TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c48c4462c4
Sample: 5d2c48c4462c4

Download results

Summary
ID: 5d2c48c4462c4
Date: Mon Jul 15 10:37:48 2019
Strain: lineage2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.923
gyrB6115c.876A>G0.933
gyrB6121c.882C>T0.933
gyrB6127c.888G>C0.933
gyrB6133c.894G>C0.933
gyrB6136c.897G>A0.933
gyrB6151c.912C>T0.933
gyrB6172c.933C>T0.933
gyrB6184c.945C>T0.933
gyrB6193c.954G>A0.857
gyrB6196c.957C>T0.857
gyrB6202c.963C>T0.818
gyrB6203p.Ser322Ala0.818
gyrB6214c.975G>C0.818
gyrB6223c.984G>C0.818
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.985
gyrB6775c.1536G>C0.983
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C0.981
gyrB6889c.1650G>A0.981
gyrB6898c.1659G>T0.979
gyrB7006c.1767T>G0.846
gyrB7010p.Leu591Met0.846
gyrB7015c.1776G>A0.846
gyrB7018c.1779G>C0.846
gyrB7024c.1785G>C0.846
gyrB7033c.1794G>C0.923
gyrB7051p.Glu604Asp0.929
gyrB7060c.1821T>C0.929
gyrB7066c.1827G>T0.929
gyrB7078c.1839A>G0.929
gyrB7081c.1842T>C0.929
gyrB7084c.1845A>G0.929
gyrB7090c.1851C>T0.929
gyrB7093c.1854T>C0.929
gyrB7100c.1861T>C0.938
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>A1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8264c.963T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C0.964
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8366c.1065G>A1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C0.941
gyrA8829c.1528T>C0.941
gyrA8837c.1536C>G0.926
gyrA8846c.1545C>T0.912
gyrA8852c.1551T>C0.944
gyrA8858c.1557T>C0.949
gyrA8870c.1569G>C0.936
gyrA8873c.1572A>G0.957
gyrA8897c.1596T>C0.967
gyrA8903c.1602T>C0.967
gyrA8915c.1614A>G0.968
gyrA8942c.1641G>T0.962
gyrA8945c.1644G>C0.961
gyrA8946c.1645T>C0.961
gyrA8957c.1656C>T0.957
gyrA8967p.Ala556Lys0.953
gyrA8978c.1677C>T0.974
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G0.976
rpoB760196c.390C>G0.977
rpoB760235c.429T>C0.976
rpoB760244c.438G>C0.975
rpoB760256c.450C>T0.974
rpoB760274p.Glu156Asp0.931
rpoB760276p.Lys157Met0.966
rpoB760283c.477G>C0.963
rpoB760298c.492G>C0.958
rpoB760307c.501T>C0.950
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.913
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn0.987
rpoB760532c.726T>C0.986
rpoB760541c.735G>C0.984
rpoB760567p.Ser254Trp0.938
rpoB760571c.765G>C0.941
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T0.971
rpoB760611c.805T>C0.974
rpoB760634c.828T>C0.974
rpoB760646c.840C>G0.974
rpoB760655c.849A>G0.974
rpoB760661c.855A>G0.972
rpoB760668p.Thr288Ala0.967
rpoB760674c.868T>C0.967
rpoB760679c.873A>G0.967
rpoB760683c.877T>C0.933
rpoB760703c.897C>T0.966
rpoB760721c.915C>G0.955
rpoB760727c.921C>G0.941
rpoB760730c.924T>C0.941
rpoB760736c.930C>G0.933
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C0.952
rpoB760858p.Val351Ala0.958
rpoB760862c.1056G>C0.958
rpoB760865c.1059C>T0.920
rpoB760886p.Glu360Asp0.974
rpoB760887p.Thr361Val0.974
rpoB760910c.1104C>T0.977
rpoB760916c.1110C>T0.977
rpoB760928c.1122G>C0.976
rpoB760943c.1137C>T0.949
rpoB760946c.1140A>G0.975
rpoB760965p.Met387Leu0.949
rpoB760970c.1164G>C0.974
rpoB760973c.1167G>T0.972
rpoB760982c.1176G>C0.968
rpoB760985c.1179G>C0.963
rpoB760988c.1182C>G0.963
rpoB760991c.1185G>T0.967
rpoB760997c.1191G>C0.969
rpoB761006c.1200C>G0.968
rpoB761015c.1209G>C0.966
rpoB761027c.1221A>C0.964
rpoB761036c.1230G>C0.958
rpoB761037c.1231T>C0.960
rpoB761051c.1245G>T0.963
rpoB761054c.1248G>C0.963
rpoB761057c.1251G>C0.963
rpoB761060c.1254C>G0.963
rpoB761063c.1257C>G0.968
rpoB761084c.1278C>A0.976
rpoB761097c.1291A>T0.973
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C0.980
rpoB761147c.1341C>T0.977
rpoB761150c.1344A>T0.977
rpoB761165c.1359G>C0.975
rpoB761171c.1365C>T0.974
rpoB761178p.Ser458Thr0.971
rpoB761186p.Glu460Asp0.971
rpoB761189c.1383T>C0.972
rpoB761195c.1389G>C0.973
rpoB761198c.1392G>C0.973
rpoB761219c.1413G>C0.972
rpoB761234c.1428G>C0.973
rpoB761249c.1443A>G0.974
rpoB761255c.1449T>G0.969
rpoB761258c.1452G>A0.967
rpoB761261c.1455G>C0.906
rpoB761264c.1458C>G0.889
rpoB761264r.1458c>cg0.083
rpoB761273c.1467T>C0.978
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761345c.1539G>C1.000
rpoB761346p.Val514Ser1.000
rpoB761354c.1548C>A1.000
rpoB761357c.1551G>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761369p.Glu521Asp1.000
rpoB761373p.Val523His1.000
rpoB761384c.1578C>G1.000
rpoB761393c.1587G>A1.000
rpoB761516c.1710G>C0.958
rpoB761528c.1722C>T0.966
rpoB761537c.1731C>G0.971
rpoB761555c.1749G>C0.975
rpoB761558c.1752C>G0.976
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C0.979
rpoB761573c.1767C>G1.000
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T0.980
rpoB761666c.1860G>C0.968
rpoB761669c.1863C>T0.966
rpoB761675c.1869G>T0.964
rpoB761681c.1875G>A0.955
rpoB761682c.1876C>T0.952
rpoB761687c.1881C>T0.952
rpoB761690c.1884G>C0.952
rpoB761693c.1887G>C0.952
rpoB761705c.1899C>A0.950
rpoB761891c.2085G>C0.950
rpoB761909c.2103T>C0.963
rpoB761912c.2106T>C0.963
rpoB761915p.Asp703Glu0.963
rpoB761916p.Asp704Asn0.963
rpoB761924c.2118G>A0.964
rpoB761930c.2124G>C0.966
rpoB761933c.2127G>C0.967
rpoB761936c.2130C>T0.967
rpoB761948c.2142G>C0.980
rpoB761954c.2148C>A0.981
rpoB761955p.Ile717Val0.981
rpoB761969c.2163G>A0.983
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T0.964
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A0.944
rpoB762137c.2331C>T0.944
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T0.955
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C0.969
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C0.978
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C0.974
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A0.971
rpoB762329c.2523G>C0.969
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A0.977
rpoB762452c.2646G>C0.977
rpoB762470c.2664G>C0.977
rpoB762488c.2682G>C0.971
rpoB762491c.2685T>C0.971
rpoB762509c.2703T>G0.750
rpoB762510p.Ala902Pro0.750
rpoB762515c.2709C>T0.900
rpoB762533c.2727T>C0.833
rpoB762536c.2730T>C0.833
rpoB762537c.2731T>C0.833
rpoB762551c.2745C>T0.900
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G0.982
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A0.972
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763193c.3387C>G1.000
rpoC763402c.33C>T0.909
rpoC763408c.39T>C0.909
rpoC763411c.42T>C0.909
rpoC763414c.45T>G0.909
rpoC763415p.Thr16Ser0.909
rpoC763423p.Glu18Asp0.909
rpoC763430c.61A>C0.909
rpoC763433p.Gln22Asn0.909
rpoC763443p.Tyr25Phe0.909
rpoC763450c.81G>A0.976
rpoC763456c.87A>G0.976
rpoC763468c.99G>C0.964
rpoC763486c.117T>C0.985
rpoC763492c.123G>C1.000
rpoC763528c.159G>A0.986
rpoC763531c.162G>T0.986
rpoC763546c.177A>G1.000
rpoC763570c.201G>C0.983
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C0.964
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G0.960
rpoC764084p.Asn239Val0.960
rpoC764095c.726C>T0.960
rpoC764098c.729A>G0.960
rpoC764143c.774G>C0.800
rpoC764147p.Ser260Ala0.769
rpoC764150p.Ile261Val0.769
rpoC764165p.Glu266Gln0.769
rpoC764311c.942C>G1.000
rpoC764317c.948C>G0.952
rpoC764320c.951C>G0.957
rpoC764332c.963G>A0.920
rpoC764338c.969G>A1.000
rpoC764353c.984G>T0.943
rpoC764365c.996C>T0.974
rpoC764371c.1002G>C0.950
rpoC764377c.1008C>G0.951
rpoC764380c.1011G>C0.951
rpoC764387c.1018T>C0.978
rpoC764405c.1036A>C0.981
rpoC764428c.1059G>C0.981
rpoC764431c.1062G>C0.980
rpoC764434c.1065A>G0.980
rpoC764435c.1066A>C0.980
rpoC764458c.1089G>C0.980
rpoC764461c.1092A>G0.979
rpoC764497c.1128A>G0.980
rpoC764510c.1141C>T0.980
rpoC764524c.1155C>G0.979
rpoC764530c.1161C>G0.949
rpoC764534c.1165C>A0.973
rpoC764539c.1170C>T0.971
rpoC764542c.1173C>T0.971
rpoC764545c.1176C>A0.971
rpoC764560c.1191T>C0.977
rpoC764575c.1206T>G0.957
rpoC764611c.1242G>T0.980
rpoC764626c.1257C>T0.980
rpoC764632c.1263T>C0.981
rpoC764650c.1281G>T0.982
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T0.981
rpoC764713c.1344G>T0.979
rpoC764716c.1347G>C0.977
rpoC764746c.1377G>T0.960
rpoC764752c.1383G>C0.958
rpoC764758c.1389C>G0.958
rpoC764764c.1395T>C0.957
rpoC764791c.1422C>G0.958
rpoC764803c.1434C>T0.953
rpoC764809c.1440C>T0.946
rpoC764810p.Pro481Ala0.946
rpoC764815c.1446A>G0.944
rpoC764824c.1455T>C0.971
rpoC764827c.1458G>C0.972
rpoC764858c.1489T>C0.950
rpoC764869c.1500C>T0.951
rpoC764875c.1506C>A0.976
rpoC764887c.1518G>C0.974
rpoC764888c.1519T>C0.973
rpoC764911c.1542A>G0.976
rpoC764912p.Met515Gln0.976
rpoC764932c.1563C>A0.978
rpoC764948c.1579T>C0.962
rpoC764968c.1599T>C0.980
rpoC765004c.1635G>C0.950
rpoC765007c.1638T>G0.947
rpoC765008c.1639T>C0.947
rpoC765011c.1642A>T0.947
rpoC765016c.1647C>G0.950
rpoC765019c.1650A>G0.950
rpoC765040c.1671T>C0.963
rpoC765041c.1672T>C0.963
rpoC765047c.1678T>C0.926
rpoC765055c.1686C>G0.963
rpoC765073c.1704G>C0.867
rpoC765076c.1707A>G0.867
rpoC765079c.1710T>G0.867
rpoC765082c.1713G>C0.867
rpoC765085c.1716T>C0.867
rpoC765089c.1720T>C0.929
rpoC765100c.1731G>C0.929
rpoC765103c.1734G>T0.929
rpoC765121c.1752G>T0.800
rpoC765129p.Tyr587Phe0.800
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G0.956
rpoC765533p.Tyr722His0.952
rpoC765544c.2175C>G0.929
rpoC765547c.2178C>T0.917
rpoC765548c.2179A>T0.917
rpoC765553c.2184C>T0.958
rpoC765556c.2187G>C0.958
rpoC765562c.2193G>T0.917
rpoC765826c.2457T>C0.913
rpoC765835c.2466C>T0.923
rpoC765841c.2472G>T0.946
rpoC765861p.Phe831Tyr0.938
rpoC765875p.Val836Ile0.963
rpoC765886c.2517C>T0.966
rpoC765907c.2538G>T0.962
rpoC765910c.2541G>C0.980
rpoC765928c.2559C>G0.979
rpoC765940c.2571A>T0.977
rpoC765947c.2578T>C0.976
rpoC765962c.2593T>C0.958
rpoC765967c.2598C>T0.957
rpoC765973c.2604C>G0.957
rpoC765979c.2610C>G0.957
rpoC765982c.2613C>T0.957
rpoC765994c.2625A>T0.947
rpoC766003c.2634G>C0.941
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C0.969
rpoC766630c.3261G>C0.968
rpoC766633c.3264G>C0.968
rpoC766792c.3423C>G0.950
rpoC766799p.Ala1144Ser0.950
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.970
rpsL781572p.Gln5Asn0.971
rpsL781586c.27C>T0.976
rpsL781595c.36T>C0.980
rpsL781608p.Ser17Ala0.981
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.946
rrs1472734r.889c>t0.970
rrs1472741r.896g>a0.970
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.966
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t0.976
rrs1473290r.1445c>t0.976
rrs1473291r.1446g>t0.976
rrl1473684r.27g>a0.895
rrl1473697r.40c>a0.895
rrl1473707r.50t>a0.931
rrl1473717r.60g>a0.973
rrl1473731r.74t>a0.977
rrl1473746r.89t>c0.979
rrl1473756r.99g>t0.980
rrl1473758r.101g>t0.980
rrl1473770r.113t>c0.982
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t0.966
rrl1473950r.293g>t0.966
rrl1474074r.417c>t0.923
rrl1474089r.432c>t0.929
rrl1474093r.436g>a0.929
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.865
rrl1474184r.527c>a0.970
rrl1474249r.592g>t0.976
rrl1474263r.606g>a0.975
rrl1474282r.625g>a0.972
rrl1474306r.649a>c0.957
rrl1474308r.651g>t0.957
rrl1474310r.653t>g0.957
rrl1474356r.699t>c0.953
rrl1474362r.705a>g0.953
rrl1474387r.730c>t0.941
rrl1474413r.756a>c0.941
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.938
rrl1474496r.839c>g0.964
rrl1474497r.840g>c0.964
rrl1474506r.849c>g0.963
rrl1474507r.850g>c0.963
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474710r.1053tggtg>t1.000
rrl1474717r.1060a>g0.958
rrl1474722r.1065t>c0.960
rrl1474743r.1086t>g0.971
rrl1474760r.1103a>g0.971
rrl1474794r.1137c>t0.971
rrl1474803r.1146g>a0.974
rrl1474812r.1155g>a0.974
rrl1474830r.1173a>g0.976
rrl1474913r.1256t>c0.980
rrl1474932r.1275c>t0.977
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c0.968
rrl1475209r.1552g>a0.962
rrl1475213r.1556c>t0.962
rrl1475220r.1563g>t0.962
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g0.960
rrl1475659r.2002g>a0.963
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.972
rrl1475977r.2320a>g0.972
rrl1475988r.2331a>g0.963
rrl1475989r.2332t>c0.963
rrl1475993r.2336c>t0.963
rrl1475997r.2340a>t0.963
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t0.963
rrl1476160r.2503t>c0.968
rrl1476214r.2557g>t0.957
rrl1476215r.2558c>t0.957
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t0.982
rrl1476594r.2937c>t0.982
rrl1476597r.2940g>a0.982
rrl1476603r.2946g>a0.981
rrl1476608r.2951c>g0.981
rrl1476619r.2962c>t0.980
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G0.976
rpsA1833790c.249T>C0.977
rpsA1833802c.261A>G0.978
rpsA1833811c.270G>T0.977
rpsA1833823c.282G>A0.978
rpsA1833832c.291G>A0.958
rpsA1833838c.297G>C0.979
rpsA1833841c.300C>G0.980
rpsA1833847c.306C>G0.962
rpsA1833856c.315A>G0.964
rpsA1833862c.321G>T0.964
rpsA1833874c.333T>G0.962
rpsA1833886c.345C>G0.964
rpsA1833894p.Ala118Glu0.962
rpsA1833928c.387G>C0.983
rpsA1833949c.408T>C0.984
rpsA1833961c.420C>G0.984
rpsA1833970c.429G>T0.984
rpsA1833979c.438T>C0.984
rpsA1833991c.450C>G0.984
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg0.980
rpsA1834096c.555G>C0.974
rpsA1834099c.558C>G0.974
rpsA1834108c.567C>G0.970
rpsA1834114c.573G>C0.969
rpsA1834177c.636A>C0.967
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T0.978
rpsA1834609c.1068T>C0.977
rpsA1834619c.1078T>C0.972
rpsA1834622c.1081T>A0.971
rpsA1834633c.1092A>G0.976
rpsA1834639c.1098T>C0.977
rpsA1834645c.1104C>T0.978
rpsA1834666c.1125G>C0.955
rpsA1834667p.Ala376Ser0.955
rpsA1834690c.1149T>C0.980
rpsA1834700p.Gln387Ala0.973
rpsA1834705c.1164C>G0.974
rpsA1834720c.1179C>G0.980
rpsA1834732c.1191T>C0.981
rpsA1834738c.1197A>G0.983
rpsA1834753c.1212T>C0.982
rpsA1834759c.1218A>C0.981
rpsA1834765p.Glu408Asp0.980
rpsA1834774c.1233C>T0.955
rpsA1834776p.Ala412Glu0.977
rpsA1834780c.1239A>G0.977
rpsA1834789c.1248T>C0.977
rpsA1834813c.1272G>T0.970
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C0.963
kasA2518756c.642G>C0.971
kasA2518768c.654C>G0.971
kasA2518771c.657C>G0.971
kasA2518774c.660C>T0.971
kasA2518783c.669T>G0.943
kasA2518787p.Arg225Lys0.943
kasA2518792c.678C>T0.943
kasA2518795c.681C>T0.943
kasA2518798c.684G>C0.943
kasA2518822c.708C>A0.960
kasA2518825c.711T>C0.960
kasA2518846c.732G>T0.953
kasA2518849c.735G>C0.953
kasA2518853p.Leu247Val0.976
kasA2518864c.750G>C0.975
embC4240729c.867C>G0.976
embC4240735c.873C>G0.977
embC4240741c.879C>T0.978
embC4240756c.894G>C0.980
embC4240771c.909G>C0.971
embC4240772p.Ser304Ala0.943
embC4240778p.His306Gly0.941
embC4240781p.Ala307Ser0.914
embC4240789c.927T>C0.979
embC4240819c.957A>C0.974
embC4240826p.Ala322Ser0.971
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr0.955
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G0.955
embB4248226c.1713G>C0.955
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;