TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d8078f0c61db
Sample: 5d8078f0c61db

Download results

Summary
ID: 5d8078f0c61db
Date: Tue Sep 17 07:16:46 2019
Strain: lineage2.2.1;lineage3.1.2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage3.1.2.2East-African-IndianCASRD750

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6091c.852G>C1.000
gyrB6098p.Val287Leu1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T0.250
gyrB6122p.Ala295Ser0.750
gyrB6127c.888G>C1.000
gyrB6130c.891T>C0.750
gyrB6133c.894G>C0.250
gyrB6136c.897G>A0.250
gyrB6139c.900G>T0.750
gyrB6151c.912C>T0.235
gyrB6172c.933C>T0.235
gyrB6184c.945C>T0.250
gyrB6190c.951A>G0.750
gyrB6193c.954G>A0.250
gyrB6196c.957C>T0.250
gyrB6202c.963C>T0.286
gyrB6202r.963ca>c1.000
gyrB6204p.Ser322Thr0.900
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A0.935
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T0.917
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T0.878
gyrB6760c.1521G>C0.125
gyrB6763c.1524G>C0.867
gyrB6764p.Leu509Phe0.125
gyrB6772c.1533C>G0.816
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C0.980
gyrB6797p.Gly520Thr0.200
gyrB6808c.1569C>G0.784
gyrB6824c.1585C>T0.761
gyrB6841c.1602T>C0.977
gyrB6844c.1605T>C0.167
gyrB6862c.1623C>G0.971
gyrB6869c.1630T>C0.964
gyrB6872c.1633T>C0.964
gyrB6878c.1639T>C0.964
gyrB6889c.1650G>A0.963
gyrB6898c.1659G>T0.957
gyrB7006c.1767T>G0.909
gyrB7010p.Leu591Met0.909
gyrB7015c.1776G>A0.909
gyrB7018c.1779G>C0.909
gyrB7024c.1785G>C0.909
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T0.909
gyrB7078c.1839A>G0.909
gyrB7081c.1842T>C0.909
gyrB7084c.1845A>G0.909
gyrB7090c.1851C>T0.909
gyrB7093c.1854T>C0.909
gyrB7100c.1861T>C0.909
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T0.933
gyrA7559c.258G>C0.937
gyrA7565c.264C>T0.939
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T0.942
gyrA7607c.306C>T1.000
gyrA7637c.336C>A0.920
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G0.909
gyrA8174c.873C>G0.909
gyrA8177c.876A>C0.909
gyrA8187p.Leu296Ile0.909
gyrA8192c.891C>G0.909
gyrA8198c.897T>C0.909
gyrA8207c.906T>C0.909
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C0.974
gyrA8903c.1602T>C0.974
gyrA8915c.1614A>G0.950
gyrA8921c.1620C>T0.947
gyrA8942c.1641G>C0.923
gyrA8945c.1644G>C0.917
gyrA8946c.1645T>C0.917
gyrA8957c.1656C>T0.917
gyrA8967p.Ala556Lys0.900
gyrA8978c.1677C>T0.824
gyrA8987c.1686C>G0.769
gyrA8990c.1689C>G0.769
gyrA8993c.1692C>T0.818
gyrA8996c.1695T>C0.818
gyrA8998p.Leu566Trp0.818
rpoB760079c.273G>A0.882
rpoB760091c.285G>C0.895
rpoB760101c.295T>C1.000
rpoB760110c.304T>A0.900
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G0.128
rpoB760140p.Pro112Ser0.128
rpoB760172c.366G>C0.159
rpoB760181c.375T>C0.136
rpoB760184c.378A>G1.000
rpoB760193c.387C>G0.886
rpoB760196c.390C>G0.878
rpoB760199c.393C>T0.122
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.816
rpoB760274p.Glu156Asp0.207
rpoB760276p.Lys157Met0.778
rpoB760283c.477G>C0.783
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760356p.Thr184Cys0.125
rpoB760361c.555T>C0.971
rpoB760368p.Ser188Arg0.143
rpoB760376p.Asp190Glu0.978
rpoB760382c.576G>C0.978
rpoB760388c.582C>T0.833
rpoB760400c.594G>C0.981
rpoB760406c.600G>C0.833
rpoB760407p.Ser201Gly0.981
rpoB760412c.606C>T0.145
rpoB760415c.609C>T0.821
rpoB760418c.612G>C0.810
rpoB760430c.624T>C0.970
rpoB760457c.651C>T0.108
rpoB760460c.654G>C0.973
rpoB760475c.669A>G0.970
rpoB760481c.675G>C0.953
rpoB760484c.678A>G0.951
rpoB760502c.696C>G0.871
rpoB760522p.Ser239Asn0.962
rpoB760532c.726T>C0.964
rpoB760541c.735G>C0.963
rpoB760567p.Ser254Trp0.923
rpoB760571c.765G>C0.926
rpoB760588p.Thr261Ile0.933
rpoB760591p.Val262Ala0.933
rpoB760595c.789C>T0.933
rpoB760596p.Thr264Pro0.933
rpoB760608c.802C>T0.950
rpoB760611c.805T>C0.951
rpoB760634c.828T>C0.980
rpoB760646c.840C>G0.978
rpoB760655c.849A>G0.976
rpoB760661c.855A>G0.976
rpoB760668p.Thr288Ala0.963
rpoB760674c.868T>C0.963
rpoB760679c.873A>G0.963
rpoB760683c.877T>C0.963
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C0.958
rpoB760865c.1059C>T0.958
rpoB760886p.Glu360Asp0.967
rpoB760887p.Thr361Val0.967
rpoB760910c.1104C>T0.925
rpoB760916c.1110C>T0.975
rpoB760928c.1122G>C0.923
rpoB760943c.1137C>T0.842
rpoB760946c.1140A>G0.976
rpoB760958c.1152G>C0.186
rpoB760961c.1155C>G0.205
rpoB760965p.Met387Leu0.974
rpoB760970c.1164G>C0.974
rpoB760973c.1167G>T0.237
rpoB760982c.1176G>C0.968
rpoB760985c.1179G>C0.970
rpoB760988c.1182C>G0.576
rpoB760991c.1185G>T0.382
rpoB760997c.1191G>C0.976
rpoB761003c.1197C>G0.364
rpoB761006c.1200C>G0.391
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C0.420
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T0.392
rpoB761054c.1248G>C0.600
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G0.582
rpoB761063c.1257C>G0.596
rpoB761084c.1278C>A1.000
rpoB761088c.1282A>T0.317
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T0.965
rpoB761150c.1344A>T0.964
rpoB761165c.1359G>C0.968
rpoB761171c.1365C>T0.678
rpoB761178p.Ser458Thr0.630
rpoB761186p.Glu460Asp0.608
rpoB761189c.1383T>C0.962
rpoB761195c.1389G>C0.962
rpoB761198c.1392G>C0.962
rpoB761204c.1398C>G0.270
rpoB761207c.1401C>A0.259
rpoB761213c.1407G>C0.290
rpoB761219c.1413G>C0.708
rpoB761234c.1428G>C0.282
rpoB761249c.1443A>G0.986
rpoB761255c.1449T>G0.313
rpoB761258c.1452G>A0.672
rpoB761261c.1455G>C0.309
rpoB761264c.1458C>G0.945
rpoB761273c.1467T>C0.741
rpoB761282c.1476C>T0.222
rpoB761303c.1497G>C0.767
rpoB761318c.1512G>T0.183
rpoB761327c.1521A>G1.000
rpoB761330c.1524G>C0.176
rpoB761333c.1527G>T0.820
rpoB761339c.1533C>G0.816
rpoB761516c.1710G>C0.900
rpoB761528c.1722C>T0.633
rpoB761531c.1725C>T0.613
rpoB761537c.1731C>G0.943
rpoB761549c.1743G>C0.341
rpoB761552c.1746G>C0.333
rpoB761555c.1749G>C0.953
rpoB761558c.1752C>G0.957
rpoB761564c.1758G>C0.667
rpoB761570c.1764T>C0.667
rpoB761573c.1767C>G0.889
rpoB761579c.1773G>C0.965
rpoB761606c.1800C>G0.215
rpoB761612c.1806G>T0.219
rpoB761615c.1809A>C0.219
rpoB761627c.1821C>T0.217
rpoB761636c.1830G>T0.964
rpoB761645c.1839C>G0.760
rpoB761648c.1842T>C0.188
rpoB761657c.1851C>T0.178
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T0.222
rpoB761681c.1875G>A0.808
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C0.955
rpoB761705c.1899C>A0.950
rpoB761885c.2079T>C0.280
rpoB761891c.2085G>C0.692
rpoB761892p.Ile696Leu0.259
rpoB761903c.2097T>C0.233
rpoB761909c.2103T>C0.967
rpoB761912c.2106T>C0.967
rpoB761915p.Asp703Glu0.967
rpoB761916p.Asp704Asn0.967
rpoB761921c.2115C>T0.222
rpoB761924c.2118G>A0.692
rpoB761930c.2124G>C0.692
rpoB761933c.2127G>C0.975
rpoB761936c.2130C>T0.675
rpoB761948c.2142G>C0.979
rpoB761954c.2148C>A0.264
rpoB761955p.Ile717Val0.698
rpoB761969c.2163G>A0.738
rpoB761990c.2184G>C0.684
rpoB762002c.2196C>G0.230
rpoB762003p.Asn733Gln0.230
rpoB762008c.2202C>T0.740
rpoB762011c.2205G>C0.247
rpoB762014c.2208C>G0.987
rpoB762026c.2220G>C0.250
rpoB762038c.2232C>T0.714
rpoB762047c.2241G>A0.701
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A0.703
rpoB762065c.2259T>G0.317
rpoB762080c.2274G>C0.311
rpoB762083c.2277T>C0.707
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G0.985
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T0.696
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A0.636
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T0.271
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C0.746
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C0.761
rpoB762218c.2412T>C0.206
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762251c.2445G>C0.170
rpoB762254c.2448T>C0.173
rpoB762257c.2451C>G0.180
rpoB762275c.2469C>T0.750
rpoB762284c.2478G>C0.167
rpoB762293c.2487T>C0.172
rpoB762296c.2490G>C0.793
rpoB762305c.2499G>T0.185
rpoB762314c.2508C>T0.167
rpoB762317c.2511A>G0.958
rpoB762323c.2517C>A0.800
rpoB762329c.2523G>C0.938
rpoB762335c.2529C>T0.214
rpoB762395c.2589G>T0.909
rpoB762398c.2592T>C0.909
rpoB762404c.2598T>C0.958
rpoB762410c.2604T>G0.929
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C0.966
rpoB762491c.2685T>C0.964
rpoB762509c.2703T>G0.870
rpoB762510p.Ala902Pro0.870
rpoB762515c.2709C>T0.950
rpoB762533c.2727T>C0.917
rpoB762536c.2730T>C0.917
rpoB762537c.2731T>C0.917
rpoB762551c.2745C>T0.917
rpoB762557c.2751G>A0.900
rpoB762827c.3021G>C0.125
rpoB762830c.3024C>G0.880
rpoB762857c.3051C>G0.971
rpoB762858p.Thr1018Ser0.171
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T0.842
rpoB762879p.Met1025Leu0.792
rpoB762894c.3088C>T0.784
rpoB762899c.3093G>C0.981
rpoB762917c.3111C>G0.951
rpoB762920c.3114C>T0.949
rpoB762923c.3117C>G0.937
rpoB762929c.3123G>C0.959
rpoB762959c.3153G>C0.961
rpoB762962c.3156C>T0.747
rpoB762971c.3165G>C0.224
rpoB762989c.3183G>C0.270
rpoB762995c.3189G>T0.973
rpoB763013c.3207C>G0.303
rpoB763022c.3216C>G0.315
rpoB763028c.3222T>C0.329
rpoB763031c.3225T>G0.333
rpoB763034c.3228C>G0.667
rpoB763040c.3234C>G0.662
rpoB763053c.3247T>C0.292
rpoB763067c.3261C>G0.259
rpoB763070c.3264T>C1.000
rpoB763074p.Thr1090Val0.263
rpoB763082c.3276C>T0.655
rpoB763088c.3282C>G0.982
rpoB763094c.3288G>C0.644
rpoB763103c.3297G>C0.346
rpoB763115c.3309T>C0.964
rpoB763127c.3321G>C0.964
rpoB763136c.3330C>T0.673
rpoB763145c.3339G>A0.660
rpoB763148c.3342G>C0.255
rpoB763157c.3351G>T0.721
rpoB763160c.3354G>C0.238
rpoB763166c.3360A>G0.950
rpoB763169c.3363A>G0.231
rpoB763172c.3366G>C0.949
rpoB763193c.3387C>G0.938
rpoC763363c.-7G>A0.727
rpoC763402c.33C>T0.368
rpoC763408c.39T>C0.350
rpoC763411c.42T>C0.952
rpoC763414c.45T>G0.952
rpoC763415p.Thr16Ser0.333
rpoC763423p.Glu18Asp0.333
rpoC763430c.61A>C0.947
rpoC763433p.Gln22Asn0.900
rpoC763443p.Tyr25Phe0.333
rpoC763450c.81G>A0.610
rpoC763456c.87A>G0.956
rpoC763468c.99G>C0.958
rpoC763486c.117T>C0.946
rpoC763492c.123G>C0.946
rpoC763507c.138G>C0.203
rpoC763528c.159G>A0.190
rpoC763531c.162G>T0.161
rpoC763534c.165T>C0.158
rpoC763537c.168C>G0.153
rpoC763546c.177A>G0.937
rpoC763570c.201G>C0.127
rpoC763573c.204G>C0.123
rpoC763576c.207C>G0.149
rpoC763594c.225C>T0.970
rpoC763609c.240C>T0.800
rpoC763618c.249C>T0.191
rpoC763633c.264T>C0.766
rpoC763642c.273G>C0.237
rpoC763657c.288G>A0.731
rpoC763660c.291T>G0.260
rpoC763663c.294C>T0.265
rpoC763666c.297G>C0.283
rpoC763669c.300C>G0.958
rpoC763675c.306C>G0.711
rpoC763696c.327T>C0.647
rpoC763699c.330G>T0.636
rpoC763702c.333C>G0.962
rpoC763703c.334T>A0.154
rpoC763708c.339G>C0.182
rpoC763711c.342G>T0.182
rpoC763714c.345G>C0.955
rpoC763717c.348T>C0.955
rpoC763723c.354G>C0.773
rpoC763726c.357C>T0.182
rpoC763732c.363C>A0.200
rpoC763741c.372C>T0.947
rpoC763744c.375G>C0.900
rpoC763747c.378G>A0.571
rpoC763765c.396T>C0.818
rpoC763900c.531G>C0.971
rpoC763933c.564C>T0.974
rpoC763940p.Ala191Ser0.974
rpoC763947p.Ala193Val0.974
rpoC763951c.582G>C0.974
rpoC763960c.591T>G0.974
rpoC763969c.600C>T0.974
rpoC763987c.618C>T0.913
rpoC763991p.Ile208Leu0.905
rpoC763996c.627T>C0.900
rpoC763999c.630C>T0.900
rpoC764002c.633C>G0.900
rpoC764003p.Ala212Ser0.900
rpoC764024c.655T>C0.895
rpoC764029p.Glu220Asp0.895
rpoC764032p.Asp221Glu0.900
rpoC764040p.Ser224Thr0.920
rpoC764044c.675T>C0.920
rpoC764054c.685C>T0.958
rpoC764059c.690G>T0.958
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T0.767
rpoC764098c.729A>G1.000
rpoC764101c.732C>G0.233
rpoC764110c.741C>T0.719
rpoC764131c.762T>C0.290
rpoC764134c.765C>G0.290
rpoC764143c.774G>C0.615
rpoC764147p.Ser260Ala0.600
rpoC764150p.Ile261Val0.600
rpoC764164p.Ile265Met0.423
rpoC764165p.Glu266Gln0.478
rpoC764176c.807C>T0.188
rpoC764177p.Ile270Leu0.188
rpoC764182p.Asp271Glu0.923
rpoC764188c.819A>G0.933
rpoC764197c.828G>C0.917
rpoC764227c.858G>C0.923
rpoC764239c.870T>G0.909
rpoC764242c.873C>T0.909
rpoC764245c.876C>T0.909
rpoC764254c.885G>C0.917
rpoC764257c.888G>C0.923
rpoC764263c.894G>C1.000
rpoC764266c.897T>C1.000
rpoC764278c.909A>G1.000
rpoC764308c.939G>C0.588
rpoC764311c.942C>A0.405
rpoC764317c.948C>G0.429
rpoC764320c.951C>T0.459
rpoC764332c.963G>A0.523
rpoC764338c.969G>A0.523
rpoC764353c.984G>T0.408
rpoC764365c.996C>T1.000
rpoC764368c.999C>T0.367
rpoC764371c.1002G>C0.353
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C0.684
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764410c.1041G>C0.274
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764446c.1077T>C0.194
rpoC764449c.1080G>C0.190
rpoC764455c.1086G>T0.200
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764503c.1134G>C0.258
rpoC764510c.1141C>T0.742
rpoC764521c.1152T>C0.246
rpoC764524c.1155C>G0.242
rpoC764527c.1158C>T0.258
rpoC764530c.1161C>G0.276
rpoC764534c.1165C>A0.712
rpoC764539c.1170C>T0.724
rpoC764542c.1173C>T0.754
rpoC764545c.1176C>A0.241
rpoC764548c.1179G>C0.197
rpoC764560c.1191T>C0.773
rpoC764566c.1197C>G0.215
rpoC764575c.1206T>G1.000
rpoC764605c.1236G>C0.235
rpoC764611c.1242G>C0.257
rpoC764626c.1257C>T0.985
rpoC764632c.1263T>C0.746
rpoC764650c.1281G>T0.984
rpoC764653c.1284G>C0.277
rpoC764662c.1293G>C0.290
rpoC764668c.1299C>T0.687
rpoC764692c.1323C>T0.607
rpoC764701c.1332C>T0.357
rpoC764713c.1344G>T0.647
rpoC764716c.1347G>C0.944
rpoC764737c.1368G>C0.302
rpoC764746c.1377G>T0.980
rpoC764752c.1383G>C0.980
rpoC764758c.1389C>G0.765
rpoC764764c.1395T>C1.000
rpoC764780c.1411A>T0.193
rpoC764785c.1416C>G0.193
rpoC764791c.1422C>G0.839
rpoC764797c.1428G>C0.164
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T0.840
rpoC764810p.Pro481Ala0.843
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C0.885
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A0.945
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A0.896
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C0.692
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G0.273
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765052c.1683C>G0.205
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C0.640
rpoC765076c.1707A>G0.667
rpoC765078c.1710 1710del1.000
rpoC765079r.1710t>g1.000
rpsL781559c.-1G>C0.882
rpsL781572p.Gln5Asn0.913
rpsL781586c.27C>T0.909
rpsL781595c.36T>C0.921
rpsL781608p.Ser17Ala0.925
rpsL781616c.57C>G0.868
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C0.111
rpsL781664c.105C>T0.107
rpsL781670c.111G>C0.870
rpsL781682c.123T>C0.113
rpsL781700c.141G>C0.102
rpsL781706c.147T>C0.976
rpsL781715c.156T>G0.972
rpsL781751c.192G>C0.900
rpsL781754c.195G>T0.900
rpsL781760c.201T>C0.900
rpsL781763c.204C>G0.900
rpsL781766c.207C>T0.909
rpsL781772c.213C>T0.735
rpsL781802c.243G>C1.000
rpsL781805c.246G>C0.239
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C0.269
rpsL781859c.300T>C0.980
rpsL781865c.306G>C0.300
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A0.667
rpsL781892c.333A>G1.000
rpsL781898c.339A>T0.353
rpsL781901c.342C>T0.344
rpsL781907c.348T>C1.000
rpsL781916c.357T>C0.385
rpsL781929p.Gly124Ser0.650
rpsL781933c.374G>A0.632
rrs1471853r.8t>c0.200
rrs1471918r.73a>t0.584
rrs1471922r.77gt>g0.413
rrs1471923r.78t>c0.977
rrs1471925r.80t>c0.986
rrs1471931r.86ga>g0.419
rrs1471932r.87a>g0.977
rrs1471934r.89a>g0.987
rrs1471938r.93t>a0.531
rrs1471985r.140t>c0.988
rrs1471986r.141c>t0.988
rrs1472030r.185g>a0.900
rrs1472031r.186g>c0.900
rrs1472032r.187g>a0.900
rrs1472033r.188a>c0.900
rrs1472035r.190g>t0.900
rrs1472040r.195t>g0.947
rrs1472041r.196c>t0.947
rrs1472042r.197t>g0.947
rrs1472043r.198t>a0.947
rrs1472050r.205g>c0.909
rrs1472053r.208agc>a0.909
rrs1472061r.216a>t0.941
rrs1472075r.230a>g0.429
rrs1472106r.261g>a0.940
rrs1472108r.263c>t0.975
rrs1472113r.268t>c0.330
rrs1472148r.303t>c0.619
rrs1472150r.305t>a0.978
rrs1472172r.327t>c0.602
rrs1472225r.380c>a0.667
rrs1472251r.406g>a1.000
rrs1472286r.441c>g1.000
rrs1472289r.444t>g1.000
rrs1472290r.445c>g1.000
rrs1472315r.470t>g1.000
rrs1472324r.479g>c1.000
rrs1472325r.480g>c1.000
rrs1472328r.483g>c1.000
rrs1472337r.492c>g0.287
rrs1472380r.535g>c0.330
rrs1472422r.577t>c0.677
rrs1472435r.590t>c0.633
rrs1472438r.593t>c0.640
rrs1472446r.601t>a0.984
rrs1472449r.604c>t0.421
rrs1472450r.605a>g0.421
rrs1472451r.606c>g0.421
rrs1472452r.607g>a0.561
rrs1472456r.611t>c0.429
rrs1472460r.615t>c0.421
rrs1472461r.616g>c0.429
rrs1472462r.617t>c0.421
rrs1472463r.618g>a0.421
rrs1472464r.619a>g0.561
rrs1472467r.622g>t0.414
rrs1472489r.644a>t0.670
rrs1472530r.685g>a0.664
rrs1472612r.767g>t0.880
rrs1472655r.810g>t0.118
rrs1472660r.815t>c0.642
rrs1472661r.816a>g0.517
rrs1472682r.837t>a0.598
rrs1472683r.838t>c0.582
rrs1472713r.868t>c0.546
rrs1472714r.869a>g0.664
rrs1472734r.889c>t0.298
rrs1472741r.896g>a0.330
rrs1472836r.991g>a0.312
rrs1472837r.992c>t0.317
rrs1472840r.995a>c0.333
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472858r.1013g>c0.333
rrs1472860r.1015c>g0.339
rrs1472861r.1016g>c0.339
rrs1472862r.1017t>c0.339
rrs1472863r.1018t>c0.339
rrs1472873r.1028c>t0.350
rrs1472875r.1030t>g0.344
rrs1472878r.1033g>a0.333
rrs1472880r.1035g>a0.333
rrs1472956r.1111t>c0.987
rrs1472957r.1112c>t0.949
rrs1472958r.1113a>g0.595
rrs1472969r.1124a>g0.926
rrs1472970r.1125c>g0.259
rrs1472977r.1132g>c0.259
rrs1472978r.1133t>c0.926
rrs1472988r.1143t>c0.607
rrs1472989r.1144g>a0.933
rrs1472990r.1145a>g0.989
rrs1473026r.1181t>c0.620
rrs1473082r.1237g>a0.410
rrs1473088r.1243a>g0.990
rrs1473099r.1254t>a0.284
rrs1473100r.1255g>a0.685
rrs1473104r.1259c>t0.985
rrs1473105r.1260g>a0.299
rrs1473110r.1265t>g0.985
rrs1473111r.1266a>g0.985
rrs1473121r.1276t>c0.944
rrs1473123r.1278a>t0.977
rrs1473129r.1284c>t0.363
rrs1473145r.1300c>t0.418
rrs1473166r.1321g>a0.433
rrs1473276r.1431a>g0.592
rrs1473288r.1443c>t0.365
rrs1473290r.1445c>t0.957
rrs1473291r.1446g>t0.394
rrs1473291r.1446g>gt0.604
rrs1473301r.1456t>c0.612
rrl1473668r.11c>t0.952
rrl1473673r.16g>a0.800
rrl1473677r.20c>t0.769
rrl1473679r.22t>c0.769
rrl1473684r.27g>a0.171
rrl1473696r.39t>c0.816
rrl1473697r.40c>a0.158
rrl1473698r.41g>a0.816
rrl1473699r.42a>g0.821
rrl1473707r.50t>a0.250
rrl1473717r.60g>a0.984
rrl1473731r.74t>a0.986
rrl1473746r.89t>c0.338
rrl1473756r.99g>t0.986
rrl1473757r.100t>g0.625
rrl1473758r.101g>t0.361
rrl1473770r.113t>c0.403
rrl1473791r.134a>c0.244
rrl1473792r.135c>a0.244
rrl1473793r.136g>c0.244
rrl1473802r.145c>g0.244
rrl1473803r.146g>t0.244
rrl1473804r.147t>g0.244
rrl1473806r.149c>t0.976
rrl1473812r.155g>a0.718
rrl1473814r.157a>g0.256
rrl1473815r.158t>c0.250
rrl1473829r.172g>c0.762
rrl1473830r.173t>c0.244
rrl1473831r.174g>t0.756
rrl1473832r.175c>t1.000
rrl1473839r.182g>a0.796
rrl1473844r.187c>t0.192
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t0.600
rrl1474135r.478g>a0.421
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474153r.496c>t0.444
rrl1474166r.509g>a0.459
rrl1474174r.517a>g0.453
rrl1474183r.526t>c0.507
rrl1474184r.527c>a0.478
rrl1474186r.529a>g0.947
rrl1474201r.544t>c0.552
rrl1474218r.561t>a0.584
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.373
rrl1474266r.609t>c0.598
rrl1474269r.612c>t0.593
rrl1474282r.625g>a0.373
rrl1474288r.631c>a0.130
rrl1474290r.633t>a0.340
rrl1474291r.634t>c0.692
rrl1474306r.649a>c0.438
rrl1474308r.651g>t0.449
rrl1474310r.653t>g0.449
rrl1474348r.691c>t0.630
rrl1474351r.694g>c0.622
rrl1474353r.696a>g0.633
rrl1474356r.699t>c0.320
rrl1474362r.705a>g0.990
rrl1474387r.730c>t0.990
rrl1474402r.745t>c0.671
rrl1474413r.756a>c0.944
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.979
rrl1474435r.778g>t0.969
rrl1474447r.790g>a0.699
rrl1474454r.797g>a0.704
rrl1474496r.839c>g0.330
rrl1474497r.840g>c0.989
rrl1474506r.849c>g0.990
rrl1474507r.850g>c0.365
rrl1474537r.880g>a0.610
rrl1474626r.969t>c0.974
rrl1474632r.975g>t0.970
rrl1474636r.979a>t0.347
rrl1474637r.980c>t0.361
rrl1474638r.981c>g0.380
rrl1474639r.982g>t0.359
rrl1474640r.983c>t1.000
rrl1474673r.1016t>c0.594
rrl1474676r.1019t>a0.604
rrl1474709r.1052g>a0.716
rrl1474710r.1053t>g0.672
rrl1474711r.1054g>a0.957
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c0.972
rrl1474734r.1077g>t0.629
rrl1474743r.1086t>g0.358
rrl1474749r.1092c>t0.637
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474823r.1166c>g0.663
rrl1474824r.1167a>g0.659
rrl1474830r.1173a>g1.000
rrl1474903r.1246t>c0.626
rrl1474904r.1247g>c0.653
rrl1474913r.1256t>c0.989
rrl1474932r.1275c>t0.958
rrl1475031r.1374g>c0.960
rrl1475060r.1403ac>a1.000
rrl1475061r.1404ca>c1.000
rrl1475065r.1408g>a0.409
rrl1475067r.1410a>g0.409
rrl1475076r.1419c>a1.000
rrl1475079r.1422t>c0.400
rrl1475081r.1424c>t0.387
rrl1475090r.1433a>t1.000
rrl1475113r.1456c>t0.510
rrl1475114r.1457c>t1.000
rrl1475116r.1459g>a0.510
rrl1475120r.1463g>t0.455
rrl1475129r.1472g>a0.406
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475414r.1757g>c0.581
rrl1475419r.1762c>t0.606
rrl1475422r.1765a>g0.606
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475460r.1803a>g0.725
rrl1475475r.1818c>t0.226
rrl1475479r.1822c>t0.226
rrl1475480r.1823a>t1.000
rrl1475481r.1824c>t0.732
rrl1475482r.1825a>t0.732
rrl1475505r.1848g>a0.197
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t0.985
rrl1475538r.1881t>a0.828
rrl1475539r.1882a>t0.815
rrl1475550r.1893a>g0.847
rrl1475573r.1916g>a0.129
rrl1475649r.1992a>g1.000
rrl1475655r.1998t>a0.652
rrl1475659r.2002g>a1.000
rrl1475699r.2042c>t0.658
rrl1475753r.2096c>g0.648
rrl1475758r.2101a>g0.648
rrl1475760r.2103ccg>c0.377
rrl1475761r.2104c>a0.977
rrl1475763r.2106c>t0.642
rrl1475764r.2107a>t0.358
rrl1475765r.2108a>t0.358
rrl1475766r.2109g>t0.632
rrl1475769r.2112t>c0.634
rrl1475775r.2118g>t0.696
rrl1475883r.2226a>t0.636
rrl1475884r.2227a>g0.627
rrl1475897r.2240t>c0.700
rrl1475916r.2259c>t0.679
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c0.271
rrl1475993r.2336c>t0.271
rrl1475997r.2340a>t1.000
rrl1476030r.2373a>g1.000
rrl1476032r.2375c>g1.000
rrl1476033r.2376t>g1.000
rrl1476034r.2377c>g1.000
rrl1476035r.2378g>c1.000
rrl1476044r.2387t>g1.000
rrl1476045r.2388g>t1.000
rrl1476046r.2389g>t1.000
rrl1476047r.2390g>c1.000
rrl1476049r.2392c>t1.000
rrl1476086r.2429g>a1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>a1.000
rrl1476110r.2453g>t1.000
rrl1476115r.2458t>c0.982
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c0.966
rrl1476194r.2537a>g0.793
rrl1476200r.2543a>t0.778
rrl1476201r.2544c>t0.767
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t0.207
rrl1476221r.2564t>c0.989
rrl1476224r.2567a>g1.000
rrl1476245r.2588c>t0.733
rrl1476251r.2594t>c0.260
rrl1476252r.2595t>g0.735
rrl1476256r.2599a>g0.730
rrl1476260r.2603a>g0.724
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t0.280
rrl1476298r.2641c>g0.713
rrl1476299r.2642c>t0.287
rrl1476300r.2643g>a0.698
rrl1476309r.2652g>c0.701
rrl1476428r.2771c>t0.565
rrl1476524r.2867c>t0.528
rrl1476539r.2882a>g0.510
rrl1476540r.2883c>g0.510
rrl1476584r.2927c>t0.971
rrl1476585r.2928a>g0.583
rrl1476594r.2937c>t0.976
rrl1476597r.2940g>a0.337
rrl1476603r.2946g>a0.975
rrl1476608r.2951c>g0.422
rrl1476614r.2957a>t0.620
rrl1476619r.2962c>t0.974
rrl1476628r.2971t>a0.969
rrl1476629r.2972c>a0.554
rrl1476630r.2973a>g0.562
rrl1476661r.3004a>g0.580
rrl1476665r.3008t>a0.391
rrl1476666r.3009c>t0.891
rrl1476674r.3017t>c0.432
rrl1476675r.3018c>g0.568
inhA1674858c.657G>A0.900
inhA1674876c.675C>T0.909
inhA1674879c.678T>C0.909
inhA1674892p.Asn231Asp0.909
inhA1674903c.702T>C0.909
inhA1674904p.Ala235Pro0.909
inhA1674909c.708G>A0.909
inhA1674912c.711G>C0.909
inhA1674915c.714C>G0.909
inhA1674942c.741T>C0.909
inhA1674949c.748C>T0.909
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C0.812
rpsA1833538c.-4CA>C0.812
rpsA1833541c.-1T>C0.812
rpsA1833547c.6G>A0.870
rpsA1833559c.18C>G0.206
rpsA1833571c.30A>G0.282
rpsA1833589c.48A>C0.939
rpsA1833595c.54T>G0.245
rpsA1833596p.Ser19Ala0.939
rpsA1833604c.63C>T0.741
rpsA1833607c.66T>C0.207
rpsA1833616c.75A>T0.203
rpsA1833619c.78A>C0.967
rpsA1833623p.Lys28Ala0.190
rpsA1833664c.123C>G0.706
rpsA1833667c.126C>G0.284
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T0.278
rpsA1833682c.141C>T0.278
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A0.610
rpsA1833694c.153G>T0.393
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T0.610
rpsA1833709c.168C>T0.984
rpsA1833724c.183C>T0.660
rpsA1833727c.186G>C0.980
rpsA1833733c.192C>G0.319
rpsA1833734p.Ala65Ser0.936
rpsA1833739c.198C>T0.300
rpsA1833742c.201A>G0.980
rpsA1833745c.204G>C0.980
rpsA1833748c.207C>G0.647
rpsA1833760c.219C>T0.660
rpsA1833781c.240T>C0.275
rpsA1833787c.246C>G0.979
rpsA1833790c.249T>C0.980
rpsA1833793c.252C>T0.286
rpsA1833802c.261A>G0.700
rpsA1833811c.270G>T0.265
rpsA1833823c.282G>A0.830
rpsA1833829c.288A>G0.109
rpsA1833832c.291G>A0.979
rpsA1833838c.297G>C0.128
rpsA1833841c.300C>G0.977
rpsA1833847c.306C>G0.978
rpsA1833850c.309C>G0.119
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G0.812
rpsA1833886c.345C>G0.776
rpsA1833894p.Ala118Glu0.981
rpsA1833928c.387G>C0.984
rpsA1833949c.408T>C0.765
rpsA1833955c.414G>C0.225
rpsA1833961c.420C>G0.770
rpsA1833970c.429G>T0.240
rpsA1833976c.435C>T0.256
rpsA1833979c.438T>C0.987
rpsA1833985c.444G>T0.253
rpsA1833991c.450C>G0.263
rpsA1833997c.456G>C0.263
rpsA1834000c.459G>C0.988
rpsA1834009c.468C>T0.986
rpsA1834012c.471G>C0.986
rpsA1834015c.474G>C0.987
rpsA1834021c.480C>T0.683
rpsA1834024c.483G>C0.293
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T0.728
rpsA1834034p.Ile165Val0.277
rpsA1834066c.525G>A0.319
rpsA1834069c.528G>C0.319
rpsA1834073p.Lys178Arg0.662
rpsA1834093c.552G>C0.344
rpsA1834096c.555G>C0.632
rpsA1834099c.558C>G1.000
rpsA1834105c.564C>T0.353
rpsA1834108c.567C>G0.383
rpsA1834114c.573G>C1.000
rpsA1834135c.594G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834183c.642T>C0.294
rpsA1834210c.669C>T0.233
rpsA1834228c.687C>A0.684
rpsA1834231c.690T>G0.289
rpsA1834234c.693G>T0.308
rpsA1834240c.699T>C0.641
rpsA1834246c.705G>T0.351
rpsA1834249c.708T>C0.973
rpsA1834252c.711C>G0.622
rpsA1834261c.720A>G0.255
rpsA1834264c.723G>C0.978
rpsA1834279c.738C>T0.976
rpsA1834294c.753G>T0.171
rpsA1834297c.756C>T0.833
rpsA1834298p.Gln253Glu0.143
rpsA1834303c.762T>G0.146
rpsA1834306c.765T>C0.975
rpsA1834307p.Asp256Asn0.136
rpsA1834327c.786G>T1.000
rpsA1834348c.807T>C0.114
rpsA1834357c.816T>C0.977
rpsA1834366c.825A>G0.957
rpsA1834375c.834G>C0.896
rpsA1834396c.855G>C0.118
rpsA1834399p.His286Gln0.120
rpsA1834411c.870T>G0.234
rpsA1834414c.873C>T0.739
rpsA1834417c.876G>C0.739
rpsA1834420c.879C>T0.745
rpsA1834423c.882G>C0.979
rpsA1834429c.888C>T0.765
rpsA1834432c.891G>T0.216
rpsA1834438c.897C>T0.731
rpsA1834451c.910T>C0.982
rpsA1834456c.915T>G0.736
rpsA1834465c.924T>C0.273
rpsA1834468c.927A>G0.982
rpsA1834477c.936C>T0.655
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C0.533
rpsA1834520p.Ala327Ser0.533
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T0.455
rpsA1834540c.999G>T0.385
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly0.972
rpsA1834570c.1029C>T0.210
rpsA1834574p.Met345Leu0.203
rpsA1834606c.1065C>T0.984
rpsA1834609c.1068T>C0.983
rpsA1834612c.1071G>C0.220
rpsA1834619c.1078T>C0.979
rpsA1834622c.1081T>A0.660
rpsA1834627c.1086C>G0.217
rpsA1834633c.1092A>G0.984
rpsA1834636c.1095C>G0.183
rpsA1834639c.1098T>C0.983
rpsA1834645c.1104C>T0.812
rpsA1834650p.Thr370Asn0.143
rpsA1834653p.Glu371Ala0.134
rpsA1834663c.1122C>T0.143
rpsA1834666c.1125G>C0.831
rpsA1834667p.Ala376Ser0.984
rpsA1834688c.1147A>T0.182
rpsA1834700p.Gln387Ala0.773
rpsA1834705c.1164C>G0.779
rpsA1834720c.1179C>G0.800
rpsA1834732c.1191T>C0.829
rpsA1834733p.Ala398Pro0.169
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val0.933
kasA2518738c.624G>C0.957
kasA2518756c.642G>C0.958
kasA2518768c.654C>G0.960
kasA2518771c.657C>G0.960
kasA2518774c.660C>T0.960
kasA2518783c.669T>G0.960
kasA2518787p.Arg225Lys0.960
kasA2518792c.678C>T0.960
kasA2518795c.681C>T0.960
kasA2518798c.684G>C0.960
kasA2518822c.708C>A0.978
kasA2518825c.711T>C0.978
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G0.917
panD4044150c.132T>G0.917
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu0.917
panD4044188c.94C>G0.917
panD4044189c.93G>A0.917
panD4044194p.Ala30Pro0.917
panD4044195c.87A>G0.917
panD4044219c.63G>A0.917
panD4044233p.Cys17His0.917
panD4044234c.48G>C0.917
panD4044249c.33G>A0.846
panD4044266p.Leu6Met0.800
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C0.974
embC4240772p.Ser304Ala0.974
embC4240778p.His306Gly0.944
embC4240781p.Ala307Ser0.946
embC4240789c.927T>C0.963
embC4240819c.957A>C0.961
embC4240826p.Ala322Ser0.956
embC4240831c.969T>G0.950
embC4240856p.Ala332Thr0.926
embC4240859p.Leu333Ile0.920
embC4240876c.1014C>T0.917
embC4240879c.1017G>T0.917
embC4240885c.1023T>C0.917
embC4240886p.Ile342Val0.917
embC4240897c.1035C>G0.900
embC4240900c.1038A>G0.900
embB4248220c.1707A>G0.842
embB4248226c.1713G>C0.842
embB4248232c.1719G>T0.842
embB4248233p.Leu574Val0.842
embB4248236p.Met575Leu0.895
embB4248245p.Ile578Val0.923
embB4248250c.1737C>T0.926
embB4248259p.Met582Ile0.929
embB4248275p.Thr588Ala0.929
embB4248292c.1779G>A0.929

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;