TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d2c5670c8b21
Sample: 5d2c5670c8b21

Download results

Summary
ID: 5d2c5670c8b21
Date: Mon Jul 15 11:36:14 2019
Strain: lineage2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T0.950
gyrB6202c.963C>T0.938
gyrB6203p.Ser322Ala0.938
gyrB6214c.975G>C0.938
gyrB6223c.984G>C0.938
gyrB6739c.1500C>T0.933
gyrB6745c.1506T>C0.941
gyrB6754c.1515C>T0.955
gyrB6763c.1524G>C0.962
gyrB6775c.1536G>C0.966
gyrB6793c.1554T>C0.979
gyrB6798p.Gly520Ala0.980
gyrB6808c.1569C>G0.981
gyrB6824c.1585C>T0.981
gyrB6838c.1599C>T0.962
gyrB6841c.1602T>C0.981
gyrB6862c.1623C>G0.981
gyrB6869c.1630T>C0.977
gyrB6872c.1633T>C0.976
gyrB6878c.1639T>C0.976
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>C1.000
gyrB7006c.1767T>G0.960
gyrB7010p.Leu591Met0.963
gyrB7015c.1776G>A0.963
gyrB7018c.1779G>C0.966
gyrB7024c.1785G>A0.968
gyrB7033c.1794G>C0.970
gyrB7051p.Glu604Asp0.971
gyrB7060c.1821T>C0.944
gyrB7066c.1827G>T0.944
gyrB7081c.1842T>C0.944
gyrB7084c.1845A>G0.944
gyrB7090c.1851C>T0.944
gyrB7093c.1854T>C0.944
gyrB7100c.1861T>C0.944
gyrA7343c.42G>C1.000
gyrA7355c.54T>A1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7412c.111C>G1.000
gyrA7499c.198G>C0.980
gyrA7511c.210C>T0.982
gyrA7523c.222C>G0.984
gyrA7526c.225G>C0.985
gyrA7547c.246C>T0.976
gyrA7559c.258G>C0.978
gyrA7565c.264C>T0.979
gyrA7574c.273G>C0.980
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.981
gyrA7595c.294C>T0.980
gyrA7607c.306C>T0.978
gyrA7637c.336C>A0.971
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8571c.1270C>T0.958
gyrA8576c.1275C>G0.964
gyrA8580p.Ile427Val0.966
gyrA8603c.1302A>C0.967
gyrA8609c.1308G>C0.967
gyrA8619c.1318T>C0.967
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>T1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8792c.1491G>C0.938
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8924c.1623C>T1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>A1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
gyrA9023c.1722A>C1.000
gyrA9026c.1725G>C1.000
gyrA9029c.1728T>C1.000
gyrA9032c.1731T>C1.000
gyrA9035c.1734G>C1.000
gyrA9044c.1743C>G1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C0.972
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G0.987
rpoB760235c.429T>C0.985
rpoB760244c.438G>C0.984
rpoB760256c.450C>T0.984
rpoB760274p.Glu156Asp0.977
rpoB760276p.Lys157Met0.975
rpoB760283c.477G>C0.972
rpoB760298c.492G>C0.970
rpoB760307c.501T>C0.963
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.900
rpoB760407p.Ser201Gly0.985
rpoB760415c.609C>T0.988
rpoB760418c.612G>C0.988
rpoB760430c.624T>C0.989
rpoB760460c.654G>C0.990
rpoB760475c.669A>G0.990
rpoB760481c.675G>T0.989
rpoB760484c.678A>G0.989
rpoB760499c.693G>A0.989
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760553c.747C>G1.000
rpoB760561c.756 757del1.000
rpoB761722p.Glu639Gly0.895
rpoB761727641SGVIEEVSADYITVMHDNGTRRTYRMRKFARSNHGTCANQCPIVDAGDRVEAGQVIADGPCTDDGEMALGKNLLVAIMPWEGHNYEDAIILSNRLVEEDVLTSIHIEEHEIDARDTKLGAEEITRDIPNISDEVLADLDERGIVRIGAEVRDGDILVGKVTPKGETELTPEERLLRAIFGEKAREVRDTSLKVPHGESGKVIGIRVFSREDEDELPAGVNELVRVYVAQKRKISDGDKLAGRHGNKGVIGKILPVEDMPFL>640GRRHRRGVCRLRHCDARQRHPAYLPDAQVCPVQPRHLRQPVPHRGRGRPSRGRSGRRGRSLHRERRNGPR*1.000
rpoB762510p.Ala902Pro0.951
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762557c.2751G>A1.000
rpoB762560c.2754A>T1.000
rpoB762827c.3021G>C0.963
rpoB762857c.3051C>G0.976
rpoB762860c.3054G>C0.976
rpoB762863c.3057T>C0.976
rpoB762866c.3060C>T0.977
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T0.957
rpoB763145c.3339G>A0.956
rpoB763157c.3351G>T0.950
rpoB763166c.3360A>G0.943
rpoB763172c.3366G>C0.939
rpoB763179c.3373C>T0.931
rpoB763193c.3387C>G0.952
rpoC763402c.33C>T0.833
rpoC763408c.39T>C0.833
rpoC763411c.42T>C0.833
rpoC763414c.45T>G0.882
rpoC763415p.Thr16Ser0.833
rpoC763423p.Glu18Asp0.882
rpoC763430c.61A>C0.882
rpoC763433p.Gln22Asn0.882
rpoC763443p.Tyr25Phe0.889
rpoC763450c.81G>A0.949
rpoC763456c.87A>G0.950
rpoC763468c.99G>C0.957
rpoC763486c.117T>C0.962
rpoC763492c.123G>C0.982
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C0.982
rpoC763594c.225C>T1.000
rpoC763609c.240C>T1.000
rpoC763621c.252C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.984
rpoC763660c.291T>G0.984
rpoC763666c.297G>C0.982
rpoC763669c.300C>G0.964
rpoC763675c.306C>G0.981
rpoC763696c.327T>C0.962
rpoC763699c.330G>T0.957
rpoC763702c.333C>G0.955
rpoC763708c.339G>C0.952
rpoC763711c.342G>C0.952
rpoC763714c.345G>C0.952
rpoC763717c.348T>C0.952
rpoC763723c.354G>C0.952
rpoC763732c.363C>G0.947
rpoC763741c.372C>T0.944
rpoC763744c.375G>C0.944
rpoC763747c.378G>A0.944
rpoC763765c.396T>C0.929
rpoC763879c.510A>G0.909
rpoC763888c.519G>T0.917
rpoC763891c.522G>C0.929
rpoC763894c.525A>G0.938
rpoC763900c.531G>C0.975
rpoC763933c.564C>T0.917
rpoC763940p.Ala191Ser0.938
rpoC763945c.576T>C0.917
rpoC763947p.Ala193Val0.938
rpoC763951c.582G>C0.938
rpoC763960c.591T>G0.938
rpoC763969c.600C>T0.938
rpoC763987c.618C>T0.897
rpoC763991p.Ile208Leu0.870
rpoC763996c.627T>C0.870
rpoC763999c.630C>T0.870
rpoC764002c.633C>G0.870
rpoC764003p.Ala212Ser0.870
rpoC764024c.655T>C0.923
rpoC764029p.Glu220Asp0.931
rpoC764032p.Asp221Glu0.964
rpoC764040p.Ser224Thr0.970
rpoC764044c.675T>C0.971
rpoC764054c.685C>T0.944
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val0.974
rpoC764098c.729A>G0.974
rpoC764110c.741C>T0.974
rpoC764143c.774G>C0.952
rpoC764147p.Ser260Ala0.950
rpoC764150p.Ile261Val0.944
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764362c.993C>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>T1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764452c.1083T>C0.987
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764509c.1140G>A0.988
rpoC764510c.1141C>T1.000
rpoC764521c.1152T>C0.988
rpoC764527c.1158C>T0.986
rpoC764530c.1161C>T0.985
rpoC764533c.1164C>A0.985
rpoC764536c.1167G>T1.000
rpoC764539c.1170C>G1.000
rpoC764545c.1176C>A0.988
rpoC764575c.1206T>G1.000
rpoC764578c.1209C>T0.987
rpoC764593c.1224C>T0.987
rpoC764611c.1242G>T0.986
rpoC764626c.1257C>T0.971
rpoC764632c.1263T>C0.969
rpoC764650c.1281G>T0.986
rpoC764668c.1299C>T0.983
rpoC764692c.1323C>T0.985
rpoC764713c.1344G>T0.985
rpoC764716c.1347G>C0.985
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.988
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.986
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.987
rpoC764875c.1506C>A0.987
rpoC764887c.1518G>C0.985
rpoC764888c.1519T>C0.970
rpoC764911c.1542A>G0.986
rpoC764912p.Met515Gln0.986
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765001c.1632C>T1.000
rpoC765004c.1635G>T1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>A1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G0.986
rpoC765480p.Tyr704Phe0.986
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G0.984
rpoC765529c.2160C>T1.000
rpoC765533p.Tyr722His0.981
rpoC765544c.2175C>G0.966
rpoC765547c.2178C>T0.964
rpoC765548c.2179A>T0.964
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>C0.964
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765895c.2526G>A1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766009c.2640G>C1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C0.905
rpoC766507c.3138C>T0.913
rpoC766513c.3144C>T0.885
rpoC766522c.3153C>A0.885
rpoC766528c.3159T>G0.885
rpoC766531c.3162G>C0.885
rpoC766534c.3165C>G0.885
rpoC766537c.3168G>A0.885
rpoC766540p.Asp1057Glu0.897
rpoC766549c.3180G>C0.929
rpoC766570c.3201T>C0.951
rpoC766573c.3204T>G0.951
rpoC766582c.3213C>T0.927
rpoC766594c.3225G>T0.951
rpoC766607p.Ile1080Leu0.951
rpoC766618c.3249G>T0.951
rpoC766624c.3255G>C0.974
rpoC766630c.3261G>C0.971
rpoC766633c.3264G>C0.967
rpoC766921c.3552G>C0.900
rpoC766931p.Ala1188Ser0.968
rpoC766942c.3573C>T0.972
rpoC766945c.3576A>C0.973
rpoC766963c.3594T>C0.978
rpoC766996c.3627C>T0.984
rpoC767002c.3633G>C0.985
rpoC767008c.3639G>A0.985
rpoC767023c.3654C>T0.985
rpoC767044c.3675G>C0.984
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn0.981
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.974
rpsL781572p.Gln5Asn0.957
rpsL781586c.27C>T0.967
rpsL781595c.36T>C0.986
rpsL781608p.Ser17Ala0.974
rpsL781616c.57C>G0.977
rpsL781628c.69T>C0.979
rpsL781649c.90T>C0.980
rpsL781655c.96T>C0.980
rpsL781658c.99A>C0.979
rpsL781670c.111G>C0.978
rpsL781706c.147T>C0.971
rpsL781715c.156T>G0.984
rpsL781766c.207C>T1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g0.983
rrs1471925r.80t>c0.981
rrs1471931r.86ga>g0.981
rrs1471934r.89a>g0.981
rrs1471985r.140t>c0.966
rrs1471986r.141c>t0.983
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.985
rrs1472286r.441c>g0.769
rrs1472287r.442c>t0.750
rrs1472289r.444t>g0.750
rrs1472290r.445c>g0.750
rrs1472313r.468g>a0.818
rrs1472315r.470t>g0.818
rrs1472324r.479g>c0.818
rrs1472325r.480g>c0.818
rrs1472327r.482g>a0.818
rrs1472328r.483g>c0.833
rrs1472337r.492c>g0.978
rrs1472380r.535g>c1.000
rrs1472446r.601t>a0.985
rrs1472452r.607g>a0.984
rrs1472464r.619a>g0.983
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t0.978
rrs1472847r.1002g>a0.978
rrs1472848r.1003t>c0.957
rrs1472860r.1015c>t0.982
rrs1472861r.1016g>a0.983
rrs1472956r.1111t>c0.981
rrs1472957r.1112c>t0.980
rrs1472969r.1124a>g0.977
rrs1472970r.1125c>g0.977
rrs1472977r.1132g>c0.977
rrs1472978r.1133t>c0.977
rrs1472989r.1144g>a0.980
rrs1472990r.1145a>g0.980
rrs1473082r.1237g>a0.981
rrs1473088r.1243a>g0.981
rrs1473099r.1254t>a0.949
rrs1473104r.1259c>t0.947
rrs1473105r.1260g>a0.946
rrs1473110r.1265t>g0.946
rrs1473111r.1266a>g0.949
rrs1473121r.1276t>c0.912
rrs1473123r.1278a>t0.963
rrs1473129r.1284c>t0.951
rrs1473145r.1300c>t0.967
rrs1473166r.1321g>a0.966
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac1.000
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a0.971
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t0.984
rrl1473812r.155g>a0.980
rrl1473814r.157a>t0.979
rrl1473815r.158t>g0.981
rrl1473829r.172g>c0.981
rrl1473831r.174g>t0.981
rrl1473832r.175c>t0.981
rrl1473839r.182g>a0.969
rrl1473876r.219g>a0.982
rrl1473887r.230t>c0.981
rrl1473888r.231t>c0.981
rrl1473898r.241c>t0.981
rrl1473899r.242a>g0.980
rrl1473916r.259c>a0.979
rrl1473923r.266c>g0.977
rrl1473937r.280c>t0.976
rrl1473943r.286g>t0.971
rrl1473945r.288t>a0.971
rrl1473946r.289a>t0.971
rrl1473950r.293g>t1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t0.944
rrl1474093r.436g>a0.944
rrl1474100r.443c>t0.944
rrl1474103r.446a>c0.944
rrl1474130r.473c>t0.976
rrl1474140r.483c>t0.977
rrl1474151r.494c>t0.979
rrl1474181r.524c>ct0.843
rrl1474184r.527c>a0.977
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a0.981
rrl1474291r.634tttcctctccggagga>t1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.986
rrl1474362r.705a>g0.985
rrl1474387r.730c>t0.951
rrl1474413r.756a>c0.905
rrl1474414r.757cccacacgcgcatacgcgcgtgtg>c0.927
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.925
rrl1474496r.839c>g0.941
rrl1474497r.840g>c0.941
rrl1474506r.849c>g0.960
rrl1474507r.850g>c0.960
rrl1474626r.969t>c0.982
rrl1474632r.975g>t0.977
rrl1474636r.979a>t0.977
rrl1474637r.980c>t0.977
rrl1474638r.981c>g0.976
rrl1474639r.982g>t0.977
rrl1474640r.983c>t0.977
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c0.960
rrl1475209r.1552g>a0.958
rrl1475213r.1556c>t0.957
rrl1475220r.1563g>t0.933
rrl1475429r.1772g>a0.974
rrl1475443r.1786g>a0.976
rrl1475452r.1795c>a0.976
rrl1475475r.1818c>t0.976
rrl1475479r.1822c>t0.974
rrl1475480r.1823a>t0.974
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.964
rrl1475977r.2320a>g0.964
rrl1475988r.2331a>g0.955
rrl1475989r.2332t>c0.955
rrl1475993r.2336c>t0.932
rrl1475997r.2340a>t0.955
rrl1476085r.2428g>a0.944
rrl1476086r.2429g>a0.944
rrl1476088r.2431a>c0.944
rrl1476099r.2442a>g0.944
rrl1476103r.2446c>g0.944
rrl1476105r.2448g>a0.944
rrl1476106r.2449a>t0.944
rrl1476110r.2453g>c0.944
rrl1476114r.2457t>c0.944
rrl1476115r.2458t>c0.944
rrl1476131r.2474c>t0.975
rrl1476160r.2503t>c0.981
rrl1476214r.2557g>t0.978
rrl1476215r.2558c>t0.978
rrl1476221r.2564t>c0.978
rrl1476224r.2567a>g0.979
rrl1476251r.2594t>c0.983
rrl1476281r.2624t>c0.982
rrl1476297r.2640c>t0.981
rrl1476299r.2642c>t0.982
rrl1476584r.2927c>t0.986
rrl1476594r.2937c>t0.986
rrl1476597r.2940g>a0.985
rrl1476603r.2946g>a0.984
rrl1476608r.2951c>g0.984
rrl1476619r.2962c>t0.984
rrl1476628r.2971t>a0.984
rrl1476665r.3008t>a0.956
rrl1476666r.3009c>t0.956
rrl1476674r.3017t>c0.953
rpsA1833536c.-6A>C0.963
rpsA1833538c.-4CA>C0.963
rpsA1833541c.-1T>C0.963
rpsA1833547c.6G>A0.974
rpsA1833589c.48A>C0.980
rpsA1833595c.54T>G0.980
rpsA1833596p.Ser19Ala0.980
rpsA1833604c.63C>T0.984
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T0.984
rpsA1833787c.246C>G0.968
rpsA1833790c.249T>C0.953
rpsA1833802c.261A>G0.969
rpsA1833811c.270G>T0.970
rpsA1833823c.282G>A0.938
rpsA1833832c.291G>A0.933
rpsA1833835c.294C>T0.911
rpsA1833838c.297G>C0.933
rpsA1833841c.300C>G0.933
rpsA1833844c.303C>T0.891
rpsA1833847c.306C>G0.920
rpsA1833862c.321G>T0.949
rpsA1833874c.333T>G0.933
rpsA1833877c.336C>G0.918
rpsA1833886c.345C>G0.931
rpsA1833894p.Ala118Glu0.953
rpsA1833928c.387G>C0.984
rpsA1833949c.408T>C0.984
rpsA1833961c.420C>G0.986
rpsA1833970c.429G>T0.985
rpsA1833979c.438T>C0.986
rpsA1833991c.450C>G0.986
rpsA1834000c.459G>C0.986
rpsA1834009c.468C>T0.986
rpsA1834012c.471G>C0.986
rpsA1834015c.474G>C0.985
rpsA1834021c.480C>T0.985
rpsA1834030c.489C>G0.970
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G0.986
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834348c.807T>C1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G0.977
rpsA1834557p.Ala339Gly0.977
rpsA1834606c.1065C>T0.980
rpsA1834609c.1068T>C0.980
rpsA1834619c.1078T>C0.972
rpsA1834622c.1081T>A0.971
rpsA1834633c.1092A>G0.980
rpsA1834639c.1098T>C0.981
rpsA1834645c.1104C>T0.981
rpsA1834666c.1125G>C0.982
rpsA1834667p.Ala376Ser0.982
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834747c.1206A>G0.986
rpsA1834759c.1218A>C0.986
rpsA1834765p.Glu408Asp0.985
rpsA1834774c.1233C>T0.962
rpsA1834776p.Ala412Glu0.962
rpsA1834780c.1239A>G0.962
rpsA1834789c.1248T>C0.962
rpsA1834813c.1272G>T0.977
rpsA1834830p.Ala430Val0.971
kasA2518738c.624G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
embC4240729c.867C>G0.968
embC4240735c.873C>G0.973
embC4240741c.879C>T0.973
embC4240756c.894G>C0.975
embC4240771c.909G>C0.966
embC4240772p.Ser304Ala0.965
embC4240778p.His306Gly0.963
embC4240781p.Ala307Ser0.963
embC4240789c.927T>C0.986
embC4240819c.957A>C0.985
embC4240826p.Ala322Ser0.970
embC4240831c.969T>G0.984
embC4240856p.Ala332Thr0.950
embC4240859p.Leu333Ile0.949
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;