TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c4cc12ff37
Sample: 5d2c4cc12ff37

Download results

Summary
ID: 5d2c4cc12ff37
Date: Mon Jul 15 10:55:30 2019
Strain: lineage4
Drug-resistance: Drug-resistant

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
FluoroquinolonesRgyrA p.Asp94Tyr (0.37)
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage4Euro-AmericanLAM;T;S;X;HNone

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T0.909
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.952
gyrB6775c.1536G>C0.953
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7006c.1767T>G0.909
gyrB7010p.Leu591Met0.909
gyrB7015c.1776G>A0.909
gyrB7018c.1779G>C0.909
gyrB7024c.1785G>C0.909
gyrB7033c.1794G>C0.909
gyrB7051p.Glu604Asp0.909
gyrB7060c.1821T>C0.909
gyrB7066c.1827G>T0.909
gyrB7078c.1839A>G0.909
gyrB7081c.1842T>C0.909
gyrB7084c.1845A>G0.909
gyrB7090c.1851C>T0.909
gyrB7093c.1854T>C0.909
gyrB7100c.1861T>C0.909
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T0.969
gyrA7607c.306C>T0.983
gyrA7637c.336C>A0.981
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C0.909
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T0.971
gyrA8382c.1081C>T1.000
gyrA8828c.1527T>C0.727
gyrA8829c.1528T>C0.727
gyrA8837c.1536C>G0.778
gyrA8840c.1539C>T0.778
gyrA8852c.1551T>C0.905
gyrA8858c.1557T>C0.938
gyrA8870c.1569G>C0.943
gyrA8873c.1572A>G0.943
gyrA8897c.1596T>C0.952
gyrA8903c.1602T>C0.952
gyrA8915c.1614A>G0.952
gyrA8921c.1620C>T0.951
gyrA8942c.1641G>C0.945
gyrA8945c.1644G>C0.943
gyrA8946c.1645T>C0.943
gyrA8957c.1656C>T0.959
gyrA8967p.Ala556Lys0.955
gyrA8978c.1677C>T0.951
gyrA8987c.1686C>G0.944
gyrA8990c.1689C>G0.941
gyrA8993c.1692C>T0.938
gyrA8996c.1695T>C0.938
gyrA8998p.Leu566Trp0.938
rpoB760079c.273G>A0.963
rpoB760091c.285G>C0.966
rpoB760101c.295T>C0.967
rpoB760110c.304T>A0.967
rpoB760118c.312T>G0.969
rpoB760121c.315T>C0.970
rpoB760130p.Asp108Glu0.980
rpoB760139c.333A>G0.981
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp0.976
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C0.973
rpoB760298c.492G>C0.968
rpoB760307c.501T>C0.926
rpoB760357p.Thr184Ser0.941
rpoB760361c.555T>C0.950
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.914
rpoB760407p.Ser201Gly0.970
rpoB760415c.609C>T0.977
rpoB760418c.612G>C0.979
rpoB760430c.624T>C0.981
rpoB760460c.654G>C0.985
rpoB760475c.669A>G0.986
rpoB760481c.675G>C0.986
rpoB760484c.678A>G0.986
rpoB760502c.696C>G0.985
rpoB760522p.Ser239Asn0.983
rpoB760532c.726T>C0.983
rpoB760541c.735G>C0.982
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G0.971
rpoB760655c.849A>G0.938
rpoB760661c.855A>G0.935
rpoB760668p.Thr288Ala0.923
rpoB760674c.868T>C0.923
rpoB760679c.873A>G0.920
rpoB760683c.877T>C0.920
rpoB760703c.897C>T0.905
rpoB760721c.915C>G0.875
rpoB760727c.921C>G0.857
rpoB760730c.924T>C0.846
rpoB760736c.930C>G0.833
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T0.970
rpoB761102c.1296A>G0.971
rpoB761132c.1326G>C0.980
rpoB761133c.1327T>C0.980
rpoB761147c.1341C>T0.984
rpoB761150c.1344A>T0.984
rpoB761165c.1359G>C0.985
rpoB761171c.1365C>T0.985
rpoB761178p.Ser458Thr0.984
rpoB761186p.Glu460Asp0.984
rpoB761189c.1383T>C0.984
rpoB761195c.1389G>C0.984
rpoB761198c.1392G>C0.984
rpoB761219c.1413G>C0.986
rpoB761234c.1428G>C0.987
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C0.984
rpoB761264c.1458C>G0.985
rpoB761273c.1467T>C1.000
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G0.980
rpoB761510c.1704T>C0.917
rpoB761516c.1710G>C0.968
rpoB761528c.1722C>T0.973
rpoB761537c.1731C>G0.977
rpoB761555c.1749G>C0.981
rpoB761558c.1752C>G0.982
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.984
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T0.987
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761891c.2085G>C1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C0.981
rpoB762167c.2361T>C0.982
rpoB762176c.2370T>C0.982
rpoB762185c.2379G>C0.983
rpoB762194c.2388G>C0.984
rpoB762233c.2427G>C0.983
rpoB762236c.2430G>C0.983
rpoB762245c.2439G>C0.983
rpoB762275c.2469C>T0.980
rpoB762284c.2478G>C0.978
rpoB762293c.2487T>C0.974
rpoB762296c.2490G>C0.972
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A0.963
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G0.867
rpoB762510p.Ala902Pro0.857
rpoB762515c.2709C>T0.960
rpoB762533c.2727T>C0.938
rpoB762536c.2730T>C0.929
rpoB762537c.2731T>C0.929
rpoB762551c.2745C>T0.900
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G0.983
rpoB762920c.3114C>T0.982
rpoB762923c.3117C>G0.982
rpoB762929c.3123G>C0.983
rpoB762959c.3153G>C0.980
rpoB762962c.3156C>T0.980
rpoB762995c.3189G>T0.979
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G0.978
rpoB763040c.3234C>G0.977
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763193c.3387C>G1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A0.969
rpoC763531c.162G>T0.984
rpoC763546c.177A>G0.985
rpoC763570c.201G>C0.985
rpoC763594c.225C>T0.973
rpoC763633c.264T>C0.971
rpoC763657c.288G>A0.958
rpoC763660c.291T>G0.958
rpoC763666c.297G>C0.955
rpoC763669c.300C>G0.952
rpoC763675c.306C>G0.952
rpoC763696c.327T>C0.900
rpoC763699c.330G>T0.882
rpoC763702c.333C>G0.875
rpoC763708c.339G>C0.933
rpoC763711c.342G>C0.929
rpoC763714c.345G>C0.933
rpoC763717c.348T>C0.933
rpoC763723c.354G>C0.875
rpoC763732c.363C>A0.857
rpoC763741c.372C>T0.727
rpoC763744c.375G>C0.818
rpoC763747c.378G>A0.727
rpoC763900c.531G>C0.957
rpoC763933c.564C>T0.957
rpoC763940p.Ala191Ser0.957
rpoC763945c.576T>C0.957
rpoC763947p.Ala193Val0.957
rpoC763951c.582G>C0.957
rpoC763960c.591T>G0.913
rpoC763969c.600C>T0.957
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T0.949
rpoC764059c.690G>T0.976
rpoC764083c.714A>G0.976
rpoC764084p.Asn239Val0.952
rpoC764095c.726C>T0.952
rpoC764098c.729A>G0.976
rpoC764143c.774G>C0.971
rpoC764147p.Ser260Ala0.969
rpoC764150p.Ile261Val0.966
rpoC764165p.Glu266Gln0.964
rpoC764311c.942C>G0.923
rpoC764317c.948C>G0.938
rpoC764320c.951C>G0.947
rpoC764332c.963G>A0.952
rpoC764338c.969G>A0.957
rpoC764353c.984G>T0.967
rpoC764365c.996C>T0.974
rpoC764371c.1002G>C0.974
rpoC764377c.1008C>G0.974
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T1.000
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T0.985
rpoC764668c.1299C>T0.985
rpoC764692c.1323C>T0.985
rpoC764713c.1344G>T0.971
rpoC764716c.1347G>C0.986
rpoC764746c.1377G>T0.987
rpoC764752c.1383G>C0.987
rpoC764758c.1389C>G0.987
rpoC764764c.1395T>C0.987
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C0.984
rpoC764888c.1519T>C0.984
rpoC764911c.1542A>G0.983
rpoC764912p.Met515Gln0.983
rpoC764932c.1563C>A0.985
rpoC764948c.1579T>C0.986
rpoC764968c.1599T>C0.986
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C0.951
rpoC765041c.1672T>C0.976
rpoC765047c.1678T>C0.976
rpoC765055c.1686C>G0.975
rpoC765073c.1704G>C0.950
rpoC765076c.1707A>G0.867
rpoC765079c.1710T>G0.923
rpoC765082c.1713G>C0.923
rpoC765085c.1716T>C0.923
rpoC765089c.1720T>C0.923
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765343c.1974G>A0.875
rpoC765352c.1983G>C0.889
rpoC765356p.Met663Val0.889
rpoC765370c.2001G>C0.944
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G0.979
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C0.947
rpoC765562c.2193G>T1.000
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T0.923
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T0.977
rpoC766607p.Ile1080Leu0.977
rpoC766618c.3249G>T0.976
rpoC766624c.3255G>C0.974
rpoC766630c.3261G>C0.971
rpoC766633c.3264G>C0.971
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C0.985
rpoC767104c.3735C>G0.985
rpoC767107c.3738C>T0.985
rpoC767119c.3750A>G0.985
rpoC767125c.3756G>C0.985
rpoC767134c.3765C>T0.986
rpoC767138c.3769C>T0.986
rpoC767149c.3780C>T0.987
rpoC767158c.3789T>C0.975
rpoC767179c.3810C>T0.972
rpoC767180p.Ala1271Ser0.972
rpoC767191c.3822C>G0.973
rpoC767197c.3828G>A0.972
rpoC767203c.3834C>G0.969
rpoC767206c.3837C>G0.983
rpoC767209c.3840T>C0.983
rpoC767212c.3843G>C0.983
rpoC767221c.3852C>G0.985
rpoC767230c.3861G>C0.984
rpoC767233c.3864T>C0.984
rpoC767254c.3885G>C0.983
rpoC767264p.Ala1299Ser0.974
rpoC767267p.Ala1300Asn0.973
rpoC767281c.3912C>G0.971
rpoC767284c.3915C>G0.971
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T0.966
rpsL781595c.36T>C0.944
rpsL781608p.Ser17Ala0.944
rpsL781616c.57C>G0.955
rpsL781628c.69T>C0.960
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a0.981
rrs1472251r.406g>a0.982
rrs1472324r.479g>c0.900
rrs1472325r.480g>c0.900
rrs1472327r.482g>a0.900
rrs1472328r.483g>c0.900
rrs1472337r.492c>g0.976
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t0.956
rrs1472847r.1002g>a0.956
rrs1472848r.1003t>c0.956
rrs1472860r.1015c>t0.957
rrs1472861r.1016g>a0.957
rrs1472956r.1111t>c0.981
rrs1472957r.1112c>t0.981
rrs1472969r.1124a>g0.980
rrs1472970r.1125c>g0.980
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.975
rrs1473088r.1243a>g0.974
rrs1473099r.1254t>a0.963
rrs1473104r.1259c>t0.960
rrs1473105r.1260g>a0.960
rrs1473110r.1265t>g0.960
rrs1473111r.1266a>g0.962
rrs1473121r.1276t>c0.897
rrs1473123r.1278a>t0.973
rrs1473129r.1284c>t0.976
rrs1473145r.1300c>t0.974
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a0.938
rrl1473697r.40c>a0.941
rrl1473707r.50t>a0.955
rrl1473717r.60g>a0.920
rrl1473731r.74t>a0.923
rrl1473746r.89t>c0.933
rrl1473756r.99g>t0.939
rrl1473758r.101g>t0.939
rrl1473770r.113t>c0.949
rrl1473806r.149c>t0.971
rrl1473812r.155g>a0.967
rrl1473814r.157a>t0.966
rrl1473815r.158t>g0.966
rrl1473829r.172g>c0.962
rrl1473831r.174g>t0.962
rrl1473832r.175c>t0.962
rrl1473839r.182g>a0.971
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t0.968
rrl1473899r.242a>g0.968
rrl1473916r.259c>a0.963
rrl1473923r.266c>g0.957
rrl1473937r.280c>t0.952
rrl1473943r.286g>t0.947
rrl1473945r.288t>a0.947
rrl1473946r.289a>t0.947
rrl1473950r.293g>t0.947
rrl1474061r.404t>c1.000
rrl1474074r.417c>t0.944
rrl1474089r.432c>t0.947
rrl1474093r.436g>a0.947
rrl1474100r.443c>t0.900
rrl1474103r.446a>c0.900
rrl1474130r.473c>t0.946
rrl1474140r.483c>t0.949
rrl1474151r.494c>t0.951
rrl1474184r.527c>a0.947
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.974
rrl1474282r.625g>a0.970
rrl1474306r.649a>c0.950
rrl1474308r.651g>t0.905
rrl1474310r.653t>g0.955
rrl1474356r.699t>c0.944
rrl1474362r.705a>g0.962
rrl1474387r.730c>t0.935
rrl1474412r.755ga>g0.974
rrl1474413r.756a>c0.970
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.970
rrl1474496r.839c>g0.915
rrl1474497r.840g>c0.894
rrl1474506r.849c>g0.956
rrl1474507r.850g>c0.956
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g0.969
rrl1474722r.1065t>c0.941
rrl1474743r.1086t>g0.953
rrl1474760r.1103a>g0.949
rrl1474794r.1137c>t0.955
rrl1474803r.1146g>a0.951
rrl1474812r.1155g>a0.956
rrl1474830r.1173a>g0.957
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t0.977
rrl1475114r.1457c>t0.973
rrl1475120r.1463g>t0.972
rrl1475129r.1472g>a0.971
rrl1475202r.1545g>c0.968
rrl1475209r.1552g>a0.963
rrl1475213r.1556c>t0.962
rrl1475220r.1563g>t0.957
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a0.960
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t0.979
rrl1475975r.2318c>t0.968
rrl1475977r.2320a>g0.967
rrl1475988r.2331a>g0.955
rrl1475989r.2332t>c0.900
rrl1475993r.2336c>t0.950
rrl1475997r.2340a>t0.950
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a0.982
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c0.957
inhA1674858c.657G>A1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
inhA1674993c.792G>T1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A0.969
rpsA1833589c.48A>C0.980
rpsA1833595c.54T>G0.980
rpsA1833596p.Ser19Ala0.980
rpsA1833604c.63C>T0.983
rpsA1833616c.75A>T0.984
rpsA1833619c.78A>C0.984
rpsA1833625c.84A>G0.984
rpsA1833664c.123C>G0.984
rpsA1833676c.135A>G0.981
rpsA1833679c.138G>T0.980
rpsA1833685c.144G>C0.978
rpsA1833691c.150G>A0.976
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.952
rpsA1833734p.Ala65Ser0.952
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A0.944
rpsA1834231c.690T>G0.943
rpsA1834234c.693G>T0.944
rpsA1834240c.699T>C0.946
rpsA1834246c.705G>T0.947
rpsA1834249c.708T>C0.949
rpsA1834252c.711C>G0.949
rpsA1834261c.720A>G0.961
rpsA1834264c.723G>C0.959
rpsA1834279c.738C>T0.962
rpsA1834294c.753G>T0.959
rpsA1834297c.756C>T0.960
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.974
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834701p.Gln387Pro1.000
rpsA1834704c.1164 1164del1.000
kasA2518738c.624G>C0.941
kasA2518756c.642G>C0.957
kasA2518768c.654C>G0.958
kasA2518771c.657C>G0.958
kasA2518774c.660C>T0.958
kasA2518783c.669T>G0.958
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A0.909
panD4044171c.111G>A0.909
panD4044174c.108G>A0.909
panD4044180p.Asp34Glu0.909
panD4044188c.94C>G0.909
panD4044189c.93G>A0.909
panD4044194p.Ala30Pro0.909
panD4044195c.87A>G0.909
panD4044219c.63G>A0.833
panD4044233p.Cys17His0.917
panD4044234c.48G>C0.917
panD4044249c.33G>A0.917
panD4044266p.Leu6Met1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser0.982
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G0.958
embB4248226c.1713G>C0.960
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala0.974
embB4248292c.1779G>A0.974

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;