TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c41f4267ab
Sample: 5d2c41f4267ab

Download results

Summary
ID: 5d2c41f4267ab
Date: Mon Jul 15 10:08:37 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A0.900
gyrB6646c.1407C>T0.833
gyrB6655c.1416T>C0.955
gyrB6673c.1434A>C0.967
gyrB6676c.1437T>G0.968
gyrB6703c.1464G>C0.973
gyrB6706c.1467G>A0.973
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.984
gyrB6775c.1536G>C0.970
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB6988c.1749C>G0.846
gyrB7006c.1767T>G0.947
gyrB7010p.Leu591Met0.947
gyrB7015c.1776G>A0.947
gyrB7018c.1779G>C0.900
gyrB7024c.1785G>C0.900
gyrB7033c.1794G>C0.950
gyrB7051p.Glu604Asp0.950
gyrB7060c.1821T>C0.900
gyrB7066c.1827G>T0.947
gyrB7078c.1839A>G0.947
gyrB7081c.1842T>C0.900
gyrB7084c.1845A>G0.950
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7499c.198G>C0.933
gyrA7511c.210C>T0.952
gyrA7523c.222C>G1.000
gyrA7526c.225G>A0.938
gyrA7547c.246C>T0.983
gyrA7553c.252C>T0.952
gyrA7559c.258G>C0.955
gyrA7565c.264C>T0.956
gyrA7574c.273G>C0.959
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.974
gyrA7595c.294C>T0.987
gyrA7607c.306C>T0.986
gyrA7637c.336C>A0.982
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8135c.834C>G0.167
gyrA8156c.855T>C1.000
gyrA8159c.858G>C0.833
gyrA8168c.867A>G1.000
gyrA8174c.873C>G0.909
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8382c.1081C>T0.967
gyrA8783c.1482G>C0.929
gyrA8786c.1485T>G1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C0.969
gyrA8858c.1557T>C0.972
gyrA8870c.1569G>C0.956
gyrA8873c.1572A>G0.978
gyrA8897c.1596T>C0.982
gyrA8903c.1602T>C0.982
gyrA8915c.1614A>G0.983
gyrA8942c.1641G>T0.975
gyrA8945c.1644G>C0.974
gyrA8946c.1645T>C0.974
gyrA8957c.1656C>T0.973
gyrA8967p.Ala556Lys0.971
gyrA8978c.1677C>T0.970
gyrA8987c.1686C>G0.957
gyrA8990c.1689C>G0.952
gyrA8993c.1692C>T0.952
gyrA8996c.1695T>C0.952
gyrA8998p.Leu566Trp0.952
gyrA9018p.Gln573Lys1.000
rpoB760079c.273G>A0.966
rpoB760091c.285G>C0.973
rpoB760101c.295T>C0.973
rpoB760110c.304T>A0.973
rpoB760118c.312T>G0.974
rpoB760121c.315T>C0.974
rpoB760130p.Asp108Glu0.980
rpoB760139c.333A>G0.980
rpoB760181c.375T>C0.982
rpoB760184c.378A>G0.982
rpoB760196c.390C>G0.980
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C0.974
rpoB760388c.582C>T0.976
rpoB760400c.594G>C0.978
rpoB760406c.600G>C1.000
rpoB760407p.Ser201Gly0.979
rpoB760415c.609C>T0.963
rpoB760418c.612G>C0.981
rpoB760430c.624T>C1.000
rpoB760460c.654G>C0.985
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G0.984
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760567p.Ser254Trp1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C0.974
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala0.966
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T0.963
rpoB760721c.915C>G0.938
rpoB760727c.921C>G0.917
rpoB760730c.924T>C1.000
rpoB760736c.930C>G0.909
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C0.952
rpoB760858p.Val351Ala0.957
rpoB760862c.1056G>C0.957
rpoB760865c.1059C>T0.917
rpoB760886p.Glu360Asp0.962
rpoB760887p.Thr361Val0.926
rpoB760910c.1104C>T0.939
rpoB760916c.1110C>T0.939
rpoB760928c.1122G>C0.970
rpoB760943c.1137C>T0.938
rpoB760946c.1140A>G0.972
rpoB760965p.Met387Leu0.935
rpoB760970c.1164G>C0.933
rpoB760973c.1167G>T0.926
rpoB760982c.1176G>C0.952
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G0.944
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C0.955
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A0.978
rpoB761097c.1291A>T0.976
rpoB761102c.1296A>G0.976
rpoB761132c.1326G>C0.981
rpoB761133c.1327T>C0.981
rpoB761147c.1341C>T0.949
rpoB761150c.1344A>T0.982
rpoB761165c.1359G>C0.984
rpoB761171c.1365C>T0.950
rpoB761178p.Ser458Thr0.943
rpoB761186p.Glu460Asp0.944
rpoB761189c.1383T>C0.982
rpoB761195c.1389G>C0.983
rpoB761198c.1392G>C0.932
rpoB761219c.1413G>C0.984
rpoB761234c.1428G>C0.933
rpoB761249c.1443A>G0.982
rpoB761255c.1449T>G0.980
rpoB761258c.1452G>A0.941
rpoB761261c.1455G>C0.979
rpoB761264c.1458C>G0.929
rpoB761273c.1467T>C0.953
rpoB761303c.1497G>C0.966
rpoB761318c.1512G>T0.980
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T0.976
rpoB761339c.1533C>G0.974
rpoB761345c.1539G>C1.000
rpoB761346p.Val514Ser1.000
rpoB761354c.1548C>A1.000
rpoB761357c.1551G>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761373p.Val523His1.000
rpoB761384c.1578C>G1.000
rpoB761393c.1587G>A1.000
rpoB761497p.Tyr564Phe0.909
rpoB761502p.Pro566Ser0.833
rpoB761505p.Ser567Ala0.833
rpoB761508p.Ser568Thr0.833
rpoB761516c.1710G>C0.938
rpoB761528c.1722C>T0.943
rpoB761531c.1725C>T0.944
rpoB761537c.1731C>G0.976
rpoB761555c.1749G>C0.960
rpoB761558c.1752C>G0.962
rpoB761564c.1758G>C0.965
rpoB761570c.1764T>C0.949
rpoB761573c.1767C>G0.950
rpoB761579c.1773G>C0.984
rpoB761612c.1806G>T0.985
rpoB761615c.1809A>C0.985
rpoB761636c.1830G>T0.982
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761891c.2085G>C1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A0.952
rpoB761930c.2124G>C0.955
rpoB761933c.2127G>C0.955
rpoB761936c.2130C>T0.955
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val0.970
rpoB761969c.2163G>A0.974
rpoB761990c.2184G>C0.980
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T0.980
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T0.953
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A0.926
rpoB762137c.2331C>T0.926
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C0.962
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C0.967
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C0.971
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C0.920
rpoB762410c.2604T>G0.933
rpoB762416c.2610A>G0.935
rpoB762449c.2643C>A0.941
rpoB762452c.2646G>C0.912
rpoB762470c.2664G>C0.886
rpoB762488c.2682G>C0.939
rpoB762491c.2685T>C0.931
rpoB762509c.2703T>G0.760
rpoB762510p.Ala902Pro0.750
rpoB762515c.2709C>T0.850
rpoB762533c.2727T>C0.857
rpoB762536c.2730T>C0.857
rpoB762537c.2731T>C0.857
rpoB762551c.2745C>T0.833
rpoB762827c.3021G>C0.929
rpoB762830c.3024C>G0.944
rpoB762857c.3051C>G0.962
rpoB762860c.3054G>C0.962
rpoB762863c.3057T>C0.963
rpoB762866c.3060C>T0.966
rpoB762879p.Met1025Leu0.976
rpoB762894c.3088C>T0.977
rpoB762899c.3093G>C0.979
rpoB762917c.3111C>G0.964
rpoB762920c.3114C>T0.964
rpoB762923c.3117C>G0.963
rpoB762929c.3123G>C0.964
rpoB762959c.3153G>C0.968
rpoB762962c.3156C>T0.969
rpoB762995c.3189G>T0.968
rpoB763031c.3225T>G0.981
rpoB763034c.3228C>G0.964
rpoB763040c.3234C>G0.963
rpoB763070c.3264T>C0.980
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C0.980
rpoB763127c.3321G>C0.979
rpoB763136c.3330C>T0.978
rpoB763145c.3339G>A0.977
rpoB763157c.3351G>T0.950
rpoB763166c.3360A>G0.974
rpoB763172c.3366G>C0.946
rpoB763193c.3387C>G0.935
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C0.944
rpoC763699c.330G>T0.938
rpoC763702c.333C>G0.938
rpoC763708c.339G>C0.938
rpoC763711c.342G>C0.938
rpoC763714c.345G>C0.938
rpoC763717c.348T>C0.938
rpoC763723c.354G>C0.938
rpoC763732c.363C>A0.929
rpoC763741c.372C>T0.923
rpoC763744c.375G>C0.923
rpoC763747c.378G>A0.923
rpoC763765c.396T>C0.900
rpoC763888c.519G>T1.000
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T0.973
rpoC763940p.Ala191Ser0.947
rpoC763947p.Ala193Val0.947
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T0.947
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T0.963
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser0.963
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp0.955
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T0.976
rpoC764059c.690G>T1.000
rpoC764083c.714A>G0.976
rpoC764084p.Asn239Val0.952
rpoC764095c.726C>T0.976
rpoC764098c.729A>G0.976
rpoC764110c.741C>T0.976
rpoC764143c.774G>C0.963
rpoC764147p.Ser260Ala0.963
rpoC764150p.Ile261Val0.963
rpoC764165p.Glu266Gln0.960
rpoC764176c.807C>T0.900
rpoC764177p.Ile270Leu0.800
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764470c.1101C>T1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G0.983
rpoC764530c.1161C>G0.980
rpoC764534c.1165C>A0.980
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T0.977
rpoC764545c.1176C>A0.978
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G0.982
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T0.983
rpoC764632c.1263T>C0.982
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T0.967
rpoC764716c.1347G>C0.984
rpoC764746c.1377G>T0.983
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G0.983
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.964
rpoC764803c.1434C>T0.981
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.977
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C0.978
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C0.875
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G0.867
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C0.900
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C0.900
rpoC765103c.1734G>T1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C0.933
rpoC765382c.2013G>T0.933
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C0.952
rpoC765405p.Leu679His0.952
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser0.952
rpoC765454c.2085C>G0.951
rpoC765469c.2100G>C0.962
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe0.962
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G0.976
rpoC765533p.Tyr722His0.976
rpoC765544c.2175C>G0.941
rpoC765547c.2178C>T0.938
rpoC765548c.2179A>T0.938
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T0.938
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T0.917
rpoC765861p.Phe831Tyr0.929
rpoC765875p.Val836Ile0.944
rpoC765886c.2517C>T1.000
rpoC765907c.2538G>T0.981
rpoC765910c.2541G>C0.981
rpoC765928c.2559C>G0.979
rpoC765940c.2571A>T0.978
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C0.941
rpoC766009c.2640G>C0.917
rpoC766012c.2643C>G0.900
rpoC766321c.2952C>G0.929
rpoC766333c.2964G>T0.933
rpoC766345c.2976T>C0.933
rpoC766348c.2979A>G0.933
rpoC766351c.2982C>G0.933
rpoC766353p.Val995Ala0.933
rpoC766369c.3000C>G0.960
rpoC766375c.3006C>G0.962
rpoC766381c.3012C>T0.963
rpoC766384c.3015A>G0.964
rpoC766390c.3021C>T0.968
rpoC766393c.3024C>T0.968
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp0.939
rpoC766501c.3132G>C0.750
rpoC766507c.3138C>T0.750
rpoC766513c.3144C>T0.800
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G0.133
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G0.867
rpoC766537c.3168G>A0.882
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C0.970
rpoC766573c.3204T>G1.000
rpoC766588c.3219G>A0.970
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T0.941
rpoC766624c.3255G>C0.941
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C0.931
rpoC766792c.3423C>G0.900
rpoC766799p.Ala1144Ser0.900
rpoC766804c.3435A>G0.900
rpoC766858c.3489C>T0.900
rpoC766861c.3492G>C0.900
rpoC766867c.3498C>G0.900
rpoC766876c.3507C>T0.900
rpoC766921c.3552G>C0.818
rpoC766931p.Ala1188Ser0.951
rpoC766942c.3573C>T0.959
rpoC766945c.3576A>C0.962
rpoC766963c.3594T>C0.952
rpoC766996c.3627C>T0.961
rpoC767002c.3633G>C0.974
rpoC767008c.3639G>A0.975
rpoC767023c.3654C>T0.962
rpoC767044c.3675G>C0.949
rpoC767080c.3711G>C0.969
rpoC767098c.3729T>C0.983
rpoC767104c.3735C>G0.967
rpoC767107c.3738C>T0.966
rpoC767119c.3750A>G0.983
rpoC767125c.3756G>C0.964
rpoC767134c.3765C>T0.981
rpoC767138c.3769C>T0.945
rpoC767149c.3780C>T0.947
rpoC767158c.3789T>C0.981
rpoC767179c.3810C>T0.966
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A0.981
rpoC767203c.3834C>G0.977
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C0.979
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C0.974
rpsL781832c.273T>C0.976
rpsL781859c.300T>C0.951
rpsL781868c.309T>C0.974
rpsL781871c.312G>C0.974
rpsL781877c.318T>A0.971
rpsL781892c.333A>G0.943
rpsL781898c.339A>T0.939
rpsL781907c.348T>C0.926
rpsL781916c.357T>C0.926
rpsL781929p.Gly124Ser0.909
rpsL781933374G>A0.833
rrs1471922r.77gt>g0.980
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g0.959
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.961
rrs1471986r.141c>t0.961
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a0.957
rrs1472108r.263c>t1.000
rrs1472113r.268t>c0.958
rrs1472150r.305t>a0.967
rrs1472251r.406g>a1.000
rrs1472337r.492c>g0.971
rrs1472380r.535g>c0.978
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g0.977
rrs1472612r.767g>t1.000
rrs1472734r.889c>t0.957
rrs1472741r.896g>a0.958
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t0.983
rrs1472861r.1016g>a0.983
rrs1472956r.1111t>c0.959
rrs1472957r.1112c>t0.959
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a0.981
rrs1472990r.1145a>g0.981
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.931
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t0.983
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t0.960
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t0.960
rrl1473684r.27g>a0.941
rrl1473697r.40c>a0.944
rrl1473707r.50t>a0.966
rrl1473717r.60g>a0.968
rrl1473731r.74t>a0.943
rrl1473746r.89t>c0.949
rrl1473756r.99g>t0.976
rrl1473758r.101g>t0.977
rrl1473770r.113t>c0.959
rrl1473806r.149c>t0.981
rrl1473812r.155g>a0.956
rrl1473814r.157a>t0.956
rrl1473815r.158t>g0.956
rrl1473829r.172g>c0.952
rrl1473831r.174g>t0.949
rrl1473832r.175c>t0.949
rrl1473839r.182g>a0.957
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a0.967
rrl1473923r.266c>g0.957
rrl1473937r.280c>t0.957
rrl1473943r.286g>t0.950
rrl1473945r.288t>a0.950
rrl1473946r.289a>t0.950
rrl1473950r.293g>t0.905
rrl1474074r.417c>t0.917
rrl1474089r.432c>t0.923
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.814
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474306r.649a>c0.964
rrl1474308r.651g>t0.964
rrl1474310r.653t>g0.964
rrl1474356r.699t>c0.982
rrl1474362r.705a>g0.982
rrl1474387r.730c>t0.982
rrl1474413r.756a>c0.973
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.973
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c0.967
rrl1474632r.975g>t0.955
rrl1474636r.979a>t0.955
rrl1474637r.980c>t0.955
rrl1474638r.981c>g0.955
rrl1474639r.982g>t0.977
rrl1474640r.983c>t0.955
rrl1474717r.1060a>g0.970
rrl1474722r.1065t>c0.971
rrl1474743r.1086t>g0.981
rrl1474760r.1103a>g0.981
rrl1474794r.1137c>t0.982
rrl1474803r.1146g>a0.983
rrl1474812r.1155g>a0.983
rrl1474830r.1173a>g0.984
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475060r.1403ac>a1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c0.943
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t0.931
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a0.962
rrl1475452r.1795c>a0.964
rrl1475475r.1818c>t0.971
rrl1475479r.1822c>t0.971
rrl1475480r.1823a>t0.971
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t0.970
rrl1475573r.1916g>a0.958
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a0.955
rrl1475760r.2103ccg>c0.979
rrl1475764r.2107a>t0.973
rrl1475765r.2108a>t0.973
rrl1475975r.2318c>t0.900
rrl1475977r.2320a>g0.897
rrl1475988r.2331a>g0.923
rrl1475989r.2332t>c0.846
rrl1475993r.2336c>t0.846
rrl1475997r.2340a>t0.880
rrl1476085r.2428g>a0.750
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c0.750
rrl1476089r.2432t>c0.250
rrl1476095r.2438c>g0.250
rrl1476099r.2442a>g0.750
rrl1476103r.2446c>g0.750
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c0.750
rrl1476114r.2457t>c0.750
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t0.865
rrl1476160r.2503t>c0.891
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t0.905
rrl1476221r.2564t>c0.895
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c0.949
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t0.972
rrl1476299r.2642c>t0.973
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t0.974
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a0.958
rrl1476666r.3009c>t0.958
rrl1476674r.3017t>c0.955
inhA1674855c.654C>G0.769
inhA1674858c.657G>A0.800
inhA1674876c.675C>T0.833
inhA1674879c.678T>C0.882
inhA1674892p.Asn231Asp0.938
inhA1674903c.702T>C0.938
inhA1674904p.Ala235Pro0.938
inhA1674909c.708G>A0.938
inhA1674912c.711G>C0.938
inhA1674915c.714C>G0.938
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
inhA1674993c.792G>T1.000
rpsA1833536c.-6A>C0.957
rpsA1833538c.-4CA>C0.957
rpsA1833541c.-1T>C0.958
rpsA1833547c.6G>A0.960
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala0.953
rpsA1833604c.63C>T0.959
rpsA1833616c.75A>T0.966
rpsA1833619c.78A>C0.967
rpsA1833625c.84A>G0.969
rpsA1833664c.123C>G0.948
rpsA1833676c.135A>G0.935
rpsA1833679c.138G>T0.933
rpsA1833685c.144G>C0.933
rpsA1833691c.150G>A0.930
rpsA1833694c.153G>T0.927
rpsA1833697c.156C>T0.927
rpsA1833700c.159C>T0.927
rpsA1833709c.168C>T0.957
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.971
rpsA1833734p.Ala65Ser0.971
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.980
rpsA1833832c.291G>A0.979
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T0.983
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G0.984
rpsA1833894p.Ala118Glu0.984
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T0.983
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T0.980
rpsA1834012c.471G>C0.979
rpsA1834015c.474G>C0.980
rpsA1834021c.480C>T0.981
rpsA1834030c.489C>G0.980
rpsA1834033c.492C>T0.978
rpsA1834073p.Lys178Arg0.971
rpsA1834096c.555G>C0.969
rpsA1834099c.558C>G0.968
rpsA1834108c.567C>G0.966
rpsA1834114c.573G>C0.966
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G0.981
rpsA1834234c.693G>T0.981
rpsA1834240c.699T>C0.981
rpsA1834246c.705G>T0.980
rpsA1834249c.708T>C0.980
rpsA1834252c.711C>G0.980
rpsA1834261c.720A>G0.983
rpsA1834264c.723G>C0.983
rpsA1834279c.738C>T0.984
rpsA1834294c.753G>T0.983
rpsA1834297c.756C>T0.983
rpsA1834303c.762T>G0.984
rpsA1834306c.765T>C0.983
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T0.984
rpsA1834451c.910T>C0.986
rpsA1834456c.915T>G0.986
rpsA1834468c.927A>G0.986
rpsA1834477c.936C>T0.986
rpsA1834489c.948T>C0.986
rpsA1834519c.978G>C0.980
rpsA1834520p.Ala327Ser0.980
rpsA1834528c.987T>C0.980
rpsA1834534c.993C>T0.960
rpsA1834543c.1002C>G0.960
rpsA1834546c.1005T>C0.959
rpsA1834552c.1011G>T0.939
rpsA1834555c.1014T>G0.958
rpsA1834557p.Ala339Gly0.958
rpsA1834606c.1065C>T0.986
rpsA1834609c.1068T>C0.985
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C0.983
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T0.977
rpsA1834776p.Ala412Glu0.977
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T0.944
rpsA1834830p.Ala430Val0.926
kasA2518738c.624G>C0.962
kasA2518756c.642G>C0.968
kasA2518768c.654C>G0.968
kasA2518771c.657C>G0.968
kasA2518774c.660C>T0.968
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044233p.Cys17His0.977
panD4044234c.48G>C0.977
panD4044249c.33G>A0.977
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C0.977
embC4240772p.Ser304Ala0.977
embC4240778p.His306Gly0.976
embC4240781p.Ala307Ser0.976
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser0.981
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr0.968
embC4240859p.Leu333Ile0.966
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C0.900
embB4248232c.1719G>T0.900
embB4248233p.Leu574Val0.900
embB4248236p.Met575Leu0.909
embB4248245p.Ile578Val0.955
embB4248250c.1737C>T0.926
embB4248259p.Met582Ile0.929
embB4248275p.Thr588Ala0.929
embB4248292c.1779G>A0.929

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;