TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c4d900b743
Sample: 5d2c4d900b743

Download results

Summary
ID: 5d2c4d900b743
Date: Mon Jul 15 11:01:00 2019
Strain: lineage4.4;lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage4.4Euro-AmericanS;TNone
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T0.969
gyrB6184c.945C>T0.969
gyrB6193c.954G>A0.933
gyrB6196c.957C>T1.000
gyrB6202c.963C>T0.857
gyrB6203p.Ser322Ala0.923
gyrB6214c.975G>C0.929
gyrB6223c.984G>C0.857
gyrB6229c.990G>A0.857
gyrB6613c.1374A>G0.900
gyrB6616c.1377A>G0.800
gyrB6634c.1395T>C0.933
gyrB6637c.1398T>G0.933
gyrB6640c.1401A>C0.933
gyrB6643c.1404A>G0.933
gyrB6646c.1407C>T0.938
gyrB6655c.1416T>C0.976
gyrB6673c.1434A>C0.980
gyrB6676c.1437T>G0.981
gyrB6700c.1461T>C0.982
gyrB6703c.1464G>C0.982
gyrB6706c.1467G>A0.982
gyrB6709c.1470A>G0.982
gyrB6712c.1473G>C0.983
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G0.986
gyrB6775c.1536G>C0.960
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C0.958
gyrA8283p.Ile328Leu0.963
gyrA8288c.987T>C0.964
gyrA8294c.993T>C0.973
gyrA8327c.1026C>T0.977
gyrA8330c.1029C>G0.977
gyrA8339c.1038A>G0.953
gyrA8340p.Ala347Ser0.953
gyrA8354c.1053G>C0.944
gyrA8372c.1071G>T0.900
gyrA8382c.1081C>T0.929
gyrA8804c.1503C>G0.900
gyrA8810c.1509A>G0.909
gyrA8817p.Ser506Ala0.909
gyrA8828c.1527T>C0.923
gyrA8829c.1528T>C0.923
gyrA8837c.1536C>G0.933
gyrA8840c.1539C>T0.933
gyrA8852c.1551T>C0.979
gyrA8858c.1557T>C0.980
gyrA8870c.1569G>C0.966
gyrA8873c.1572A>G0.983
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8921c.1620C>T1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A0.963
rpoB760091c.285G>C0.966
rpoB760101c.295T>C0.967
rpoB760110c.304T>A0.967
rpoB760118c.312T>G0.969
rpoB760121c.315T>C0.969
rpoB760130p.Asp108Glu0.976
rpoB760139c.333A>G0.977
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T0.976
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.977
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn0.984
rpoB760532c.726T>C0.985
rpoB760541c.735G>C0.984
rpoB760567p.Ser254Trp0.967
rpoB760571c.765G>C0.970
rpoB760588p.Thr261Ile0.980
rpoB760591p.Val262Ala0.980
rpoB760595c.789C>T0.980
rpoB760596p.Thr264Pro0.980
rpoB760608c.802C>T0.982
rpoB760611c.805T>C0.983
rpoB760634c.828T>C0.984
rpoB760646c.840C>G0.983
rpoB760655c.849A>G0.982
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760805c.999G>C0.923
rpoB760817c.1011A>G0.938
rpoB760820c.1014T>C0.938
rpoB760826c.1020C>G0.950
rpoB760830c.1024T>C0.957
rpoB760841c.1035T>C0.969
rpoB760858p.Val351Ala0.971
rpoB760862c.1056G>C0.971
rpoB760865c.1059C>T0.971
rpoB760886p.Glu360Asp0.978
rpoB760887p.Thr361Val0.978
rpoB760910c.1104C>T0.979
rpoB760916c.1110C>T0.979
rpoB760928c.1122G>C0.979
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp0.983
rpoB761189c.1383T>C0.983
rpoB761195c.1389G>C0.983
rpoB761198c.1392G>C0.983
rpoB761219c.1413G>C0.985
rpoB761234c.1428G>C0.984
rpoB761249c.1443A>G0.983
rpoB761255c.1449T>G0.981
rpoB761258c.1452G>A0.980
rpoB761261c.1455G>C0.980
rpoB761264c.1458C>G0.961
rpoB761273c.1467T>C0.983
rpoB761318c.1512G>T0.977
rpoB761327c.1521A>G0.976
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761510c.1704T>C1.000
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C0.933
rpoB761573c.1767C>G0.903
rpoB761573r.1767c>cg1.000
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T0.972
rpoB761681c.1875G>A0.971
rpoB761682c.1876C>T0.971
rpoB761687c.1881C>T0.970
rpoB761690c.1884G>C0.970
rpoB761693c.1887G>C0.970
rpoB761705c.1899C>A0.963
rpoB761891c.2085G>C0.933
rpoB761909c.2103T>C0.950
rpoB761912c.2106T>C0.950
rpoB761915p.Asp703Glu0.950
rpoB761916p.Asp704Asn0.950
rpoB761924c.2118G>A0.960
rpoB761930c.2124G>C0.960
rpoB761933c.2127G>C0.960
rpoB761936c.2130C>T0.962
rpoB761948c.2142G>C0.974
rpoB761954c.2148C>A0.975
rpoB761955p.Ile717Val0.976
rpoB761969c.2163G>A0.980
rpoB761990c.2184G>C0.982
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762507c.2702 2702del1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C0.978
rpoC763486c.117T>C0.983
rpoC763492c.123G>C0.983
rpoC763528c.159G>A0.986
rpoC763531c.162G>T0.985
rpoC763546c.177A>G0.986
rpoC763570c.201G>C0.987
rpoC763594c.225C>T0.988
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A1.000
rpoC763900c.531G>C0.971
rpoC763933c.564C>T0.975
rpoC763940p.Ala191Ser0.975
rpoC763945c.576T>C0.975
rpoC763947p.Ala193Val0.975
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T1.000
rpoC764098c.729A>G1.000
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764332c.963G>A1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C0.982
rpoC764431c.1062G>C0.982
rpoC764434c.1065A>G0.982
rpoC764435c.1066A>C0.982
rpoC764458c.1089G>C0.973
rpoC764461c.1092A>G0.971
rpoC764497c.1128A>G0.973
rpoC764510c.1141C>T0.973
rpoC764524c.1155C>G0.958
rpoC764530c.1161C>G0.968
rpoC764534c.1165C>A0.952
rpoC764539c.1170C>T0.983
rpoC764542c.1173C>T0.966
rpoC764545c.1176C>A0.983
rpoC764560c.1191T>C0.986
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T0.983
rpoC764626c.1257C>T0.983
rpoC764632c.1263T>C0.982
rpoC764650c.1281G>T0.983
rpoC764668c.1299C>T0.981
rpoC764692c.1323C>T0.982
rpoC764713c.1344G>T0.983
rpoC764716c.1347G>C0.983
rpoC764746c.1377G>T0.985
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G0.985
rpoC764764c.1395T>C0.984
rpoC764791c.1422C>G0.985
rpoC764803c.1434C>T0.985
rpoC764809c.1440C>T0.984
rpoC764810p.Pro481Ala0.984
rpoC764815c.1446A>G0.984
rpoC764824c.1455T>C0.984
rpoC764827c.1458G>C0.985
rpoC764858c.1489T>C0.986
rpoC764869c.1500C>T0.986
rpoC764875c.1506C>A0.985
rpoC764887c.1518G>C0.984
rpoC764888c.1519T>C0.984
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C0.974
rpoC765055c.1686C>G0.975
rpoC765073c.1704G>C0.947
rpoC765076c.1707A>G0.941
rpoC765079c.1710T>G0.938
rpoC765082c.1713G>C0.938
rpoC765085c.1716T>C0.938
rpoC765089c.1720T>C0.938
rpoC765100c.1731G>C0.933
rpoC765103c.1734G>T0.933
rpoC765358p.Met663Ile0.900
rpoC765370c.2001G>C0.938
rpoC765379c.2010G>C0.941
rpoC765382c.2013G>T0.941
rpoC765383p.Met672Leu0.941
rpoC765403c.2034G>C0.952
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G0.962
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T1.000
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766321c.2952C>G0.909
rpoC766333c.2964G>T0.917
rpoC766345c.2976T>C0.923
rpoC766348c.2979A>G0.923
rpoC766351c.2982C>G0.923
rpoC766353p.Val995Ala0.923
rpoC766369c.3000C>G0.968
rpoC766375c.3006C>G0.970
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T0.980
rpoC766435p.Glu1022Asp0.980
rpoC766501c.3132G>C0.941
rpoC766507c.3138C>T0.944
rpoC766513c.3144C>T0.950
rpoC766522c.3153C>A0.952
rpoC766528c.3159T>G0.952
rpoC766531c.3162G>C0.952
rpoC766534c.3165C>G0.952
rpoC766537c.3168G>A0.952
rpoC766540p.Asp1057Glu0.955
rpoC766549c.3180G>C0.979
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C0.974
rpoC766633c.3264G>C0.973
rpoC766931p.Ala1188Ser0.969
rpoC766942c.3573C>T0.975
rpoC766945c.3576A>C0.976
rpoC766963c.3594T>C0.981
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C0.986
rpoC767098c.3729T>C0.987
rpoC767104c.3735C>G0.986
rpoC767107c.3738C>T0.986
rpoC767119c.3750A>G0.987
rpoC767125c.3756G>C0.986
rpoC767134c.3765C>T0.987
rpoC767138c.3769C>T0.987
rpoC767149c.3780C>T0.986
rpoC767158c.3789T>C0.986
rpoC767179c.3810C>T0.984
rpoC767180p.Ala1271Ser0.984
rpoC767191c.3822C>G0.986
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781742c.183C>G0.909
rpsL781751c.192G>C0.917
rpsL781754c.195G>T0.917
rpsL781760c.201T>C0.917
rpsL781763c.204C>G0.917
rpsL781766c.207C>T0.923
rpsL781772c.213C>T0.977
rpsL781802c.243G>C0.982
rpsL781814c.255C>T0.980
rpsL781817c.258G>T0.981
rpsL781829c.270G>C0.984
rpsL781832c.273T>C0.984
rpsL781859c.300T>C0.964
rpsL781868c.309T>C0.960
rpsL781871c.312G>C0.960
rpsL781877c.318T>A0.957
rpsL781892c.333A>G0.974
rpsL781898c.339A>T0.974
rpsL781907c.348T>C0.939
rpsL781916c.357T>C0.967
rpsL781929p.Gly124Ser0.957
rpsL781933374G>A0.950
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.981
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.984
rrs1472734r.889c>t0.978
rrs1472741r.896g>a0.978
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c1.000
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a0.941
rrl1473697r.40c>a0.941
rrl1473707r.50t>a0.970
rrl1473717r.60g>a0.971
rrl1473731r.74t>a0.976
rrl1473746r.89t>c0.979
rrl1473756r.99g>t0.980
rrl1473758r.101g>t0.980
rrl1473770r.113t>c1.000
rrl1473806r.149c>t0.984
rrl1473812r.155g>a0.981
rrl1473814r.157a>t0.981
rrl1473815r.158t>g0.981
rrl1473829r.172g>c0.980
rrl1473831r.174g>t0.979
rrl1473832r.175c>t0.979
rrl1473839r.182g>a0.982
rrl1473876r.219g>a0.983
rrl1473887r.230t>c0.981
rrl1473888r.231t>c0.981
rrl1473898r.241c>t0.980
rrl1473899r.242a>g0.980
rrl1473916r.259c>a0.978
rrl1473923r.266c>g0.974
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.914
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t0.978
rrl1474263r.606g>a0.975
rrl1474282r.625g>a0.971
rrl1474306r.649a>c0.962
rrl1474308r.651g>t0.962
rrl1474310r.653t>g0.962
rrl1474356r.699t>c0.983
rrl1474362r.705a>g0.983
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.962
rrl1474497r.840g>c0.962
rrl1474506r.849c>g0.981
rrl1474507r.850g>c0.981
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t0.977
rrl1475031r.1374g>c0.967
rrl1475061r.1404ca>c0.974
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t0.968
rrl1476215r.2558c>t0.968
rrl1476221r.2564t>c0.968
rrl1476224r.2567a>g0.971
rrl1476251r.2594t>c0.958
rrl1476281r.2624t>c0.980
rrl1476297r.2640c>t0.978
rrl1476299r.2642c>t0.978
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C0.923
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T0.978
rpsA1833727c.186G>C0.978
rpsA1833733c.192C>G0.917
rpsA1833734p.Ala65Ser0.917
rpsA1833742c.201A>G0.980
rpsA1833745c.204G>C0.981
rpsA1833748c.207C>G0.981
rpsA1833760c.219C>T0.982
rpsA1833787c.246C>G0.963
rpsA1833790c.249T>C0.963
rpsA1833802c.261A>G0.966
rpsA1833811c.270G>T0.966
rpsA1833823c.282G>A0.966
rpsA1833832c.291G>A0.966
rpsA1833838c.297G>C0.965
rpsA1833841c.300C>G0.964
rpsA1833847c.306C>G0.964
rpsA1833856c.315A>G0.962
rpsA1833862c.321G>T0.981
rpsA1833874c.333T>G0.982
rpsA1833886c.345C>G0.981
rpsA1833894p.Ala118Glu0.980
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G0.985
rpsA1834468c.927A>G0.984
rpsA1834477c.936C>T0.982
rpsA1834489c.948T>C0.981
rpsA1834519c.978G>C0.966
rpsA1834520p.Ala327Ser0.966
rpsA1834528c.987T>C0.967
rpsA1834534c.993C>T0.933
rpsA1834543c.1002C>G0.929
rpsA1834546c.1005T>C0.963
rpsA1834552c.1011G>T0.920
rpsA1834555c.1014T>G0.920
rpsA1834557p.Ala339Gly0.920
rpsA1834606c.1065C>T0.979
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C0.973
rpsA1834622c.1081T>A0.973
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T0.981
rpsA1834666c.1125G>C0.978
rpsA1834667p.Ala376Ser0.978
rpsA1834690c.1149T>C1.000
rpsA1834701p.Gln387Pro1.000
rpsA1834704c.1164 1164del1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
embC4240729c.867C>G0.981
embC4240735c.873C>G0.982
embC4240741c.879C>T0.966
embC4240756c.894G>C0.968
embC4240771c.909G>C0.978
embC4240772p.Ser304Ala0.978
embC4240778p.His306Gly0.977
embC4240781p.Ala307Ser0.977
embC4240789c.927T>C0.984
embC4240819c.957A>C0.983
embC4240826p.Ala322Ser0.983
embC4240831c.969T>G0.983
embC4240856p.Ala332Thr0.972
embC4240859p.Leu333Ile0.971
embC4240876c.1014C>T0.969
embC4240879c.1017G>T0.969
embC4240885c.1023T>C0.968
embC4240886p.Ile342Val0.968
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;