TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d770ad02bab6
Sample: 5d770ad02bab6

Download results

Summary
ID: 5d770ad02bab6
Date: Tue Sep 10 03:32:10 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6754c.1515C>T0.818
gyrB6763c.1524G>C0.875
gyrB6772c.1533C>G0.882
gyrB6775c.1536G>C0.850
gyrB6793c.1554T>C0.909
gyrB6798p.Gly520Ala0.913
gyrB6808c.1569C>G0.913
gyrB6824c.1585C>T0.950
gyrB6841c.1602T>C0.950
gyrB6862c.1623C>G0.933
gyrB6865c.1626G>A0.923
gyrB6869c.1630T>C0.917
gyrB6872c.1633T>C0.917
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrA7499c.198G>C0.955
gyrA7511c.210C>T0.957
gyrA7523c.222C>G0.957
gyrA7526c.225G>C0.957
gyrA7547c.246C>T0.960
gyrA7553c.252C>T0.923
gyrA7559c.258G>C0.929
gyrA7565c.264C>T0.938
gyrA7574c.273G>C0.971
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.971
gyrA7595c.294C>T0.971
gyrA7607c.306C>T0.966
gyrA7637c.336C>A0.952
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu0.929
gyrA8288c.987T>C0.933
gyrA8294c.993T>C0.950
gyrA8327c.1026C>T0.962
gyrA8330c.1029C>G0.962
gyrA8339c.1038A>G0.960
gyrA8340p.Ala347Ser0.958
gyrA8354c.1053G>C0.955
gyrA8382c.1081C>T0.952
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C0.944
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
rpoB760079c.273G>A0.800
rpoB760091c.285G>C0.800
rpoB760101c.295T>C0.800
rpoB760110c.304T>A0.800
rpoB760118c.312T>G0.800
rpoB760121c.315T>C0.818
rpoB760130p.Asp108Glu0.875
rpoB760139c.333A>G0.882
rpoB760181c.375T>C0.958
rpoB760184c.378A>G0.958
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.944
rpoB760274p.Glu156Asp0.933
rpoB760276p.Lys157Met0.933
rpoB760283c.477G>C0.929
rpoB760298c.492G>C0.818
rpoB760376p.Asp190Glu0.818
rpoB760382c.576G>C0.833
rpoB760388c.582C>T0.857
rpoB760400c.594G>C0.923
rpoB760406c.600G>C0.929
rpoB760407p.Ser201Gly0.929
rpoB760415c.609C>T0.929
rpoB760418c.612G>C0.933
rpoB760430c.624T>C0.938
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561c.756 757del1.000
rpoC763450c.81G>A0.917
rpoC763456c.87A>G0.933
rpoC763468c.99G>C0.944
rpoC763486c.117T>C0.913
rpoC763492c.123G>C0.913
rpoC763528c.159G>A0.920
rpoC763531c.162G>T0.917
rpoC763546c.177A>G0.929
rpoC763570c.201G>C0.909
rpoC763594c.225C>T0.923
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.941
rpoC763660c.291T>G0.929
rpoC763666c.297G>C0.929
rpoC763669c.300C>G0.929
rpoC763675c.306C>G0.923
rpoC764054c.685C>T0.900
rpoC764059c.690G>T0.900
rpoC764083c.714A>G0.900
rpoC764084p.Asn239Val0.900
rpoC764095c.726C>T0.900
rpoC764098c.729A>G0.900
rpoC764110c.741C>T0.900
rpoC764311c.942C>G0.900
rpoC764317c.948C>G0.900
rpoC764320c.951C>G0.909
rpoC764338c.969G>A0.917
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764470c.1101C>T1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T1.000
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T0.923
rpoC764752c.1383G>C0.931
rpoC764758c.1389C>G0.943
rpoC764764c.1395T>C0.935
rpoC764791c.1422C>G0.935
rpoC764803c.1434C>T0.935
rpoC764809c.1440C>T0.929
rpoC764810p.Pro481Ala0.929
rpoC764815c.1446A>G0.931
rpoC764824c.1455T>C0.962
rpoC764827c.1458G>C0.967
rpoC764858c.1489T>C0.933
rpoC764869c.1500C>T0.931
rpoC764875c.1506C>A0.935
rpoC764887c.1518G>C0.931
rpoC764888c.1519T>C0.931
rpoC764896c.1527C>T0.914
rpoC764911c.1542A>G0.900
rpoC764912p.Met515Gln0.900
rpoC764932c.1563C>A0.906
rpoC764948c.1579T>C0.906
rpoC764968c.1599T>C0.933
rpoC765004c.1635G>C0.917
rpoC765007c.1638T>G0.909
rpoC765008c.1639T>C0.909
rpoC765011c.1642A>T0.909
rpoC765016c.1647C>G0.909
rpoC765019c.1650A>G0.909
rpoC765040c.1671T>C0.938
rpoC765041c.1672T>C0.938
rpoC765047c.1678T>C0.938
rpoC765055c.1686C>G0.938
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C0.955
rpoC765478c.2109T>G0.875
rpoC765480p.Tyr704Phe0.957
rpoC765499c.2130C>G0.957
rpoC765517c.2148C>G0.955
rpoC765533p.Tyr722His0.947
rpoC765544c.2175C>G0.917
rpoC765547c.2178C>T0.917
rpoC765548c.2179A>T0.917
rpoC765553c.2184C>T0.917
rpoC765556c.2187G>C0.917
rpoC765562c.2193G>T0.917
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T0.952
rpoC765861p.Phe831Tyr0.963
rpoC765875p.Val836Ile0.966
rpoC765886c.2517C>T0.967
rpoC765907c.2538G>T0.967
rpoC765910c.2541G>C0.966
rpoC765928c.2559C>G0.913
rpoC765940c.2571A>T0.909
rpoC765947c.2578T>C0.947
rpoC765962c.2593T>C0.900
rpoC766369c.3000C>G0.909
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C0.933
rpsL781715c.156T>G0.929
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C0.941
rpsL781916c.357T>C0.938
rpsL781929p.Gly124Ser0.933
rpsL781933374G>A0.929
rrs1471922r.77gt>g0.974
rrs1471925r.80t>c0.966
rrs1471931r.86ga>g0.966
rrs1471934r.89a>g0.968
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a0.933
rrs1472031r.186g>c0.933
rrs1472032r.187g>a0.933
rrs1472033r.188a>c0.933
rrs1472035r.190g>t0.933
rrs1472040r.195t>g0.933
rrs1472041r.196c>t0.933
rrs1472042r.197t>g0.933
rrs1472043r.198t>a0.933
rrs1472050r.205g>c0.944
rrs1472053r.208agc>a0.944
rrs1472061r.216a>t0.976
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.973
rrs1472337r.492c>g0.957
rrs1472380r.535g>c0.947
rrs1472446r.601t>a0.971
rrs1472452r.607g>a0.973
rrs1472464r.619a>g0.970
rrs1472612r.767g>t0.957
rrs1472734r.889c>t0.978
rrs1472741r.896g>a0.979
rrs1472846r.1001c>t0.935
rrs1472847r.1002g>a0.935
rrs1472848r.1003t>c0.935
rrs1472860r.1015c>t0.944
rrs1472861r.1016g>a0.944
rrs1472956r.1111t>c0.923
rrs1472957r.1112c>t0.918
rrs1472969r.1124a>g0.900
rrs1472970r.1125c>g0.900
rrs1472977r.1132g>c0.875
rrs1472978r.1133t>c0.875
rrs1472989r.1144g>a0.922
rrs1472990r.1145a>g0.922
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.871
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473697r.40c>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a0.970
rrl1473746r.89t>c0.972
rrl1473756r.99g>t0.974
rrl1473758r.101g>t0.974
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c0.974
rrl1473831r.174g>t0.973
rrl1473832r.175c>t0.974
rrl1473839r.182g>a0.976
rrl1473876r.219g>a0.973
rrl1473887r.230t>c0.972
rrl1473888r.231t>c0.972
rrl1473898r.241c>t0.967
rrl1473899r.242a>g0.967
rrl1473916r.259c>a0.967
rrl1473923r.266c>g0.964
rrl1473937r.280c>t0.958
rrl1473943r.286g>t0.944
rrl1473945r.288t>a0.944
rrl1473946r.289a>t0.944
rrl1473950r.293g>t1.000
rrl1474074r.417c>t0.812
rrl1474089r.432c>t0.812
rrl1474093r.436g>a0.812
rrl1474100r.443c>t0.867
rrl1474103r.446a>c0.867
rrl1474130r.473c>t0.969
rrl1474140r.483c>t0.969
rrl1474151r.494c>t0.974
rrl1474181r.524c>ct0.758
rrl1474184r.527c>a0.962
rrl1474185r.528ga>g0.962
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.943
rrl1474282r.625g>a0.964
rrl1474290r.633ttttcctctccggagg>t1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.949
rrl1474497r.840g>c0.949
rrl1474506r.849c>g0.947
rrl1474507r.850g>c0.947
rrl1474626r.969t>c0.944
rrl1474632r.975g>t0.933
rrl1474636r.979a>t0.933
rrl1474637r.980c>t0.933
rrl1474638r.981c>g0.933
rrl1474639r.982g>t0.933
rrl1474640r.983c>t0.933
rrl1474717r.1060a>g0.944
rrl1474722r.1065t>c0.947
rrl1474743r.1086t>g0.967
rrl1474760r.1103a>g0.970
rrl1474794r.1137c>t0.977
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c0.938
rrl1474932r.1275c>t0.935
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t0.974
rrl1475120r.1463g>t0.974
rrl1475129r.1472g>a0.971
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a0.971
rrl1475443r.1786g>a0.972
rrl1475452r.1795c>a0.973
rrl1475475r.1818c>t0.971
rrl1475479r.1822c>t0.969
rrl1475480r.1823a>t0.969
rrl1475505r.1848g>a0.946
rrl1475526r.1869c>a0.974
rrl1475531r.1874c>t0.951
rrl1475573r.1916g>a0.972
rrl1475649r.1992a>g0.968
rrl1475659r.2002g>a0.973
rrl1475760r.2103ccg>c0.964
rrl1475764r.2107a>t0.962
rrl1475765r.2108a>t0.893
rrl1475975r.2318c>t0.962
rrl1475977r.2320a>g0.958
rrl1475988r.2331a>g0.941
rrl1475989r.2332t>c0.941
rrl1475993r.2336c>t0.941
rrl1475997r.2340a>t0.941
rrl1476085r.2428g>a0.917
rrl1476086r.2429g>a0.917
rrl1476088r.2431a>c0.917
rrl1476099r.2442a>g0.917
rrl1476103r.2446c>g0.917
rrl1476105r.2448g>a0.917
rrl1476106r.2449a>t0.917
rrl1476110r.2453g>c0.917
rrl1476114r.2457t>c0.917
rrl1476115r.2458t>c0.917
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c0.966
rrl1476281r.2624t>c0.967
rrl1476297r.2640c>t0.966
rrl1476299r.2642c>t0.966
rrl1476584r.2927c>t0.958
rrl1476594r.2937c>t0.957
rrl1476597r.2940g>a0.958
rrl1476603r.2946g>a0.957
rrl1476608r.2951c>g0.978
rrl1476619r.2962c>t0.975
rrl1476628r.2971t>a0.972
rrl1476665r.3008t>a0.952
rrl1476666r.3009c>t0.952
rrl1476674r.3017t>c0.952
rpsA1833536c.-6A>C0.944
rpsA1833538c.-4CA>C0.944
rpsA1833541c.-1T>C0.944
rpsA1833547c.6G>A0.955
rpsA1833589c.48A>C0.963
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A0.947
rpsA1833832c.291G>A0.947
rpsA1833838c.297G>C0.947
rpsA1833841c.300C>G0.944
rpsA1833847c.306C>G0.950
rpsA1833856c.315A>G0.944
rpsA1833862c.321G>T0.944
rpsA1833874c.333T>G0.913
rpsA1833886c.345C>G0.920
rpsA1833894p.Ala118Glu0.926
rpsA1833928c.387G>C0.935
rpsA1833949c.408T>C0.964
rpsA1833961c.420C>G0.964
rpsA1833970c.429G>T0.960
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C0.952
rpsA1834366c.825A>G0.950
rpsA1834375c.834G>C0.950
rpsA1834396c.855G>C0.941
rpsA1834411c.870T>G0.917
rpsA1834414c.873C>T0.900
rpsA1834417c.876G>C0.900
rpsA1834420c.879C>T0.900
rpsA1834423c.882G>C0.900
rpsA1834429c.888C>T0.917
rpsA1834438c.897C>T0.938
rpsA1834451c.910T>C0.933
rpsA1834456c.915T>G0.933
rpsA1834468c.927A>G0.933
rpsA1834477c.936C>T0.933
rpsA1834489c.948T>C0.923
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C0.944
rpsA1834667p.Ala376Ser0.944
rpsA1834690c.1149T>C0.947
rpsA1834700p.Gln387Ala0.900
rpsA1834705c.1164C>G0.895
rpsA1834720c.1179C>G0.957
rpsA1834732c.1191T>C0.955
rpsA1834738c.1197A>G0.955
rpsA1834753c.1212T>C0.950
rpsA1834759c.1218A>C0.950
rpsA1834765p.Glu408Asp0.947
rpsA1834774c.1233C>T0.909
rpsA1834776p.Ala412Glu0.909
rpsA1834780c.1239A>G0.909
rpsA1834789c.1248T>C0.909
rpsA1834813c.1272G>T0.909
kasA2518756c.642G>C0.917
kasA2518768c.654C>G0.917
kasA2518771c.657C>G0.917
kasA2518774c.660C>T0.917
kasA2518783c.669T>G0.917
kasA2518787p.Arg225Lys0.917
kasA2518792c.678C>T0.917
kasA2518795c.681C>T0.917
kasA2518798c.684G>C0.917
kasA2518822c.708C>A0.938
kasA2518825c.711T>C0.938
kasA2518846c.732G>T0.929
kasA2518849c.735G>C0.929
kasA2518853p.Leu247Val0.923
kasA2518864c.750G>C1.000
embC4240729c.867C>G0.917
embC4240735c.873C>G0.917
embC4240741c.879C>T0.917
embC4240756c.894G>C0.938
embC4240771c.909G>C0.938
embC4240772p.Ser304Ala0.938
embC4240778p.His306Gly0.933
embC4240781p.Ala307Ser0.933
embC4240789c.927T>C0.941
embC4240819c.957A>C0.889
embC4240826p.Ala322Ser0.882
embC4240831c.969T>G0.875
embB4248245p.Ile578Val0.909
embB4248250c.1737C>T0.923
embB4248259p.Met582Ile0.929
embB4248275p.Thr588Ala0.929
embB4248292c.1779G>A0.929

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;