174r.517a>g0.855
rrl1474181r.524c>t0.836
rrl1474183r.526t>c0.871
rrl1474184r.527c>a0.129
rrl1474185r.528g>a0.871
rrl1474186r.529a>g1.000
rrl1474249r.592g>t1.000
rrl1474266r.609t>c0.914
rrl1474269r.612c>t0.912
rrl1474289r.632c>t0.812
rrl1474292r.635t>g1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474362r.705a>g1.000
rrl1474414r.757c>t0.905
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.095
rrl1474417r.760acacgcgc>a1.000
rrl1474427r.770a>c1.000
rrl1474430r.773c>g1.000
rrl1474432r.775c>g1.000
rrl1474437r.780gaa>g1.000
rrl1474446r.789c>t0.937
rrl1474626r.969t>c0.984
rrl1474627r.970g>a0.787
rrl1474629r.972g>a0.787
rrl1474632r.975g>t0.983
rrl1474636r.979a>t0.983
rrl1474637r.980c>t0.983
rrl1474638r.981c>g0.983
rrl1474639r.982g>t0.983
rrl1474640r.983c>t0.983
rrl1474673r.1016t>c0.872
rrl1474676r.1019t>a0.872
rrl1474677r.1020a>g0.874
rrl1474710r.1053t>a0.836
rrl1474711r.1054g>c1.000
rrl1474712r.1055g>a1.000
rrl1474713r.1056t>a1.000
rrl1474717r.1060a>g1.000
rrl1474720r.1063c>t0.836
rrl1474722r.1065t>c0.115
rrl1474743r.1086t>g0.118
rrl1474753r.1096a>g0.896
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a0.990
rrl1474830r.1173a>g1.000
rrl1474932r.1275c>t0.984
rrl1475031r.1374g>c0.120
rrl1475061r.1404c>a0.861
rrl1475062r.1405a>t1.000
rrl1475076r.1419c>a0.122
rrl1475090r.1433a>t0.108
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a0.103
rrl1475199r.1542g>a0.167
rrl1475202r.1545g>t0.182
rrl1475315r.1658a>t0.982
rrl1475353r.1696a>t0.985
rrl1475354r.1697a>g0.985
rrl1475355r.1698c>t0.985
rrl1475363r.1706c>t0.985
rrl1475379r.1722g>a0.917
rrl1475380r.1723c>a0.958
rrl1475381r.1724g>c0.958
rrl1475382r.1725a>g0.958
rrl1475395r.1738t>c0.958
rrl1475396r.1739c>g0.958
rrl1475397r.1740g>t0.958
rrl1475398r.1741c>t0.958
rrl1475403r.1746t>a0.958
rrl1475404r.1747a>t0.958
rrl1475419r.1762c>t0.944
rrl1475429r.1772g>t0.986
rrl1475452r.1795c>a1.000
rrl1475479r.1822c>g1.000
rrl1475483r.1826c>t0.962
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a0.989
rrl1475531r.1874c>t1.000
rrl1475544r.1887a>t0.937
rrl1475545r.1888t>g0.925
rrl1475602r.1945g>c0.964
rrl1475603r.1946g>c0.964
rrl1475604r.1947a>c0.964
rrl1475612r.1955g>c0.964
rrl1475615r.1958c>g0.964
rrl1475616r.1959a>g0.964
rrl1475618r.1961c>t0.964
rrl1475626r.1969t>c0.964
rrl1475629r.1972g>c0.964
rrl1475637r.1980t>g0.964
rrl1475638r.1981c>g0.964
rrl1475639r.1982c>g0.964
rrl1475643r.1986c>g0.794
rrl1475647r.1990g>c0.810
rrl1475659r.2002g>a0.989
rrl1475753r.2096c>t0.884
rrl1475760r.2103ccg>c0.326
rrl1475762r.2105g>t0.984
rrl1475763r.2106c>t0.847
rrl1475764r.2107a>t0.139
rrl1475765r.2108a>t0.137
rrl1475775r.2118g>a0.871
rrl1475988r.2331a>g0.987
rrl1475991r.2334t>c0.939
rrl1475995r.2338g>a0.939
rrl1476030r.2373a>g0.979
rrl1476032r.2375c>a0.978
rrl1476033r.2376t>g0.978
rrl1476035r.2378g>c0.978
rrl1476044r.2387t>g0.978
rrl1476046r.2389g>t0.978
rrl1476047r.2390g>t0.978
rrl1476049r.2392c>t0.978
rrl1476088r.2431a>c0.987
rrl1476099r.2442a>g0.985
rrl1476103r.2446c>g0.984
rrl1476105r.2448g>a0.984
rrl1476106r.2449a>t0.984
rrl1476110r.2453g>c0.985
rrl1476115r.2458t>c0.985
rrl1476131r.2474c>t0.989
rrl1476160r.2503t>c0.990
rrl1476214r.2557g>t0.988
rrl1476215r.2558c>t0.988
rrl1476224r.2567a>g0.989
rrl1476251r.2594t>g1.000
rrl1476256r.2599a>t0.902
rrl1476260r.2603a>g0.901
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476529r.2872a>g0.943
rrl1476540r.2883c>t0.943
rrl1476583r.2926g>a0.946
rrl1476584r.2927c>t0.989
rrl1476594r.2937c>t0.989
rrl1476597r.2940g>a0.989
rrl1476603r.2946g>a0.989
rrl1476628r.2971t>a0.988
rrl1476664r.3007t>c0.983
rrl1476665r.3008t>c0.982
rrl1476674r.3017t>c0.982
rrl1476679r.3022t>c1.000
rrl1476689r.3032a>t0.978
rrl1476690r.3033c>t0.978
rrl1476693r.3036g>a0.978
rrl1476695r.3038t>a0.978
rrl1476716r.3059a>c0.939
rrl1476723r.3066t>a0.933
rrl1476725r.3068c>t0.933
rrl1476726r.3069a>g1.000
rrl1476731r.3074g>a0.933
rrl1476732r.3075t>c1.000
rrl1476746r.3089t>c0.929
rrl1476747r.3090c>t0.929
rrl1476754r.3097g>a0.929
rrl1476759r.3102t>c1.000
rrl1476770r.3113t>c1.000
rrl1476771r.3114g>a1.000
fabG11673703c.264C>T1.000
fabG11673724c.285A>G1.000
fabG11673730c.291C>G1.000
fabG11673745c.306G>A1.000
fabG11673748c.309A>G1.000
fabG11673749p.Lys104Arg1.000
fabG11673760p.Lys107Asn1.000
fabG11673778c.339C>G1.000
fabG11673784c.345G>C1.000
fabG11673787c.348G>C1.000
fabG11673901c.462A>G1.000
fabG11673905p.Ser156Ala1.000
fabG11673916c.477A>C1.000
fabG11673917p.Val160Leu1.000
fabG11673922c.483T>C1.000
fabG11673931c.492C>G1.000
fabG11673941p.Ala168Ser1.000
fabG11673955c.516G>C1.000
fabG11673961c.522A>C1.000
fabG11673962p.Asn175Gly1.000
fabG11673967c.528G>C1.000
fabG11673973c.534G>C0.962
fabG11673976c.537T>C0.962
fabG11674006p.Asp189Glu0.982
fabG11674024c.585T>C0.981
fabG11674037p.Gln200Ala0.968
fabG11674042c.603G>C0.967
fabG11674045c.606G>C0.967
fabG11674049p.Gln204Asp0.967
fabG11674054c.615T>C0.967
fabG11674060c.621A>C0.967
fabG11674079p.Pro214Ala0.960
fabG11674083p.Ala215Glu0.880
fabG11674096c.657G>C0.933
fabG11674098p.Val220Ala0.929
fabG11674102c.663C>G0.929
fabG11674114c.675T>A0.923
inhA1674651c.450C>T0.957
inhA1674656p.Ser152Thr0.957
inhA1674660c.459G>C0.957
inhA1674663c.462G>C0.957
inhA1674672c.471C>A0.958
inhA1674690c.489C>G1.000
inhA1674702c.501G>T1.000
inhA1674703c.502T>C1.000
inhA1674718c.517A>C1.000
inhA1674729c.528G>T1.000
inhA1674742p.Lys181Ala1.000
inhA1674745p.Tyr182Ala1.000
inhA1674753c.552G>C1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>G1.000
inhA1674904p.Ala235Pro1.000
inhA1674924c.723G>T1.000
inhA1674930c.729C>T1.000
inhA1674934c.733C>T1.000
inhA1674942c.741T>C1.000
inhA1674949p.Leu250Met1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>A1.000
inhA1674966c.765T>C1.000
inhA1674967p.Asp256Thr1.000
rpsA1833538c.-4CA>C1.000
rpsA1833539c.-3A>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833554p.Thr5Ser0.750
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T0.182
rpsA1833616c.75A>C0.167
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G0.154
rpsA1833628c.87G>C0.843
rpsA1833634c.93G>A0.849
rpsA1833661c.120A>G0.833
rpsA1833664c.123C>A0.167
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>T1.000
rpsA1833694c.153G>C1.000
rpsA1833697c.156C>G1.000
rpsA1833703c.162C>T0.900
rpsA1833709c.168C>T0.122
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833730c.189C>T0.805
rpsA1833733c.192C>T0.171
rpsA1833734p.Ala65Ser0.976
rpsA1833742c.201A>G0.115
rpsA1833745c.204G>C0.982
rpsA1833748c.207C>G0.138
rpsA1833760c.219C>T0.984
rpsA1833787c.246C>G0.983
rpsA1833790c.249T>C0.981
rpsA1833793c.252C>T0.828
rpsA1833802c.261A>G0.984
rpsA1833811c.270G>T0.984
rpsA1833823c.282G>A0.145
rpsA1833829c.288A>G0.833
rpsA1833832c.291G>A0.983
rpsA1833838c.297G>C0.983
rpsA1833841c.300C>G0.984
rpsA1833847c.306C>G0.984
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G0.143
rpsA1833886c.345C>G0.169
rpsA1833894p.Ala118Glu1.000
rpsA1833904c.363G>A0.831
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C0.982
rpsA1833961c.420C>G0.136
rpsA1833970c.429G>T1.000
rpsA1833976c.435C>T0.844
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>A0.136
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>T0.183
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G0.984
rpsA1834033c.492C>T0.143
rpsA1834073p.Lys178Arg0.119
rpsA1834096c.555G>C0.127
rpsA1834097p.Ser186Arg0.833
rpsA1834102c.561T>C0.833
rpsA1834108c.567C>G0.140
rpsA1834114c.573G>C0.128
rpsA1834150c.609G>C0.952
rpsA1834153c.612T>C0.957
rpsA1834154p.Asn205Gln0.957
rpsA1834157c.616T>C0.957
rpsA1834162c.621A>G0.957
rpsA1834165c.624A>G0.957
rpsA1834168c.627C>T1.000
rpsA1834169p.Thr210Ala1.000
rpsA1834177c.636A>C1.000
rpsA1834189c.648G>C0.756
rpsA1834213c.672G>C0.780
rpsA1834228c.687C>A0.196
rpsA1834231c.690T>G0.196
rpsA1834234c.693G>C0.196
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>C0.209
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T0.120
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T0.164
rpsA1834345c.804C>T0.884
rpsA1834348c.807T>C0.891
rpsA1834361c.820T>C0.889
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C0.136
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>C0.156
rpsA1834414c.873C>T0.133
rpsA1834417c.876G>C0.130
rpsA1834423c.882G>T0.133
rpsA1834429c.888C>T0.133
rpsA1834438c.897C>T0.125
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834489c.948T>C0.980
rpsA1834513c.972C>G0.889
rpsA1834520p.Ala327Ser0.982
rpsA1834528c.987T>C0.982
rpsA1834540c.999G>C0.891
rpsA1834543c.1002C>G0.938
rpsA1834546c.1005T>C0.978
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834720c.1179C>G0.111
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834756c.1215G>A0.804
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>G0.226
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G0.967
rpsA1834786c.1245A>G0.767
rpsA1834789c.1248T>C1.000
rpsA1834792c.1251G>C0.767
rpsA1834813c.1272G>T0.231
rpsA1834829p.Ala430Ile0.667
rpsA1834840c.1299G>A0.684
katG2155661p.Val151Leu1.000
katG2155668c.444C>G1.000
katG2155674c.438C>G1.000
katG2155680c.432C>T1.000
katG2155691c.421A>G0.962
katG2155696p.Ala139Val0.962
katG2155716c.396A>C0.962
katG2155722c.390C>G0.962
katG2155728c.384C>G0.962
katG2155742p.Gly124Arg0.957
katG2155747p.Ala122Gly0.950
katG2155752c.360G>A0.950
kasA2518726c.612G>A1.000
kasA2518732c.618C>G1.000
kasA2518747c.633C>G0.929
kasA2518756c.642G>C1.000
kasA2518780p.Glu222Asp0.909
kasA2518783c.669T>C1.000
kasA2518785p.Glu224Ala0.909
kasA2518787p.Arg225Gly1.000
kasA2518792c.678C>G1.000
kasA2518795c.681C>T1.000
kasA2518813c.699C>T0.830
kasA2518816c.702C>T0.830
kasA2518822c.708C>A0.148
kasA2518825c.711T>C0.984
kasA2518843c.729T>C0.850
kasA2518846c.732G>T0.158
kasA2518847p.Leu245Ile0.839
kasA2518853p.Leu247Ile0.182
kasA2518864c.750G>C1.000
kasA2518877p.Lys255Leu0.763
kasA2518898c.784T>C1.000
kasA2518903c.789C>T1.000
kasA2518906c.792A>G1.000
kasA2518907c.793T>C1.000
kasA2518910p.Leu266Met1.000
thyX3067319c.627C>G1.000
thyX3067325c.621T>C1.000
thyX3067331c.615G>A1.000
thyX3067334c.612G>T1.000
thyX3067340c.606C>T1.000
thyX3067346c.600G>C0.960
thyX3067349c.597C>G1.000
thyX3067355c.591T>C1.000
thyX3067376c.570C>G0.971
thyX3067403c.543G>C0.971
thyX3067406c.540T>C0.971
thyX3067415c.531G>A0.971
thyX3067423c.523G>A0.963
thyX3067424c.522C>T0.962
thyX3067427c.519C>G0.962
thyX3067430c.516G>C0.962
thyX3067436c.510G>C0.962
thyX3067442c.504G>C0.962
thyX3067457c.489G>A0.957
thyX3067465p.Ile161Val0.933
thyX3067466c.480C>G0.933
thyX3067475c.471T>C0.933
embC4240717c.855T>C0.839
embC4240729c.867C>G0.176
embC4240735c.873C>G0.169
embC4240741c.879C>T0.160
embC4240756c.894G>C0.172
embC4240768c.906G>A0.828
embC4240771c.909G>C0.155
embC4240772p.Ser304Ala0.145
embC4240777c.915G>A0.831
embC4240778p.His306Gly0.157
embC4240781p.Ala307Ser0.159
embC4240786c.924C>T0.829
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser0.188
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr0.191
embC4240859p.Leu333Ile0.205
embC4241560c.1698C>G1.000
embC4241584c.1722T>C1.000
embC4241587c.1725C>G1.000
embC4241593c.1731C>G1.000
embC4241611c.1749G>C1.000
embC4241614c.1752A>C1.000
embC4241626c.1764T>C1.000
embC4241635c.1773G>C1.000
embC4241644c.1782G>C1.000
embC4241647c.1785G>A1.000
embC4241648c.1786T>C1.000
embC4241656c.1794G>A1.000
embC4241659c.1797G>C1.000
embC4241665c.1803G>T1.000
embC4241668c.1806G>C1.000
embC4241671c.1809T>G1.000
embC4241750p.Leu630Met0.960
embC4241756c.1894C>T0.960
embC4241767c.1905C>G0.960
embC4241769p.Ser636Thr0.960
embC4241809c.1947A>C1.000
embC4242907c.3045G>C0.900
embC4242919c.3057A>G0.900
embC4242928c.3066A>G0.900
embA4244645c.1413T>C0.947
embA4244648c.1416G>C0.950
embA4244665p.Thr478Ser0.955
embA4244669c.1437G>C0.955
embA4244681c.1449A>C0.955
embA4244684c.1452C>G1.000
embA4244695p.Lys488Thr0.955
embA4244712p.Ala494Ser0.955
embA4244726p.Asp498Glu0.955
embA4244747c.1515T>G0.950
embA4245042p.Thr604Ala0.917
embA4245053c.1821G>C0.913
embA4245060c.1828T>C0.917
embA4245071c.1839G>C0.917
embA4245083c.1851A>C0.917
embA4245089c.1857G>C0.917
embA4245092c.1860C>G0.957
embA4245094p.Ile621Thr0.957
embA4245101c.1869G>C1.000
embA4245122c.1890C>T1.000
embA4245125c.1893G>C1.000
embA4245431c.2199T>C0.955
embA4245454p.Ala741Val0.955
embA4245459p.Pro743Ala0.955
embA4245465p.Pro745Thr0.977
embB4247426p.Gly305Gln1.000
embB4247434c.921C>G1.000
embB4247437c.924A>C1.000
embB4247440c.927C>G1.000
embB4247449c.936C>T1.000
embB4247464c.951C>G1.000
embB4247470c.957T>C1.000
embB4247491c.978G>C1.000
embB4247497c.984T>C1.000
embB4247511p.Tyr333Phe1.000
embB4247527c.1014G>C1.000
embB4247536c.1023C>G1.000
embB4247554c.1041T>C1.000
embB4247555p.Leu348Ile1.000
embB4247566c.1053C>A1.000
embB4247572c.1059A>C1.000
embB4247590c.1077A>G1.000
embB4248199c.1686A>G1.000
embB4248200p.Ile563Val1.000
embB4248206p.Ser565Gly1.000
embB4248220c.1707A>G0.971
embB4248225p.Ala571Val0.857
embB4248233c.1720C>T0.972
embB4248242p.Val577Ile0.830
embB4248245p.Ile578Val0.149
embB4248250c.1737C>T0.140
embB4248252p.Gly580Ala0.820
embB4248259p.Met582Ile0.137
embB4248264p.Phe584Cys0.827
embB4248275p.Thr588Ala0.130
embB4248292c.1779G>A0.140
embB4248304c.1791G>C0.795
embB4248319c.1806A>G0.939
embB4248322c.1809G>T0.939

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;