TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c4ef77ccc9
Sample: 5d2c4ef77ccc9

Download results

Summary
ID: 5d2c4ef77ccc9
Date: Mon Jul 15 11:04:22 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T0.974
gyrB6184c.945C>T0.974
gyrB6193c.954G>A0.938
gyrB6196c.957C>T0.933
gyrB6202c.963C>T0.929
gyrB6203p.Ser322Ala0.929
gyrB6214c.975G>C0.929
gyrB6223c.984G>C0.929
gyrB6655c.1416T>C1.000
gyrB6664c.1425C>T1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T0.977
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T0.964
gyrB6838c.1599C>T0.981
gyrB6841c.1602T>C0.981
gyrB6862c.1623C>G0.980
gyrB6869c.1630T>C0.974
gyrB6872c.1633T>C0.974
gyrB6878c.1639T>C0.974
gyrB6889c.1650G>A0.971
gyrB6898c.1659G>C0.964
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>A1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7081c.1842T>C0.974
gyrB7084c.1845A>G0.974
gyrB7090c.1851C>T0.974
gyrB7093c.1854T>C0.974
gyrB7100c.1861T>C0.974
gyrA7343c.42G>C0.980
gyrA7355c.54T>A0.980
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T0.961
gyrA7394c.93T>C0.961
gyrA7397c.96G>C0.961
gyrA7412c.111C>G0.961
gyrA7421c.120G>C0.947
gyrA7424c.123G>C0.946
gyrA7427c.126G>C0.944
gyrA7433c.132G>C0.944
gyrA7439c.138C>T0.933
gyrA7442c.141G>C0.933
gyrA7451c.150C>A0.917
gyrA7457c.156T>C0.889
gyrA7499c.198G>C0.962
gyrA7511c.210C>T0.966
gyrA7523c.222C>G0.984
gyrA7526c.225G>C0.985
gyrA7547c.246C>T0.986
gyrA7559c.258G>C0.987
gyrA7565c.264C>T0.988
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.989
gyrA7595c.294C>T0.989
gyrA7607c.306C>T0.987
gyrA7637c.336C>A0.983
gyrA8121c.820T>C0.974
gyrA8129c.828T>C0.974
gyrA8156c.855T>C0.974
gyrA8168c.867A>G0.974
gyrA8174c.873C>G0.974
gyrA8177c.876A>C0.974
gyrA8187p.Leu296Ile0.933
gyrA8192c.891C>G0.964
gyrA8198c.897T>C0.964
gyrA8207c.906T>C0.960
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T0.979
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8366c.1065G>A0.946
gyrA8372c.1071G>T0.971
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>T1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8792c.1491G>C0.909
gyrA8799p.Ala500Ser0.929
gyrA8810c.1509A>G0.933
gyrA8817p.Ser506Ala0.933
gyrA8828c.1527T>C0.938
gyrA8829c.1528T>C0.938
gyrA8837c.1536C>G0.950
gyrA8840c.1539C>T0.952
gyrA8846c.1545C>T0.971
gyrA8852c.1551T>C0.974
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C0.985
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G0.971
gyrA8924c.1623C>T0.953
gyrA8942c.1641G>C0.968
gyrA8945c.1644G>C0.948
gyrA8946c.1645T>C0.966
gyrA8967p.Ala556Lys0.936
gyrA8978c.1677C>T0.911
gyrA8987c.1686C>G0.935
gyrA8990c.1689C>G0.903
gyrA8993c.1692C>T0.867
gyrA8996c.1695T>C0.900
gyrA8998p.Leu566Trp0.933
gyrA9018p.Gln573Lys0.769
rpoB760079c.273G>A0.968
rpoB760091c.285G>C0.976
rpoB760101c.295T>C0.976
rpoB760110c.304T>A0.976
rpoB760118c.312T>G0.978
rpoB760121c.315T>C0.978
rpoB760130p.Asp108Glu0.982
rpoB760139c.333A>G0.982
rpoB760142c.336C>T0.982
rpoB760181c.375T>C0.986
rpoB760184c.378A>G0.986
rpoB760196c.390C>G0.971
rpoB760235c.429T>C0.982
rpoB760244c.438G>C0.980
rpoB760256c.450C>T0.978
rpoB760274p.Glu156Asp0.972
rpoB760276p.Lys157Met0.972
rpoB760283c.477G>C0.971
rpoB760298c.492G>C0.967
rpoB760307c.501T>C0.962
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.953
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>T1.000
rpoB760484c.678A>G1.000
rpoB760499c.693G>A1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760553c.747C>G1.000
rpoB760567c.1913 1913del1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A0.989
rpoC763531c.162G>T0.988
rpoC763546c.177A>G0.988
rpoC763570c.201G>C0.989
rpoC763594c.225C>T0.979
rpoC763609c.240C>T0.980
rpoC763621c.252C>T0.980
rpoC763633c.264T>C0.980
rpoC763657c.288G>A0.975
rpoC763660c.291T>G0.974
rpoC763666c.297G>C0.971
rpoC763669c.300C>G0.971
rpoC763675c.306C>G0.970
rpoC763696c.327T>C0.963
rpoC763699c.330G>T0.957
rpoC763702c.333C>G0.957
rpoC763708c.339G>C0.957
rpoC763711c.342G>C0.957
rpoC763714c.345G>C0.957
rpoC763717c.348T>C0.957
rpoC763723c.354G>C0.957
rpoC763732c.363C>G0.955
rpoC763741c.372C>T0.952
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763888c.519G>T0.909
rpoC763891c.522G>C0.929
rpoC763894c.525A>G0.933
rpoC763900c.531G>C0.958
rpoC763933c.564C>T0.958
rpoC763940p.Ala191Ser0.958
rpoC763945c.576T>C0.958
rpoC763947p.Ala193Val0.979
rpoC763951c.582G>C0.979
rpoC763960c.591T>G0.958
rpoC763969c.600C>T0.958
rpoC763987c.618C>T0.963
rpoC763991p.Ile208Leu0.955
rpoC763996c.627T>C0.947
rpoC763999c.630C>T0.900
rpoC764002c.633C>G0.947
rpoC764003p.Ala212Ser0.900
rpoC764024c.655T>C0.857
rpoC764029p.Glu220Asp0.867
rpoC764032p.Asp221Glu0.941
rpoC764040p.Ser224Thr0.962
rpoC764044c.675T>C0.964
rpoC764054c.685C>T0.972
rpoC764059c.690G>T0.973
rpoC764083c.714A>G0.974
rpoC764084p.Asn239Val0.974
rpoC764098c.729A>G0.974
rpoC764110c.741C>T0.974
rpoC764143c.774G>C0.962
rpoC764147p.Ser260Ala0.962
rpoC764150p.Ile261Val0.962
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G0.944
rpoC764317c.948C>G0.952
rpoC764320c.951C>G0.958
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764362c.993C>T0.975
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C0.976
rpoC764377c.1008C>G0.976
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>T0.978
rpoC764431c.1062G>C0.978
rpoC764434c.1065A>G0.977
rpoC764435c.1066A>C0.977
rpoC764452c.1083T>C0.982
rpoC764458c.1089G>C0.981
rpoC764461c.1092A>G0.980
rpoC764497c.1128A>G0.977
rpoC764509c.1140G>A0.978
rpoC764510c.1141C>T0.977
rpoC764521c.1152T>C0.978
rpoC764527c.1158C>T0.971
rpoC764530c.1161C>T0.970
rpoC764533c.1164C>A0.970
rpoC764536c.1167G>T0.971
rpoC764539c.1170C>G0.971
rpoC764545c.1176C>A0.978
rpoC764575c.1206T>G1.000
rpoC764593c.1224C>T1.000
rpoC764611c.1242G>T0.982
rpoC764626c.1257C>T0.983
rpoC764632c.1263T>C0.967
rpoC764650c.1281G>T0.984
rpoC764668c.1299C>T0.985
rpoC764683c.1314G>A0.973
rpoC764692c.1323C>T0.987
rpoC764713c.1344G>T0.988
rpoC764716c.1347G>C0.988
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764848p.Glu493Asp0.987
rpoC764858c.1489T>C0.986
rpoC764869c.1500C>T0.969
rpoC764875c.1506C>A0.970
rpoC764887c.1518G>C0.969
rpoC764888c.1519T>C0.969
rpoC764911c.1542A>G0.968
rpoC764912p.Met515Gln0.968
rpoC764932c.1563C>A0.973
rpoC764948c.1579T>C0.972
rpoC764968c.1599T>C0.970
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>A1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His0.967
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765529c.2160C>T1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>C1.000
rpoC765835c.2466C>T0.975
rpoC765841c.2472G>T0.977
rpoC765861p.Phe831Tyr0.981
rpoC765875p.Val836Ile0.968
rpoC765895c.2526G>A0.984
rpoC765907c.2538G>T0.983
rpoC765910c.2541G>C0.982
rpoC765928c.2559C>G0.980
rpoC765940c.2571A>T0.980
rpoC765947c.2578T>C0.977
rpoC765962c.2593T>C0.957
rpoC765967c.2598C>T0.955
rpoC765973c.2604C>G0.955
rpoC765979c.2610C>G0.952
rpoC765982c.2613C>T0.952
rpoC765994c.2625A>T0.947
rpoC766003c.2634G>C0.929
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C0.923
rpoC766507c.3138C>T0.933
rpoC766513c.3144C>T0.938
rpoC766522c.3153C>A0.938
rpoC766528c.3159T>G0.938
rpoC766531c.3162G>C0.938
rpoC766534c.3165C>G0.938
rpoC766537c.3168G>A0.941
rpoC766540p.Asp1057Glu0.944
rpoC766549c.3180G>C0.973
rpoC766570c.3201T>C0.974
rpoC766573c.3204T>G0.974
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766975c.3606C>T1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C0.989
rpoC767098c.3729T>C0.989
rpoC767104c.3735C>G0.988
rpoC767107c.3738C>T0.988
rpoC767119c.3750A>G0.988
rpoC767125c.3756G>C0.987
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T0.978
rpsL781802c.243G>C0.981
rpsL781814c.255C>T0.983
rpsL781817c.258G>T0.983
rpsL781829c.270G>C0.985
rpsL781832c.273T>C0.985
rpsL781859c.300T>C0.983
rpsL781868c.309T>C0.981
rpsL781871c.312G>C0.980
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g0.983
rrs1471925r.80t>c0.979
rrs1471931r.86ga>g0.980
rrs1471934r.89a>g0.980
rrs1471985r.140t>c0.949
rrs1471986r.141c>t0.949
rrs1472030r.185g>a0.952
rrs1472031r.186g>c0.952
rrs1472032r.187g>a0.952
rrs1472033r.188a>c0.952
rrs1472035r.190g>t0.952
rrs1472040r.195t>g0.952
rrs1472041r.196c>t0.952
rrs1472042r.197t>g0.952
rrs1472043r.198t>a0.952
rrs1472050r.205g>c0.952
rrs1472061r.216a>t0.978
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472286r.441c>g1.000
rrs1472287r.442c>t1.000
rrs1472289r.444t>g1.000
rrs1472290r.445c>g1.000
rrs1472313r.468g>a1.000
rrs1472315r.470t>g1.000
rrs1472324r.479g>c1.000
rrs1472325r.480g>c1.000
rrs1472327r.482g>a1.000
rrs1472328r.483g>c1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c0.981
rrs1472446r.601t>a0.982
rrs1472452r.607g>a0.981
rrs1472464r.619a>g0.981
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c0.982
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.984
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t0.979
rrs1473290r.1445c>t0.979
rrs1473291r.1446g>t0.979
rrl1473684r.27g>a0.917
rrl1473697r.40c>a0.923
rrl1473707r.50t>a0.952
rrl1473717r.60g>a0.958
rrl1473731r.74t>a0.931
rrl1473746r.89t>c0.971
rrl1473756r.99g>t0.975
rrl1473758r.101g>t0.976
rrl1473770r.113t>c0.977
rrl1473806r.149c>t0.982
rrl1473812r.155g>a0.962
rrl1473814r.157a>t0.962
rrl1473815r.158t>g0.980
rrl1473829r.172g>c0.980
rrl1473831r.174g>t0.979
rrl1473832r.175c>t0.979
rrl1473839r.182g>a0.980
rrl1473876r.219g>a0.982
rrl1473887r.230t>c0.981
rrl1473888r.231t>c0.980
rrl1473898r.241c>t0.977
rrl1473899r.242a>g0.977
rrl1473916r.259c>a0.976
rrl1473923r.266c>g0.967
rrl1473937r.280c>t0.963
rrl1473943r.286g>t0.960
rrl1473945r.288t>a0.958
rrl1473946r.289a>t0.958
rrl1473950r.293g>t0.958
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t0.973
rrl1474140r.483c>t0.975
rrl1474151r.494c>t0.953
rrl1474184r.527c>a0.947
rrl1474249r.592g>t0.986
rrl1474263r.606g>a0.985
rrl1474282r.625g>a0.983
rrl1474291r.634tttcctctccggagga>t0.981
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.984
rrl1474362r.705a>g0.983
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474418r.761cacgcgcatacgcgcgtgtgaat>c1.000
rrl1474496r.839c>g0.933
rrl1474497r.840g>c0.932
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474710r.1053tggtg>t0.971
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a0.957
rrl1475443r.1786g>a0.929
rrl1475452r.1795c>a0.966
rrl1475475r.1818c>t0.964
rrl1475479r.1822c>t0.963
rrl1475480r.1823a>t0.964
rrl1475505r.1848g>a0.972
rrl1475526r.1869c>a0.975
rrl1475531r.1874c>t0.974
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a0.977
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a0.944
rrl1476086r.2429g>a0.944
rrl1476088r.2431a>c0.944
rrl1476099r.2442a>g0.944
rrl1476103r.2446c>g0.944
rrl1476105r.2448g>a0.944
rrl1476106r.2449a>t0.944
rrl1476110r.2453g>c0.944
rrl1476114r.2457t>c0.944
rrl1476115r.2458t>c0.944
rrl1476131r.2474c>t0.972
rrl1476160r.2503t>c0.976
rrl1476214r.2557g>t0.974
rrl1476215r.2558c>t0.972
rrl1476221r.2564t>c0.973
rrl1476224r.2567a>g0.973
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a0.957
rrl1476666r.3009c>t0.957
rrl1476674r.3017t>c0.947
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C0.981
rpsA1833691c.150G>A0.980
rpsA1833694c.153G>T0.979
rpsA1833697c.156C>T0.979
rpsA1833700c.159C>T0.979
rpsA1833709c.168C>T0.973
rpsA1833724c.183C>T0.973
rpsA1833727c.186G>C0.972
rpsA1833733c.192C>G0.958
rpsA1833734p.Ala65Ser0.959
rpsA1833745c.204G>C0.974
rpsA1833748c.207C>G0.974
rpsA1833760c.219C>T0.975
rpsA1833787c.246C>G0.971
rpsA1833790c.249T>C0.971
rpsA1833802c.261A>G0.972
rpsA1833811c.270G>T0.971
rpsA1833823c.282G>A0.958
rpsA1833832c.291G>A0.967
rpsA1833835c.294C>T0.964
rpsA1833838c.297G>C0.963
rpsA1833841c.300C>G0.964
rpsA1833847c.306C>G0.973
rpsA1833862c.321G>T0.986
rpsA1833874c.333T>G0.986
rpsA1833877c.336C>G0.986
rpsA1833886c.345C>G0.986
rpsA1833894p.Ala118Glu0.986
rpsA1833928c.387G>C0.976
rpsA1833949c.408T>C0.988
rpsA1833958c.417C>T0.988
rpsA1833961c.420C>G0.988
rpsA1833970c.429G>T0.988
rpsA1833979c.438T>C0.975
rpsA1833991c.450C>G0.988
rpsA1834000c.459G>C0.987
rpsA1834009c.468C>T0.957
rpsA1834012c.471G>C0.985
rpsA1834015c.474G>C0.986
rpsA1834021c.480C>T0.987
rpsA1834030c.489C>G0.987
rpsA1834073p.Lys178Arg0.983
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834348c.807T>C0.985
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>T1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834516c.975G>A0.980
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T0.983
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.971
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834747c.1206A>G0.960
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
kasA2518738c.624G>C0.939
kasA2518768c.654C>G0.959
kasA2518771c.657C>G0.959
kasA2518774c.660C>T0.959
kasA2518783c.669T>G0.979
kasA2518787p.Arg225Lys0.979
kasA2518792c.678C>T0.979
kasA2518795c.681C>T0.979
kasA2518798c.684G>C0.960
kasA2518822c.708C>A0.986
kasA2518825c.711T>C1.000
kasA2518846c.732G>T0.983
kasA2518849c.735G>C0.981
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044150c.132T>G1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044240c.42C>G1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C0.985
embC4240826p.Ala322Ser0.955
embC4240831c.969T>G0.984
embC4240856p.Ala332Thr0.973
embC4240859p.Leu333Ile0.973
embC4240876c.1014C>T0.971
embC4240879c.1017G>T0.969
embC4240885c.1023T>C0.963
embC4240886p.Ile342Val0.963
embC4240897c.1035C>G0.957
embC4240900c.1038A>G0.957

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;