TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c43f9a4295
Sample: 5d2c43f9a4295

Download results

Summary
ID: 5d2c43f9a4295
Date: Mon Jul 15 10:17:17 2019
Strain: lineage2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.977
gyrB6775c.1536G>C0.977
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrA7496c.195C>G0.952
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T0.955
gyrA7553c.252C>T0.933
gyrA7559c.258G>C0.957
gyrA7565c.264C>T0.958
gyrA7574c.273G>C0.962
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.964
gyrA7595c.294C>T0.964
gyrA7607c.306C>T0.961
gyrA7637c.336C>A0.950
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T0.909
gyrA8576c.1275C>G0.929
gyrA8580p.Ile427Val0.938
gyrA8603c.1302A>C0.944
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G0.944
gyrA8636c.1335A>C0.944
gyrA8642c.1341A>G0.944
gyrA8645c.1344C>G0.944
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C0.944
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C0.938
gyrA8696c.1395G>C0.938
gyrA8699c.1398A>G0.933
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T0.972
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T0.968
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C0.973
rpoB760184c.378A>G0.973
rpoB760193c.387C>G0.969
rpoB760196c.390C>G0.966
rpoB760197p.Ala131Thr0.966
rpoB760235c.429T>C0.970
rpoB760244c.438G>C0.969
rpoB760256c.450C>T0.966
rpoB760274p.Glu156Asp0.957
rpoB760276p.Lys157Met0.952
rpoB760283c.477G>C0.952
rpoB760298c.492G>C0.947
rpoB760307c.501T>C0.882
rpoB760357p.Thr184Ser0.938
rpoB760361c.555T>C1.000
rpoB760370c.564C>G0.958
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C0.963
rpoB760388c.582C>T0.966
rpoB760400c.594G>C0.971
rpoB760406c.600G>C0.947
rpoB760407p.Ser201Gly0.976
rpoB760415c.609C>T0.977
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C0.980
rpoB760561252MRS>252MMG1.000
rpoB760567r.761cg>c1.000
rpoB760571c.765G>C0.964
rpoB760588p.Thr261Ile0.972
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro0.973
rpoB760608c.802C>T0.978
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala0.971
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760805c.999G>C0.909
rpoB760817c.1011A>G0.933
rpoB760820c.1014T>C0.875
rpoB760826c.1020C>G0.889
rpoB760830c.1024T>C0.895
rpoB760841c.1035T>C0.917
rpoB760858p.Val351Ala0.923
rpoB760862c.1056G>C0.923
rpoB760865c.1059C>T0.885
rpoB760886p.Glu360Asp0.935
rpoB760887p.Thr361Val0.935
rpoB760910c.1104C>T0.972
rpoB760916c.1110C>T0.972
rpoB760928c.1122G>C0.971
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C0.957
rpoB760973c.1167G>T0.952
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G0.882
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T0.800
rpoB761054c.1248G>C0.800
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G0.762
rpoB761063c.1257C>G0.750
rpoB761064p.Ala420Ser0.200
rpoB761084c.1278C>A0.710
rpoB761097c.1291A>T0.935
rpoB761102c.1296A>G0.941
rpoB761132c.1326G>C0.150
rpoB761133c.1327T>C0.951
rpoB761147c.1341C>T0.780
rpoB761150c.1344A>T0.146
rpoB761165c.1359G>C0.921
rpoB761171c.1365C>T0.912
rpoB761178p.Ser458Thr0.879
rpoB761186p.Glu460Asp0.879
rpoB761189c.1383T>C0.909
rpoB761195c.1389G>C0.919
rpoB761198c.1392G>C0.923
rpoB761219c.1413G>C0.922
rpoB761234c.1428G>C0.960
rpoB761249c.1443A>G0.960
rpoB761255c.1449T>G0.956
rpoB761258c.1452G>A0.956
rpoB761261c.1455G>C0.956
rpoB761264c.1458C>G0.938
rpoB761273c.1467T>C0.967
rpoB761303c.1497G>C1.000
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T0.810
rpoB761531c.1725C>T0.810
rpoB761537c.1731C>G1.000
rpoB761552c.1746G>C0.208
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G0.800
rpoB761564c.1758G>C0.786
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.719
rpoB761579c.1773G>C0.818
rpoB761612c.1806G>T0.128
rpoB761615c.1809A>C0.105
rpoB761622p.Gln606Met0.108
rpoB761627c.1821C>T0.111
rpoB761636c.1830G>T0.853
rpoB761645c.1839C>G0.964
rpoB761657c.1851C>T0.963
rpoB761666c.1860G>C0.933
rpoB761669c.1863C>T0.933
rpoB761675c.1869G>T0.917
rpoB761681c.1875G>A0.917
rpoB761682c.1876C>T0.917
rpoB761687c.1881C>T0.917
rpoB761690c.1884G>C0.917
rpoB761693c.1887G>C0.917
rpoB761705c.1899C>A0.917
rpoB761909c.2103T>C0.929
rpoB761912c.2106T>C0.929
rpoB761915p.Asp703Glu0.929
rpoB761916p.Asp704Asn0.929
rpoB761924c.2118G>A0.933
rpoB761930c.2124G>C0.933
rpoB761933c.2127G>C0.938
rpoB761936c.2130C>T0.938
rpoB761948c.2142G>C0.958
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A0.955
rpoB761990c.2184G>C0.958
rpoB762008c.2202C>T0.959
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T0.945
rpoB762047c.2241G>A0.943
rpoB762053c.2247T>C0.978
rpoB762056c.2250G>A0.935
rpoB762065c.2259T>G0.976
rpoB762083c.2277T>C0.979
rpoB762086c.2280G>C0.939
rpoB762101c.2295C>G0.977
rpoB762114p.Ile770Val0.976
rpoB762122c.2316C>T0.971
rpoB762131c.2325C>G0.900
rpoB762134c.2328C>A0.897
rpoB762137c.2331C>T0.897
rpoB762140c.2334G>C0.967
rpoB762143c.2337T>C0.969
rpoB762149c.2343G>T0.974
rpoB762158c.2352G>C0.976
rpoB762167c.2361T>C0.864
rpoB762176c.2370T>C0.898
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762209c.2403C>G0.125
rpoB762212c.2406G>C0.127
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762251c.2445G>C0.115
rpoB762254c.2448T>C0.117
rpoB762257c.2451C>G0.119
rpoB762275c.2469C>T0.135
rpoB762284c.2478G>C0.854
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C0.842
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G0.935
rpoB762510p.Ala902Pro0.935
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G0.944
rpoB762857c.3051C>G0.906
rpoB762860c.3054G>C0.906
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T0.922
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C0.932
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T0.960
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T0.946
rpoB763145c.3339G>A0.917
rpoB763157c.3351G>T0.935
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C0.964
rpoB763193c.3387C>G1.000
rpoC763402c.33C>T0.882
rpoC763408c.39T>C0.882
rpoC763411c.42T>C0.882
rpoC763414c.45T>G0.882
rpoC763415p.Thr16Ser0.882
rpoC763423p.Glu18Asp0.882
rpoC763430c.61A>C0.882
rpoC763433p.Gln22Asn0.882
rpoC763443p.Tyr25Phe0.900
rpoC763450c.81G>A0.938
rpoC763456c.87A>G0.970
rpoC763468c.99G>C0.975
rpoC763486c.117T>C0.979
rpoC763492c.123G>C0.980
rpoC763504c.135C>A0.122
rpoC763507c.138G>C0.122
rpoC763528c.159G>A0.132
rpoC763531c.162G>T0.846
rpoC763534c.165T>C0.127
rpoC763537c.168C>G0.127
rpoC763546c.177A>G1.000
rpoC763570c.201G>C0.145
rpoC763573c.204G>C0.158
rpoC763594c.225C>T1.000
rpoC763615c.246G>C0.113
rpoC763618c.249C>T0.141
rpoC763633c.264T>C0.867
rpoC763657c.288G>A0.898
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G0.902
rpoC763675c.306C>G0.897
rpoC763696c.327T>C0.955
rpoC763699c.330G>T0.136
rpoC763702c.333C>G0.955
rpoC763708c.339G>C0.955
rpoC763711c.342G>C0.955
rpoC763714c.345G>C0.955
rpoC763717c.348T>C0.955
rpoC763723c.354G>C0.818
rpoC763729c.360G>C0.136
rpoC763732c.363C>A0.158
rpoC763741c.372C>T0.765
rpoC763744c.375G>C0.765
rpoC763747c.378G>A0.941
rpoC763751p.Ile128Val0.176
rpoC763900c.531G>C0.966
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C0.952
rpoC764029p.Glu220Asp0.952
rpoC764032p.Asp221Glu0.955
rpoC764040p.Ser224Thr0.971
rpoC764044c.675T>C0.971
rpoC764054c.685C>T0.973
rpoC764059c.690G>T0.971
rpoC764083c.714A>G0.971
rpoC764084p.Asn239Val0.971
rpoC764095c.726C>T0.971
rpoC764098c.729A>G0.971
rpoC764110c.741C>T0.971
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G0.917
rpoC764317c.948C>G0.857
rpoC764320c.951C>G0.938
rpoC764338c.969G>A0.952
rpoC764353c.984G>T0.917
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C0.950
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764470c.1101C>T1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T0.952
rpoC764524c.1155C>G0.943
rpoC764530c.1161C>G0.967
rpoC764534c.1165C>A0.935
rpoC764539c.1170C>T0.966
rpoC764542c.1173C>T0.933
rpoC764545c.1176C>A0.966
rpoC764560c.1191T>C0.844
rpoC764566c.1197C>G0.130
rpoC764575c.1206T>G0.149
rpoC764581c.1212T>C0.143
rpoC764582p.Leu405Met0.143
rpoC764605c.1236G>C0.189
rpoC764611c.1242G>T0.982
rpoC764626c.1257C>T0.778
rpoC764632c.1263T>C0.782
rpoC764635c.1266C>G0.207
rpoC764644c.1275G>C0.135
rpoC764646p.Gly426Ala0.137
rpoC764650c.1281G>T0.981
rpoC764653c.1284G>C0.125
rpoC764656c.1287C>G0.136
rpoC764662c.1293G>C0.133
rpoC764668c.1299C>T0.983
rpoC764671c.1302G>A0.143
rpoC764692c.1323C>T0.817
rpoC764701c.1332C>G0.150
rpoC764705p.Leu446Ala0.150
rpoC764713c.1344G>T0.729
rpoC764716c.1347G>C0.746
rpoC764722c.1353G>C0.203
rpoC764746c.1377G>T0.190
rpoC764752c.1383G>C0.814
rpoC764758c.1389C>G0.949
rpoC764764c.1395T>C0.935
rpoC764791c.1422C>G0.870
rpoC764803c.1434C>T0.948
rpoC764809c.1440C>T0.944
rpoC764810p.Pro481Ala0.944
rpoC764815c.1446A>G0.947
rpoC764824c.1455T>C0.931
rpoC764827c.1458G>C0.949
rpoC764858c.1489T>C0.968
rpoC764869c.1500C>T0.889
rpoC764875c.1506C>A0.883
rpoC764887c.1518G>C0.948
rpoC764888c.1519T>C0.965
rpoC764911c.1542A>G0.953
rpoC764912p.Met515Gln0.952
rpoC764932c.1563C>A0.936
rpoC764948c.1579T>C0.976
rpoC764968c.1599T>C0.978
rpoC765004c.1635G>C0.958
rpoC765007c.1638T>G0.955
rpoC765008c.1639T>C0.955
rpoC765011c.1642A>T0.955
rpoC765016c.1647C>G0.955
rpoC765019c.1650A>G0.955
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C0.957
rpoC765405p.Leu679His0.957
rpoC765409c.2040T>G0.960
rpoC765421c.2052C>G0.971
rpoC765449p.Ala694Ser0.974
rpoC765454c.2085C>G0.974
rpoC765469c.2100G>C0.977
rpoC765478c.2109T>G0.976
rpoC765480p.Tyr704Phe0.976
rpoC765499c.2130C>G0.950
rpoC765517c.2148C>G0.967
rpoC765533p.Tyr722His0.958
rpoC765544c.2175C>G0.917
rpoC765547c.2178C>T0.909
rpoC765548c.2179A>T0.909
rpoC765553c.2184C>T0.909
rpoC765556c.2187G>C0.909
rpoC765562c.2193G>T0.909
rpoC765826c.2457T>C0.963
rpoC765835c.2466C>T0.968
rpoC765841c.2472G>T0.970
rpoC765861p.Phe831Tyr0.977
rpoC765875p.Val836Ile0.980
rpoC765886c.2517C>T0.982
rpoC765907c.2538G>T0.980
rpoC765910c.2541G>C0.980
rpoC765928c.2559C>G0.977
rpoC765940c.2571A>T0.977
rpoC765947c.2578T>C0.975
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766333c.2964G>T0.769
rpoC766345c.2976T>C0.786
rpoC766348c.2979A>G0.929
rpoC766351c.2982C>G0.929
rpoC766353p.Val995Ala0.786
rpoC766369c.3000C>G0.875
rpoC766375c.3006C>G0.880
rpoC766381c.3012C>T0.962
rpoC766384c.3015A>G0.962
rpoC766390c.3021C>T0.889
rpoC766393c.3024C>T0.889
rpoC766408c.3039C>T0.964
rpoC766435p.Glu1022Asp0.929
rpoC766501c.3132G>C0.900
rpoC766507c.3138C>T0.909
rpoC766513c.3144C>T0.923
rpoC766522c.3153C>A0.933
rpoC766528c.3159T>G0.933
rpoC766531c.3162G>C0.933
rpoC766534c.3165C>G0.933
rpoC766537c.3168G>A0.933
rpoC766540p.Asp1057Glu0.933
rpoC766549c.3180G>C0.957
rpoC766570c.3201T>C0.957
rpoC766573c.3204T>G0.957
rpoC766588c.3219G>A0.955
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C0.950
rpoC766633c.3264G>C0.950
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T0.923
rpoC766861c.3492G>C0.923
rpoC766867c.3498C>G0.923
rpoC766876c.3507C>T0.923
rpoC766931p.Ala1188Ser0.963
rpoC766942c.3573C>T0.969
rpoC766945c.3576A>C0.971
rpoC766963c.3594T>C0.975
rpoC766996c.3627C>T0.979
rpoC767002c.3633G>C0.980
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C0.980
rpoC767080c.3711G>C0.978
rpoC767098c.3729T>C0.977
rpoC767104c.3735C>G0.978
rpoC767107c.3738C>T0.977
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.958
rpsL781572p.Gln5Asn0.964
rpsL781586c.27C>T0.971
rpsL781595c.36T>C0.972
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T0.926
rpsL781817c.258G>T1.000
rpsL781829c.270G>C0.903
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A0.889
rpsL781892c.333A>G1.000
rpsL781898c.339A>T0.125
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933c.374G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.971
rrs1471986r.141c>t0.971
rrs1472030r.185g>a0.929
rrs1472031r.186g>c0.929
rrs1472032r.187g>a0.929
rrs1472033r.188a>c0.929
rrs1472035r.190g>t0.929
rrs1472040r.195t>g0.929
rrs1472041r.196c>t0.929
rrs1472042r.197t>g0.929
rrs1472043r.198t>a0.929
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c0.376
rrs1472148r.303t>c0.612
rrs1472150r.305t>a1.000
rrs1472172r.327t>c0.663
rrs1472225r.380c>a0.609
rrs1472251r.406g>a0.989
rrs1472286r.441c>g0.909
rrs1472327r.482g>a0.273
rrs1472328r.483g>c0.917
rrs1472337r.492c>g0.292
rrs1472338r.493a>g0.703
rrs1472344r.499c>t0.690
rrs1472379r.534t>c0.679
rrs1472380r.535g>c0.321
rrs1472382r.537g>a0.688
rrs1472400r.555c>t0.612
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472530r.685g>a0.494
rrs1472571r.726g>a0.580
rrs1472581r.736a>c0.575
rrs1472582r.737g>a0.570
rrs1472584r.739a>t0.577
rrs1472612r.767g>t0.303
rrs1472655r.810g>t0.580
rrs1472660r.815t>a0.557
rrs1472670r.825g>t0.364
rrs1472673r.828t>c0.316
rrs1472674r.829t>g0.316
rrs1472675r.830t>a0.316
rrs1472677r.832c>a0.310
rrs1472682r.837t>a0.295
rrs1472683r.838t>c0.295
rrs1472685r.840g>t0.310
rrs1472686r.841g>c0.310
rrs1472687r.842a>g0.310
rrs1472690r.845c>g0.328
rrs1472697r.852t>c0.506
rrs1472714r.869a>t0.549
rrs1472734r.889c>t0.400
rrs1472741r.896g>a0.442
rrs1472779r.934g>a0.490
rrs1472793r.948a>c0.468
rrs1472803r.958t>c0.432
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472955r.1110c>t0.208
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472958r.1113a>g0.200
rrs1472969r.1124a>g0.783
rrs1472970r.1125c>g0.783
rrs1472972r.1127t>g0.217
rrs1472973r.1128a>g0.217
rrs1472974r.1129a>g0.217
rrs1472977r.1132g>a0.217
rrs1472978r.1133t>c0.783
rrs1472987r.1142g>a0.196
rrs1472988r.1143t>c0.200
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473026r.1181t>c0.602
rrs1473055r.1210c>t0.583
rrs1473056r.1211a>t0.583
rrs1473062r.1217t>g0.589
rrs1473068r.1223a>g0.622
rrs1473082r.1237g>a0.351
rrs1473088r.1243a>g0.340
rrs1473089r.1244a>t0.652
rrs1473091r.1246g>a0.656
rrs1473099r.1254t>a0.264
rrs1473104r.1259c>t0.250
rrs1473105r.1260g>a0.250
rrs1473109r.1264t>c0.683
rrs1473110r.1265t>g0.963
rrs1473111r.1266a>g0.963
rrs1473120r.1275c>t0.652
rrs1473121r.1276t>c0.955
rrs1473122r.1277t>a0.656
rrs1473123r.1278a>t0.287
rrs1473129r.1284c>t0.302
rrs1473145r.1300c>t0.967
rrs1473166r.1321g>a0.987
rrs1473179r.1334c>t0.629
rrs1473201r.1356a>t0.582
rrs1473202r.1357c>t0.582
rrs1473252r.1407t>c0.639
rrs1473276r.1431a>g0.643
rrs1473283r.1438t>c0.659
rrs1473288r.1443c>t0.329
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t0.329
rrs1473315r.1470t>c0.581
rrs1473316r.1471c>t0.588
rrl1473684r.27g>a0.933
rrl1473697r.40c>a0.933
rrl1473707r.50t>a0.957
rrl1473717r.60g>a0.960
rrl1473731r.74t>a0.967
rrl1473746r.89t>c0.975
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a0.980
rrl1473887r.230t>c0.977
rrl1473888r.231t>c0.976
rrl1473898r.241c>t0.971
rrl1473899r.242a>g0.971
rrl1473916r.259c>a0.968
rrl1473923r.266c>g0.960
rrl1473937r.280c>t0.958
rrl1473943r.286g>t0.933
rrl1473945r.288t>a0.933
rrl1473946r.289a>t0.933
rrl1473950r.293g>t0.933
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t0.967
rrl1474140r.483c>t0.970
rrl1474151r.494c>t1.000
rrl1474153r.496c>g0.316
rrl1474166r.509g>c0.408
rrl1474179r.522c>t0.423
rrl1474183r.526t>c0.441
rrl1474184r.527c>t0.441
rrl1474186r.529a>g0.943
rrl1474232r.575c>g0.448
rrl1474239r.582g>c0.439
rrl1474249r.592g>t0.956
rrl1474263r.606g>a0.534
rrl1474282r.625g>a0.956
rrl1474306r.649a>c0.969
rrl1474308r.651g>t0.969
rrl1474310r.653t>g0.971
rrl1474356r.699t>c0.978
rrl1474362r.705a>g0.976
rrl1474387r.730c>t1.000
rrl1474411r.754cg>c1.000
rrl1474413r.756a>c0.957
rrl1474414r.757cccacacgcgcatacgcgcgtgtg>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474416r.759cacacgcgcatacgcgcgtgtga>c1.000
rrl1474476r.819c>g0.128
rrl1474483r.826c>g0.130
rrl1474488r.831g>t0.130
rrl1474494r.837c>cg0.739
rrl1474496r.839c>g0.976
rrl1474497r.840g>a0.140
rrl1474506r.849c>t0.140
rrl1474507r.850g>t0.136
rrl1474516r.859c>a0.130
rrl1474527r.870t>c0.130
rrl1474528r.871t>a0.130
rrl1474529r.872a>g0.128
rrl1474537r.880g>a0.128
rrl1474540r.883t>c0.122
rrl1474541r.884g>t0.122
rrl1474542r.885a>g0.128
rrl1474551r.894g>c0.526
rrl1474558r.901g>t0.554
rrl1474626r.969t>c1.000
rrl1474628r.971c>t0.396
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>c0.442
rrl1474640r.983c>t0.558
rrl1474660r.1003g>a0.339
rrl1474662r.1005c>g0.339
rrl1474676r.1019t>c0.365
rrl1474677r.1020a>g0.373
rrl1474688r.1031g>c0.333
rrl1474690r.1033c>t0.333
rrl1474710r.1053tggtg>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474734r.1077g>t0.233
rrl1474736r.1079c>t0.267
rrl1474743r.1086t>g0.714
rrl1474751r.1094g>a0.259
rrl1474754r.1097c>g0.275
rrl1474760r.1103a>g1.000
rrl1474777r.1120t>g0.339
rrl1474779r.1122g>a0.317
rrl1474780r.1123c>t0.312
rrl1474783r.1126g>a0.323
rrl1474794r.1137c>t1.000
rrl1474801r.1144g>a0.373
rrl1474802r.1145t>c0.378
rrl1474803r.1146g>a0.590
rrl1474812r.1155g>a0.582
rrl1474823r.1166c>g0.432
rrl1474830r.1173a>g0.568
rrl1474831r.1174a>g0.437
rrl1474904r.1247g>c0.398
rrl1474905r.1248t>c0.402
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t0.552
rrl1474933r.1276a>g0.439
rrl1474934r.1277c>t0.439
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t0.529
rrl1475129r.1472g>a1.000
rrl1475175r.1518g>c0.592
rrl1475188r.1531c>g0.597
rrl1475202r.1545g>c0.952
rrl1475209r.1552g>a0.947
rrl1475213r.1556c>t0.947
rrl1475220r.1563g>t0.944
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a0.957
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t0.963
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t0.963
rrl1475499r.1842c>t0.508
rrl1475505r.1848g>a0.452
rrl1475508r.1851a>t0.532
rrl1475526r.1869c>a0.984
rrl1475531r.1874c>t0.438
rrl1475532r.1875a>g0.547
rrl1475539r.1882a>t0.538
rrl1475542r.1885a>g0.547
rrl1475544r.1887a>t0.547
rrl1475545r.1888t>g0.547
rrl1475573r.1916g>a0.303
rrl1475649r.1992a>g1.000
rrl1475655r.1998t>c0.457
rrl1475659r.2002g>a1.000
rrl1475696r.2039t>c0.449
rrl1475699r.2042c>t0.451
rrl1475703r.2046a>g0.456
rrl1475740r.2083g>c0.411
rrl1475747r.2090a>g0.384
rrl1475753r.2096c>g0.235
rrl1475760r.2103c>g0.206
rrl1475760r.2103ccg>c0.778
rrl1475761r.2104c>t0.722
rrl1475764r.2107a>t0.759
rrl1475765r.2108a>c0.220
rrl1475775r.2118g>t0.425
rrl1475781r.2124t>c0.449
rrl1475788r.2131c>g0.478
rrl1475883r.2226a>g0.583
rrl1475900r.2243a>g0.529
rrl1475902r.2245t>c0.545
rrl1475906r.2249c>t0.561
rrl1475937r.2280a>t0.527
rrl1475943r.2286g>a0.505
rrl1475952r.2295a>g0.500
rrl1475970r.2313c>t0.328
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475978r.2321c>t0.339
rrl1475982r.2325g>a0.357
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c0.545
rrl1475993r.2336c>t0.545
rrl1475997r.2340a>t1.000
rrl1476001r.2344t>c0.455
rrl1476025r.2368g>t0.148
rrl1476085r.2428g>a0.944
rrl1476086r.2429g>a0.944
rrl1476088r.2431a>c0.944
rrl1476099r.2442a>g0.944
rrl1476103r.2446c>g0.944
rrl1476105r.2448g>a0.944
rrl1476106r.2449a>t0.944
rrl1476110r.2453g>c0.944
rrl1476114r.2457t>c0.895
rrl1476115r.2458t>c0.947
rrl1476126r.2469c>t0.474
rrl1476130r.2473g>a0.458
rrl1476131r.2474c>t0.983
rrl1476160r.2503t>c0.494
rrl1476164r.2507a>g0.488
rrl1476165r.2508t>a0.488
rrl1476194r.2537a>g0.500
rrl1476200r.2543a>t0.500
rrl1476201r.2544c>t0.482
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c0.500
rrl1476224r.2567a>g1.000
rrl1476245r.2588c>t0.415
rrl1476251r.2594t>c1.000
rrl1476252r.2595t>g0.351
rrl1476255r.2598a>g0.359
rrl1476256r.2599a>g0.354
rrl1476260r.2603a>g0.349
rrl1476281r.2624t>c1.000
rrl1476295r.2638c>g0.342
rrl1476296r.2639c>t0.347
rrl1476297r.2640c>g0.351
rrl1476298r.2641c>g0.351
rrl1476299r.2642c>t0.649
rrl1476300r.2643g>t0.347
rrl1476301r.2644a>t0.347
rrl1476309r.2652g>c0.377
rrl1476311r.2654g>c0.382
rrl1476428r.2771c>t0.540
rrl1476429r.2772a>c0.544
rrl1476466r.2809c>t0.559
rrl1476506r.2849t>c0.500
rrl1476515r.2858c>t0.408
rrl1476517r.2860c>t0.396
rrl1476524r.2867c>a0.389
rrl1476525r.2868a>g0.385
rrl1476529r.2872a>t0.394
rrl1476530r.2873c>a0.394
rrl1476536r.2879g>a0.427
rrl1476538r.2881a>g0.411
rrl1476539r.2882a>g0.411
rrl1476540r.2883c>g0.407
rrl1476584r.2927c>t0.987
rrl1476585r.2928a>g0.403
rrl1476594r.2937c>t0.583
rrl1476596r.2939c>t0.400
rrl1476597r.2940g>a0.594
rrl1476601r.2944g>a0.359
rrl1476603r.2946g>a0.613
rrl1476607r.2950c>t0.273
rrl1476608r.2951c>g0.981
rrl1476614r.2957a>t0.275
rrl1476616r.2959a>g0.260
rrl1476619r.2962c>t0.979
rrl1476628r.2971t>a1.000
rrl1476629r.2972c>a0.333
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t0.900
rrl1476674r.3017t>c1.000
rpsA1833536c.-6A>C0.941
rpsA1833538c.-4CA>C0.941
rpsA1833541c.-1T>C0.941
rpsA1833547c.6G>A0.955
rpsA1833589c.48A>C0.968
rpsA1833595c.54T>G0.968
rpsA1833596p.Ser19Ala0.968
rpsA1833604c.63C>T0.972
rpsA1833616c.75A>T0.974
rpsA1833619c.78A>C0.974
rpsA1833625c.84A>G0.975
rpsA1833664c.123C>G0.971
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C0.957
rpsA1833961c.420C>G0.909
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T0.849
rpsA1834024c.483G>C0.148
rpsA1834030c.489C>G0.855
rpsA1834033c.492C>T0.855
rpsA1834034p.Ile165Val0.140
rpsA1834046p.Ile169Leu0.143
rpsA1834054c.513C>G0.148
rpsA1834073p.Lys178Arg0.800
rpsA1834093c.552G>C0.150
rpsA1834096c.555G>C0.811
rpsA1834099c.558C>G0.806
rpsA1834102c.561T>C0.147
rpsA1834105c.564C>T0.121
rpsA1834108c.567C>G0.862
rpsA1834114c.573G>C0.960
rpsA1834177c.636A>C0.963
rpsA1834228c.687C>A0.970
rpsA1834231c.690T>G0.968
rpsA1834234c.693G>T0.969
rpsA1834240c.699T>C0.939
rpsA1834246c.705G>T0.943
rpsA1834249c.708T>C0.971
rpsA1834252c.711C>G0.914
rpsA1834261c.720A>G0.977
rpsA1834264c.723G>C0.978
rpsA1834279c.738C>T0.927
rpsA1834294c.753G>T0.980
rpsA1834297c.756C>T0.922
rpsA1834303c.762T>G0.979
rpsA1834306c.765T>C0.981
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C0.948
rpsA1834396c.855G>C0.942
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T0.972
rpsA1834417c.876G>C0.972
rpsA1834420c.879C>T0.974
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T0.979
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G0.950
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T0.949
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C0.917
rpsA1834520p.Ala327Ser0.917
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C0.962
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C0.979
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G0.929
embB4248226c.1713G>C0.933
embB4248232c.1719G>T0.933
embB4248233p.Leu574Val0.933
embB4248236p.Met575Leu0.944
embB4248245p.Ile578Val0.964
embB4248250c.1737C>T0.967
embB4248259p.Met582Ile0.967
embB4248275p.Thr588Ala0.967
embB4248292c.1779G>A0.967

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;