TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c5219eab6a
Sample: 5d2c5219eab6a

Download results

Summary
ID: 5d2c5219eab6a
Date: Mon Jul 15 11:18:25 2019
Strain: lineage2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.966
gyrB6115c.876A>G0.968
gyrB6121c.882C>T0.968
gyrB6127c.888G>C0.938
gyrB6133c.894G>C0.938
gyrB6136c.897G>A0.938
gyrB6151c.912C>T0.938
gyrB6172c.933C>T0.938
gyrB6184c.945C>T0.938
gyrB6193c.954G>A0.818
gyrB6196c.957C>T0.818
gyrB6634c.1395T>C0.938
gyrB6637c.1398T>G0.938
gyrB6640c.1401A>C0.938
gyrB6643c.1404A>G0.938
gyrB6646c.1407C>T0.933
gyrB6655c.1416T>C0.952
gyrB6673c.1434A>C0.966
gyrB6676c.1437T>G0.969
gyrB6703c.1464G>C0.973
gyrB6706c.1467G>A0.973
gyrB6709c.1470A>G0.973
gyrB6712c.1473G>C0.973
gyrB6727c.1488G>T0.976
gyrB6728c.1489C>T0.976
gyrB6739c.1500C>T0.980
gyrB6745c.1506T>C0.981
gyrB6754c.1515C>T0.983
gyrB6763c.1524G>C0.982
gyrB6772c.1533C>G0.981
gyrB6775c.1536G>C0.981
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7100c.1861T>C1.000
gyrA7499c.198G>C0.947
gyrA7511c.210C>T0.932
gyrA7523c.222C>G0.958
gyrA7526c.225G>A0.958
gyrA7547c.246C>T0.968
gyrA7553c.252C>T0.969
gyrA7559c.258G>C0.969
gyrA7565c.264C>T0.971
gyrA7574c.273G>C0.975
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.978
gyrA7595c.294C>T0.978
gyrA7607c.306C>T0.977
gyrA7637c.336C>A0.940
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T0.984
gyrA8330c.1029C>G0.984
gyrA8339c.1038A>G0.983
gyrA8340p.Ala347Ser0.983
gyrA8354c.1053G>C0.981
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C0.947
gyrA8609c.1308G>C0.947
gyrA8619c.1318T>C0.947
gyrA8624c.1323G>T0.947
gyrA8633c.1332C>G0.947
gyrA8636c.1335A>C0.947
gyrA8642c.1341A>G0.947
gyrA8645c.1344C>G0.947
gyrA8649p.Arg450Lys0.947
gyrA8666c.1365G>C0.947
gyrA8672c.1371A>G0.900
gyrA8693c.1392T>C0.882
gyrA8696c.1395G>C0.875
gyrA8699c.1398A>G0.867
gyrA8783c.1482G>C0.900
gyrA8786c.1485T>G0.917
gyrA8792c.1491G>C0.923
gyrA8799p.Ala500Ser0.938
gyrA8810c.1509A>G0.952
gyrA8817p.Ser506Ala0.952
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C0.984
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G0.987
gyrA8942c.1641G>C0.984
gyrA8945c.1644G>C0.983
gyrA8946c.1645T>C0.983
gyrA8967p.Ala556Lys0.982
gyrA8978c.1677C>T0.980
gyrA8987c.1686C>G0.966
gyrA8990c.1689C>G0.962
gyrA8993c.1692C>T0.958
gyrA8996c.1695T>C0.958
gyrA8998p.Leu566Trp0.920
gyrA9018p.Gln573Lys0.818
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.982
rpoB760406r.600ga>g1.000
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C0.985
rpoB760567p.Ser254Trp0.964
rpoB760571c.765G>C0.968
rpoB760588p.Thr261Ile0.976
rpoB760591p.Val262Ala0.976
rpoB760595c.789C>T0.976
rpoB760596p.Thr264Pro0.976
rpoB760608c.802C>T0.977
rpoB760611c.805T>C0.977
rpoB760634c.828T>C0.976
rpoB760646c.840C>G0.975
rpoB760655c.849A>G0.974
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760793c.987A>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761105c.1299C>T1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C0.987
rpoB761198c.1392G>C0.987
rpoB761219c.1413G>C0.989
rpoB761234c.1428G>C0.988
rpoB761249c.1443A>G0.988
rpoB761255c.1449T>G0.987
rpoB761258c.1452G>A0.987
rpoB761261c.1455G>C0.974
rpoB761264c.1458C>G0.964
rpoB761273c.1467T>C0.989
rpoB761303c.1497G>C0.987
rpoB761318c.1512G>T0.986
rpoB761327c.1521A>G0.985
rpoB761333c.1527G>T0.984
rpoB761339c.1533C>G0.982
rpoB761345c.1539G>C1.000
rpoB761346p.Val514Ser1.000
rpoB761354c.1548C>A0.917
rpoB761357c.1551G>T0.917
rpoB761360c.1554T>C0.917
rpoB761362p.Ser519Thr0.917
rpoB761373p.Val523His0.917
rpoB761384c.1578C>G0.917
rpoB761393c.1587G>A0.917
rpoB761482p.Ala559Gly0.900
rpoB761497p.Tyr564Phe0.900
rpoB761502p.Pro566Ser0.900
rpoB761505p.Ser567Ala0.900
rpoB761508p.Ser568Thr0.900
rpoB761516c.1710G>C0.967
rpoB761528c.1722C>T0.972
rpoB761531c.1725C>T0.947
rpoB761537c.1731C>G0.976
rpoB761555c.1749G>C0.978
rpoB761558c.1752C>G0.978
rpoB761564c.1758G>C0.979
rpoB761570c.1764T>C0.961
rpoB761573c.1767C>G0.944
rpoB761579c.1773G>C0.984
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761891c.2085G>C1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T0.987
rpoB762047c.2241G>A0.986
rpoB762053c.2247T>C0.986
rpoB762056c.2250G>A0.985
rpoB762065c.2259T>G0.983
rpoB762083c.2277T>C0.964
rpoB762086c.2280G>C0.964
rpoB762101c.2295C>G0.968
rpoB762114p.Ile770Val0.967
rpoB762122c.2316C>T0.966
rpoB762131c.2325C>G0.956
rpoB762134c.2328C>A0.950
rpoB762137c.2331C>T0.950
rpoB762140c.2334G>C0.951
rpoB762143c.2337T>C0.951
rpoB762149c.2343G>T0.959
rpoB762158c.2352G>C0.964
rpoB762167c.2361T>C0.964
rpoB762176c.2370T>C0.982
rpoB762185c.2379G>C0.982
rpoB762194c.2388G>C0.983
rpoB762233c.2427G>C0.984
rpoB762236c.2430G>C0.984
rpoB762245c.2439G>C0.985
rpoB762275c.2469C>T0.981
rpoB762284c.2478G>C0.980
rpoB762293c.2487T>C0.978
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C0.977
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G1.000
rpoB762510p.Ala902Pro1.000
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762560c.2754A>C0.900
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>T1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C0.970
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G0.982
rpoB762920c.3114C>T0.981
rpoB762923c.3117C>G0.981
rpoB762929c.3123G>C0.985
rpoB762959c.3153G>C0.973
rpoB762962c.3156C>T0.972
rpoB762995c.3189G>T0.975
rpoB763031c.3225T>G0.987
rpoB763034c.3228C>G0.975
rpoB763040c.3234C>G0.976
rpoB763070c.3264T>C0.988
rpoB763082c.3276C>T0.988
rpoB763088c.3282C>G0.988
rpoB763094c.3288G>C0.988
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763193c.3387C>G1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T0.984
rpoC763546c.177A>G1.000
rpoC763570c.201G>C0.986
rpoC763594c.225C>T0.987
rpoC763609c.240C>T0.962
rpoC763633c.264T>C0.987
rpoC763657c.288G>A0.942
rpoC763660c.291T>G0.956
rpoC763666c.297G>C0.937
rpoC763669c.300C>G0.922
rpoC763675c.306C>G0.951
rpoC763696c.327T>C0.912
rpoC763699c.330G>T0.912
rpoC763702c.333C>G0.909
rpoC763708c.339G>C0.897
rpoC763711c.342G>C0.897
rpoC763714c.345G>C0.897
rpoC763717c.348T>C0.897
rpoC763723c.354G>C0.929
rpoC763732c.363C>A0.929
rpoC763741c.372C>T0.917
rpoC763744c.375G>C0.917
rpoC763747c.378G>A0.917
rpoC763765c.396T>C0.889
rpoC763900c.531G>C0.974
rpoC763933c.564C>T0.976
rpoC763940p.Ala191Ser0.976
rpoC763945c.576T>C0.976
rpoC763947p.Ala193Val0.976
rpoC763951c.582G>C0.976
rpoC763960c.591T>G0.976
rpoC763969c.600C>T0.976
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr0.960
rpoC764044c.675T>C0.962
rpoC764054c.685C>T0.960
rpoC764059c.690G>T0.962
rpoC764083c.714A>G0.967
rpoC764084p.Asn239Val0.967
rpoC764095c.726C>T0.933
rpoC764098c.729A>G0.967
rpoC764143c.774G>C0.960
rpoC764147p.Ser260Ala0.952
rpoC764150p.Ile261Val0.947
rpoC764165p.Glu266Gln0.944
rpoC764311c.942C>G0.950
rpoC764317c.948C>G0.955
rpoC764320c.951C>G0.957
rpoC764332c.963G>A0.963
rpoC764338c.969G>A0.963
rpoC764353c.984G>T0.974
rpoC764365c.996C>T0.950
rpoC764371c.1002G>C0.955
rpoC764377c.1008C>G0.958
rpoC764380c.1011G>C0.959
rpoC764387c.1018T>C0.962
rpoC764405c.1036A>C0.966
rpoC764428c.1059G>C0.984
rpoC764431c.1062G>C0.984
rpoC764434c.1065A>G0.984
rpoC764435c.1066A>C0.984
rpoC764458c.1089G>C0.986
rpoC764461c.1092A>G0.984
rpoC764497c.1128A>G0.985
rpoC764510c.1141C>T0.986
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T1.000
rpoC764545c.1176C>A0.984
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T0.986
rpoC764626c.1257C>T0.987
rpoC764632c.1263T>C0.986
rpoC764650c.1281G>T0.984
rpoC764668c.1299C>T0.982
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A0.985
rpoC764887c.1518G>C0.985
rpoC764888c.1519T>C0.985
rpoC764911c.1542A>G0.982
rpoC764912p.Met515Gln0.982
rpoC764932c.1563C>A0.984
rpoC764948c.1579T>C0.984
rpoC764968c.1599T>C0.984
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T0.955
rpoC765129p.Tyr587Phe0.955
rpoC765143p.Val592Ile0.938
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C0.960
rpoC765405p.Leu679His0.923
rpoC765409c.2040T>G0.963
rpoC765421c.2052C>G0.974
rpoC765449p.Ala694Ser0.980
rpoC765454c.2085C>G0.980
rpoC765469c.2100G>C0.984
rpoC765478c.2109T>G0.983
rpoC765480p.Tyr704Phe0.983
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T1.000
rpoC765826c.2457T>C0.970
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T0.974
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C0.944
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G0.929
rpoC766321c.2952C>G0.923
rpoC766333c.2964G>T0.933
rpoC766345c.2976T>C0.933
rpoC766348c.2979A>G0.933
rpoC766351c.2982C>G0.933
rpoC766353p.Val995Ala0.933
rpoC766369c.3000C>G0.966
rpoC766375c.3006C>G0.966
rpoC766381c.3012C>T0.967
rpoC766384c.3015A>G0.969
rpoC766390c.3021C>T0.971
rpoC766393c.3024C>T0.971
rpoC766408c.3039C>T0.976
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C0.955
rpoC766867c.3498C>G0.955
rpoC766876c.3507C>T0.955
rpoC766931p.Ala1188Ser0.972
rpoC766942c.3573C>T0.978
rpoC766945c.3576A>C0.981
rpoC766963c.3594T>C0.983
rpoC766996c.3627C>T0.987
rpoC767002c.3633G>C0.988
rpoC767008c.3639G>A0.988
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C0.984
rpoC767098c.3729T>C0.983
rpoC767104c.3735C>G0.982
rpoC767107c.3738C>T0.982
rpoC767119c.3750A>G0.981
rpoC767125c.3756G>C0.981
rpoC767134c.3765C>T0.981
rpoC767138c.3769C>T0.981
rpoC767149c.3780C>T0.981
rpoC767158c.3789T>C0.982
rpoC767179c.3810C>T0.981
rpoC767180p.Ala1271Ser0.981
rpoC767191c.3822C>G0.982
rpoC767197c.3828G>A0.982
rpoC767203c.3834C>G0.979
rpoC767206c.3837C>G0.979
rpoC767209c.3840T>C0.979
rpoC767212c.3843G>C0.980
rpoC767221c.3852C>G0.984
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g0.982
rrs1471925r.80t>c0.980
rrs1471931r.86ga>g0.980
rrs1471934r.89a>g0.980
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.983
rrs1472337r.492c>g1.000
rrs1472380r.535g>c0.982
rrs1472446r.601t>a0.961
rrs1472452r.607g>a0.959
rrs1472464r.619a>g0.957
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c0.971
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g0.975
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.941
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473697r.40c>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a0.980
rrl1473887r.230t>c0.977
rrl1473888r.231t>c0.976
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a0.969
rrl1473923r.266c>g0.966
rrl1473937r.280c>t1.000
rrl1473943r.286g>t0.947
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.953
rrl1474184r.527c>a0.984
rrl1474249r.592g>t0.981
rrl1474263r.606g>a0.980
rrl1474282r.625g>a0.971
rrl1474306r.649a>c0.941
rrl1474308r.651g>t0.941
rrl1474310r.653t>g0.941
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474576r.919t>c0.985
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474710r.1053tggtg>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t0.978
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a0.941
rrl1475443r.1786g>a0.947
rrl1475452r.1795c>a0.950
rrl1475475r.1818c>t0.962
rrl1475479r.1822c>t0.960
rrl1475480r.1823a>t0.960
rrl1475505r.1848g>a0.968
rrl1475526r.1869c>a0.966
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c0.975
rrl1476214r.2557g>t0.972
rrl1476215r.2558c>t0.972
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t0.981
rrl1476594r.2937c>t0.981
rrl1476597r.2940g>a0.981
rrl1476603r.2946g>a0.982
rrl1476608r.2951c>g0.982
rrl1476619r.2962c>t0.980
rrl1476628r.2971t>a0.980
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
inhA1674993c.792G>T1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C0.978
rpsA1833595c.54T>G0.978
rpsA1833596p.Ser19Ala0.978
rpsA1833604c.63C>T0.981
rpsA1833616c.75A>T0.981
rpsA1833619c.78A>C0.982
rpsA1833625c.84A>G0.983
rpsA1833664c.123C>G0.982
rpsA1833676c.135A>G0.976
rpsA1833679c.138G>T0.976
rpsA1833685c.144G>C0.975
rpsA1833691c.150G>A0.974
rpsA1833694c.153G>T0.973
rpsA1833697c.156C>T0.973
rpsA1833700c.159C>T0.974
rpsA1833709c.168C>T0.980
rpsA1833724c.183C>T0.977
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.915
rpsA1833734p.Ala65Ser0.915
rpsA1833734r.193g>gt0.957
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G0.986
rpsA1833790c.249T>C0.986
rpsA1833802c.261A>G0.986
rpsA1833811c.270G>T0.986
rpsA1833823c.282G>A0.986
rpsA1833832c.291G>A0.987
rpsA1833838c.297G>C0.987
rpsA1833841c.300C>G0.987
rpsA1833847c.306C>G0.986
rpsA1833856c.315A>G0.986
rpsA1833862c.321G>T0.986
rpsA1833874c.333T>G0.986
rpsA1833886c.345C>G0.986
rpsA1833894p.Ala118Glu0.973
rpsA1833928c.387G>C0.985
rpsA1833949c.408T>C0.984
rpsA1833961c.420C>G0.985
rpsA1833970c.429G>T0.985
rpsA1833979c.438T>C0.985
rpsA1833991c.450C>G0.985
rpsA1834000c.459G>C0.969
rpsA1834009c.468C>T0.981
rpsA1834012c.471G>C0.981
rpsA1834015c.474G>C0.982
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A0.963
rpsA1834231c.690T>G0.963
rpsA1834234c.693G>T0.966
rpsA1834240c.699T>C0.964
rpsA1834246c.705G>T0.966
rpsA1834249c.708T>C0.967
rpsA1834252c.711C>G0.968
rpsA1834261c.720A>G0.974
rpsA1834264c.723G>C0.976
rpsA1834279c.738C>T0.978
rpsA1834294c.753G>T0.980
rpsA1834297c.756C>T0.979
rpsA1834303c.762T>G0.978
rpsA1834306c.765T>C0.979
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C0.982
rpsA1834622c.1081T>A0.981
rpsA1834633c.1092A>G0.984
rpsA1834639c.1098T>C0.985
rpsA1834645c.1104C>T0.986
rpsA1834666c.1125G>C0.983
rpsA1834667p.Ala376Ser0.984
rpsA1834690c.1149T>C0.983
rpsA1834700p.Gln387Ala0.980
rpsA1834705c.1164C>G0.981
rpsA1834720c.1179C>G0.984
rpsA1834732c.1191T>C0.984
rpsA1834738c.1197A>G0.986
rpsA1834753c.1212T>C0.986
rpsA1834759c.1218A>C0.985
rpsA1834765p.Glu408Asp0.969
rpsA1834774c.1233C>T0.981
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T0.978
kasA2518849c.735G>C0.978
kasA2518853p.Leu247Val0.977
kasA2518864c.750G>C0.976
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;