TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c4d3e20bb1
Sample: 5d2c4d3e20bb1

Download results

Summary
ID: 5d2c4d3e20bb1
Date: Mon Jul 15 10:58:08 2019
Strain: lineage2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.955
gyrB6115c.876A>G0.960
gyrB6121c.882C>T0.960
gyrB6127c.888G>C0.960
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T0.923
gyrB6184c.945C>T0.923
gyrB6193c.954G>A0.882
gyrB6196c.957C>T0.875
gyrB6202c.963C>T0.857
gyrB6203p.Ser322Ala0.857
gyrB6214c.975G>C0.857
gyrB6223c.984G>C0.857
gyrB6229c.990G>A0.846
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G0.917
gyrB6646c.1407C>T0.929
gyrB6655c.1416T>C0.967
gyrB6673c.1434A>C0.974
gyrB6676c.1437T>G0.977
gyrB6703c.1464G>C0.935
gyrB6706c.1467G>A0.935
gyrB6709c.1470A>G0.935
gyrB6712c.1473G>C0.936
gyrB6727c.1488G>T0.941
gyrB6728c.1489C>T0.941
gyrB6739c.1500C>T0.946
gyrB6745c.1506T>C0.948
gyrB6754c.1515C>T0.953
gyrB6763c.1524G>C0.955
gyrB6772c.1533C>G0.926
gyrB6775c.1536G>C0.924
gyrB6793c.1554T>C0.969
gyrB6798p.Gly520Ala0.969
gyrB6808c.1569C>G0.966
gyrB6824c.1585C>T0.959
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrA7499c.198G>C0.950
gyrA7511c.210C>T0.958
gyrA7523c.222C>G0.963
gyrA7526c.225G>C0.964
gyrA7547c.246C>T0.971
gyrA7553c.252C>T0.972
gyrA7559c.258G>C0.974
gyrA7565c.264C>T0.977
gyrA7574c.273G>C0.979
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.982
gyrA7595c.294C>T0.982
gyrA7607c.306C>T0.980
gyrA7637c.336C>A1.000
gyrA8121c.820T>C0.900
gyrA8129c.828T>C0.900
gyrA8156c.855T>C0.900
gyrA8159c.858G>C0.900
gyrA8168c.867A>G0.900
gyrA8174c.873C>G0.900
gyrA8177c.876A>C0.900
gyrA8187p.Leu296Ile0.900
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T0.867
gyrA8576c.1275C>G0.889
gyrA8580p.Ile427Val0.905
gyrA8603c.1302A>C0.905
gyrA8609c.1308G>C0.905
gyrA8619c.1318T>C0.950
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C0.976
gyrA8873c.1572A>G0.977
gyrA8897c.1596T>C0.982
gyrA8903c.1602T>C0.983
gyrA8915c.1614A>G0.983
gyrA8942c.1641G>C0.980
gyrA8945c.1644G>C0.980
gyrA8946c.1645T>C0.980
gyrA8957c.1656C>T0.978
gyrA8967p.Ala556Lys0.974
gyrA8978c.1677C>T0.971
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
gyrA9023c.1722A>C1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G0.971
rpoB760121c.315T>C0.972
rpoB760130p.Asp108Glu0.978
rpoB760139c.333A>G0.979
rpoB760181c.375T>C0.982
rpoB760184c.378A>G0.982
rpoB760196c.390C>G0.981
rpoB760235c.429T>C0.980
rpoB760244c.438G>C0.957
rpoB760256c.450C>T0.953
rpoB760274p.Glu156Asp0.969
rpoB760276p.Lys157Met0.969
rpoB760283c.477G>C0.967
rpoB760298c.492G>C0.966
rpoB760307c.501T>C0.962
rpoB760357p.Thr184Ser0.958
rpoB760361c.555T>C0.963
rpoB760370c.564C>G0.966
rpoB760376p.Asp190Glu0.966
rpoB760382c.576G>C0.967
rpoB760388c.582C>T0.972
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.907
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760805c.999G>C0.917
rpoB760817c.1011A>G0.929
rpoB760820c.1014T>C0.929
rpoB760826c.1020C>G0.947
rpoB760830c.1024T>C0.947
rpoB760841c.1035T>C0.952
rpoB760858p.Val351Ala0.955
rpoB760862c.1056G>C0.955
rpoB760865c.1059C>T0.955
rpoB760886p.Glu360Asp0.941
rpoB760887p.Thr361Val0.970
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu0.929
rpoB760970c.1164G>C0.962
rpoB760973c.1167G>T0.960
rpoB760982c.1176G>C0.955
rpoB760985c.1179G>C0.952
rpoB760988c.1182C>G0.952
rpoB760991c.1185G>T0.952
rpoB760997c.1191G>C0.957
rpoB761006c.1200C>G0.960
rpoB761015c.1209G>C0.960
rpoB761027c.1221A>C0.955
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C0.981
rpoB761171c.1365C>T0.980
rpoB761178p.Ser458Thr0.976
rpoB761186p.Glu460Asp0.974
rpoB761189c.1383T>C0.974
rpoB761195c.1389G>C0.974
rpoB761198c.1392G>C0.974
rpoB761219c.1413G>C0.982
rpoB761234c.1428G>C0.982
rpoB761246c.1440C>T0.975
rpoB761249c.1443A>G0.974
rpoB761255c.1449T>G0.974
rpoB761258c.1452G>A0.973
rpoB761261c.1455G>C0.973
rpoB761264c.1458C>G0.976
rpoB761273c.1467T>C0.981
rpoB761303c.1497G>C0.979
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G0.974
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761516c.1710G>C0.950
rpoB761528c.1722C>T0.955
rpoB761531c.1725C>T0.963
rpoB761537c.1731C>G0.971
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.975
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T0.977
rpoB761666c.1860G>C0.971
rpoB761669c.1863C>T0.971
rpoB761675c.1869G>T0.970
rpoB761681c.1875G>A0.923
rpoB761682c.1876C>T0.960
rpoB761687c.1881C>T0.913
rpoB761690c.1884G>C0.957
rpoB761693c.1887G>C0.913
rpoB761705c.1899C>A0.905
rpoB761891c.2085G>C1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C0.971
rpoB762404c.2598T>C0.977
rpoB762410c.2604T>G0.978
rpoB762416c.2610A>G0.981
rpoB762449c.2643C>A0.984
rpoB762452c.2646G>C0.984
rpoB762470c.2664G>C0.984
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G1.000
rpoB762510p.Ala902Pro1.000
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C0.947
rpoB762536c.2730T>C0.947
rpoB762537c.2731T>C0.947
rpoB762551c.2745C>T0.944
rpoB762557c.2751G>A0.909
rpoB762560c.2754A>C0.900
rpoB762563c.2757G>T0.900
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G0.983
rpoB763040c.3234C>G0.984
rpoB763070c.3264T>C0.970
rpoB763082c.3276C>T0.955
rpoB763088c.3282C>G0.952
rpoB763094c.3288G>C0.953
rpoB763115c.3309T>C0.950
rpoB763127c.3321G>C0.945
rpoB763136c.3330C>T0.958
rpoB763145c.3339G>A0.938
rpoB763157c.3351G>T0.956
rpoB763166c.3360A>G0.974
rpoB763172c.3366G>C0.941
rpoB763193c.3387C>G0.926
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T0.983
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A0.957
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763774c.405G>C1.000
rpoC763781p.Ser138Ala1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C0.941
rpoC764029p.Glu220Asp0.941
rpoC764032p.Asp221Glu0.941
rpoC764040p.Ser224Thr0.947
rpoC764044c.675T>C0.950
rpoC764054c.685C>T0.957
rpoC764059c.690G>T0.962
rpoC764083c.714A>G0.964
rpoC764084p.Asn239Val0.964
rpoC764095c.726C>T0.964
rpoC764098c.729A>G0.964
rpoC764143c.774G>C0.955
rpoC764147p.Ser260Ala0.933
rpoC764150p.Ile261Val0.933
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G1.000
rpoC764317c.948C>G0.957
rpoC764320c.951C>G0.960
rpoC764332c.963G>A0.967
rpoC764338c.969G>A0.970
rpoC764353c.984G>T0.975
rpoC764365c.996C>T0.976
rpoC764371c.1002G>C0.977
rpoC764377c.1008C>G0.977
rpoC764380c.1011G>C0.977
rpoC764387c.1018T>C0.980
rpoC764405c.1036A>C0.981
rpoC764428c.1059G>C0.979
rpoC764431c.1062G>C0.978
rpoC764434c.1065A>G0.977
rpoC764435c.1066A>C0.977
rpoC764458c.1089G>C0.981
rpoC764461c.1092A>G0.981
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G0.982
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A0.979
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T0.978
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C0.986
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C0.979
rpoC764888c.1519T>C0.979
rpoC764911c.1542A>G0.980
rpoC764912p.Met515Gln0.980
rpoC764932c.1563C>A0.983
rpoC764948c.1579T>C0.984
rpoC764968c.1599T>C0.985
rpoC765004c.1635G>C0.968
rpoC765007c.1638T>G0.966
rpoC765008c.1639T>C0.966
rpoC765011c.1642A>T0.966
rpoC765016c.1647C>G0.966
rpoC765019c.1650A>G0.966
rpoC765040c.1671T>C0.974
rpoC765041c.1672T>C0.974
rpoC765047c.1678T>C0.974
rpoC765055c.1686C>G0.974
rpoC765073c.1704G>C0.944
rpoC765076c.1707A>G0.944
rpoC765079c.1710T>G0.938
rpoC765082c.1713G>C0.938
rpoC765085c.1716T>C0.938
rpoC765089c.1720T>C0.938
rpoC765100c.1731G>C0.923
rpoC765103c.1734G>T0.923
rpoC765121c.1752G>T0.909
rpoC765129p.Tyr587Phe0.909
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His0.957
rpoC765408c.2040 2040del1.000
rpoC765409r.2040t>g1.000
rpsL781559c.-1G>C0.920
rpsL781572p.Gln5Asn0.939
rpsL781586c.27C>T0.952
rpsL781595c.36T>C0.939
rpsL781608p.Ser17Ala0.939
rpsL781616c.57C>G0.948
rpsL781628c.69T>C0.968
rpsL781649c.90T>C0.969
rpsL781655c.96T>C0.968
rpsL781658c.99A>C0.967
rpsL781670c.111G>C0.983
rpsL781706c.147T>C0.977
rpsL781715c.156T>G0.975
rpsL781772c.213C>T1.000
rpsL781802c.243G>C0.972
rpsL781814c.255C>T0.974
rpsL781817c.258G>T0.976
rpsL781829c.270G>C0.977
rpsL781832c.273T>C0.978
rpsL781859c.300T>C0.977
rpsL781868c.309T>C0.972
rpsL781871c.312G>C0.971
rpsL781877c.318T>A0.970
rpsL781892c.333A>G0.966
rpsL781898c.339A>T0.964
rpsL781907c.348T>C0.962
rpsL781916c.357T>C0.955
rpsL781929p.Gly124Ser0.941
rpsL781933374G>A0.938
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.974
rrs1472337r.492c>g0.935
rrs1472380r.535g>c0.976
rrs1472446r.601t>a0.975
rrs1472452r.607g>a0.975
rrs1472464r.619a>g0.975
rrs1472612r.767g>t0.950
rrs1472734r.889c>t0.977
rrs1472741r.896g>a0.979
rrs1472846r.1001c>t0.969
rrs1472847r.1002g>a0.969
rrs1472848r.1003t>c0.969
rrs1472860r.1015c>t0.968
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.909
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t0.976
rrs1473290r.1445c>t0.976
rrs1473291r.1446g>t0.976
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac1.000
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t0.957
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474074r.417c>t0.909
rrl1474089r.432c>t0.909
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.902
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t0.978
rrl1474263r.606g>a0.976
rrl1474282r.625g>a0.974
rrl1474306r.649a>c0.952
rrl1474308r.651g>t0.952
rrl1474310r.653t>g0.955
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.962
rrl1474497r.840g>c0.962
rrl1474506r.849c>g0.964
rrl1474507r.850g>c0.964
rrl1474626r.969t>c0.944
rrl1474632r.975g>t0.933
rrl1474636r.979a>t0.964
rrl1474637r.980c>t0.964
rrl1474638r.981c>g0.964
rrl1474639r.982g>t0.964
rrl1474640r.983c>t0.966
rrl1474717r.1060a>g0.935
rrl1474722r.1065t>c0.941
rrl1474743r.1086t>g0.977
rrl1474760r.1103a>g0.978
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c0.957
rrl1475209r.1552g>a0.955
rrl1475213r.1556c>t0.950
rrl1475220r.1563g>t0.950
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475790r.2133c>t1.000
rrl1475975r.2318c>t0.974
rrl1475977r.2320a>g0.974
rrl1475988r.2331a>g0.966
rrl1475989r.2332t>c0.966
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g0.979
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a0.977
rrl1476665r.3008t>a0.964
rrl1476666r.3009c>t0.964
rrl1476674r.3017t>c0.960
rpsA1833536c.-6A>C0.941
rpsA1833538c.-4CA>C0.941
rpsA1833541c.-1T>C0.941
rpsA1833547c.6G>A0.957
rpsA1833589c.48A>C0.981
rpsA1833595c.54T>G0.981
rpsA1833596p.Ser19Ala0.981
rpsA1833604c.63C>T0.985
rpsA1833616c.75A>T0.986
rpsA1833619c.78A>C0.986
rpsA1833625c.84A>G0.987
rpsA1833664c.123C>G0.986
rpsA1833676c.135A>G0.984
rpsA1833679c.138G>T0.984
rpsA1833685c.144G>C0.983
rpsA1833691c.150G>A0.966
rpsA1833694c.153G>T0.983
rpsA1833697c.156C>T0.967
rpsA1833700c.159C>T0.968
rpsA1833709c.168C>T0.973
rpsA1833724c.183C>T0.958
rpsA1833727c.186G>C0.958
rpsA1833733c.192C>G0.979
rpsA1833734p.Ala65Ser0.979
rpsA1833742c.201A>G0.935
rpsA1833745c.204G>C0.978
rpsA1833748c.207C>G0.979
rpsA1833760c.219C>T0.980
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C0.962
rpsA1834228c.687C>A0.974
rpsA1834231c.690T>G0.973
rpsA1834234c.693G>T0.973
rpsA1834240c.699T>C0.974
rpsA1834246c.705G>T0.973
rpsA1834249c.708T>C0.973
rpsA1834252c.711C>G0.974
rpsA1834261c.720A>G0.976
rpsA1834264c.723G>C0.977
rpsA1834279c.738C>T0.980
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.977
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834701p.Gln387Pro1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C0.984
rpsA1834759c.1218A>C0.982
rpsA1834765p.Glu408Asp0.981
rpsA1834774c.1233C>T0.974
rpsA1834776p.Ala412Glu0.972
rpsA1834780c.1239A>G0.972
rpsA1834789c.1248T>C0.972
rpsA1834813c.1272G>T0.964
rpsA1834830p.Ala430Val0.957
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;