TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d808674338c6
Sample: 5d808674338c6

Download results

Summary
ID: 5d808674338c6
Date: Tue Sep 17 08:51:38 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.917
gyrB6115c.876A>G0.926
gyrB6121c.882C>T0.926
gyrB6127c.888G>C0.926
gyrB6133c.894G>C0.926
gyrB6136c.897G>A0.926
gyrB6151c.912C>T0.926
gyrB6172c.933C>T0.926
gyrB6184c.945C>T0.926
gyrB6193c.954G>A0.900
gyrB6196c.957C>T0.900
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6703c.1464G>C0.977
gyrB6706c.1467G>A0.977
gyrB6709c.1470A>G0.977
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T0.979
gyrB6728c.1489C>T0.979
gyrB6739c.1500C>T0.981
gyrB6745c.1506T>C0.982
gyrB6754c.1515C>T0.983
gyrB6763c.1524G>C0.983
gyrB6772c.1533C>G0.982
gyrB6775c.1536G>C0.962
gyrB6793c.1554T>C0.986
gyrB6798p.Gly520Ala0.986
gyrB6808c.1569C>G0.984
gyrB6824c.1585C>T0.983
gyrB6841c.1602T>C0.983
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7006c.1767T>G0.947
gyrB7010p.Leu591Met0.947
gyrB7015c.1776G>A0.947
gyrB7018c.1779G>C0.947
gyrB7024c.1785G>C0.947
gyrB7033c.1794G>C0.947
gyrB7051p.Glu604Asp0.947
gyrB7060c.1821T>C0.947
gyrB7066c.1827G>T0.900
gyrB7078c.1839A>G0.900
gyrB7081c.1842T>C0.900
gyrB7084c.1845A>G0.900
gyrB7090c.1851C>T0.900
gyrB7093c.1854T>C0.900
gyrB7100c.1861T>C0.900
gyrA7499c.198G>C0.979
gyrA7511c.210C>T0.981
gyrA7523c.222C>G0.966
gyrA7526c.225G>C0.968
gyrA7547c.246C>T0.973
gyrA7553c.252C>T0.974
gyrA7559c.258G>C0.987
gyrA7565c.264C>T0.989
gyrA7574c.273G>C0.989
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.989
gyrA7595c.294C>T0.989
gyrA7607c.306C>T0.977
gyrA7637c.336C>A0.953
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C0.955
gyrA8159c.858G>C0.955
gyrA8168c.867A>G0.955
gyrA8174c.873C>G0.955
gyrA8177c.876A>C0.955
gyrA8187p.Leu296Ile0.955
gyrA8192c.891C>G0.955
gyrA8198c.897T>C0.955
gyrA8207c.906T>C0.955
gyrA8267c.966G>C0.976
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T0.964
gyrA8330c.1029C>G0.964
gyrA8339c.1038A>G0.963
gyrA8340p.Ala347Ser0.963
gyrA8354c.1053G>C0.962
gyrA8372c.1071G>T0.935
gyrA8382c.1081C>T0.914
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8783c.1482G>C1.000
gyrA8786c.1485T>G1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T0.961
gyrA8967p.Ala556Lys0.957
gyrA8978c.1677C>T0.957
gyrA8987c.1686C>G0.931
gyrA8990c.1689C>G0.929
gyrA8993c.1692C>T0.926
gyrA8996c.1695T>C0.926
gyrA8998p.Leu566Trp0.926
gyrA9018p.Gln573Lys0.857
gyrA9023c.1722A>C0.846
gyrA9026c.1725G>C0.833
gyrA9029c.1728T>C0.833
gyrA9035c.1734G>C0.833
rpoB760079c.273G>A0.967
rpoB760091c.285G>C0.976
rpoB760101c.295T>C0.976
rpoB760110c.304T>A0.976
rpoB760118c.312T>G0.976
rpoB760121c.315T>C0.977
rpoB760130p.Asp108Glu0.982
rpoB760139c.333A>G0.984
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser0.958
rpoB760361c.555T>C0.960
rpoB760370c.564C>G0.963
rpoB760376p.Asp190Glu0.964
rpoB760382c.576G>C0.967
rpoB760388c.582C>T0.971
rpoB760400c.594G>C0.974
rpoB760406c.600G>C0.830
rpoB760407p.Ser201Gly0.976
rpoB760415c.609C>T0.983
rpoB760418c.612G>C0.984
rpoB760430c.624T>C0.985
rpoB760460c.654G>C0.987
rpoB760475c.669A>G0.989
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G0.989
rpoB760522p.Ser239Asn0.978
rpoB760532c.726T>C0.978
rpoB760541c.735G>C0.977
rpoB760567p.Ser254Trp0.917
rpoB760571c.765G>C0.917
rpoB760588p.Thr261Ile0.929
rpoB760591p.Val262Ala0.929
rpoB760595c.789C>T0.929
rpoB760596p.Thr264Pro0.929
rpoB760608c.802C>T0.941
rpoB760611c.805T>C0.941
rpoB760634c.828T>C0.935
rpoB760646c.840C>G0.929
rpoB760655c.849A>G0.971
rpoB760661c.855A>G0.971
rpoB760668p.Thr288Ala0.958
rpoB760674c.868T>C0.957
rpoB760679c.873A>G0.957
rpoB760683c.877T>C0.957
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760793c.987A>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala0.975
rpoB760862c.1056G>C0.976
rpoB760865c.1059C>T0.976
rpoB760886p.Glu360Asp0.980
rpoB760887p.Thr361Val0.962
rpoB760910c.1104C>T0.983
rpoB760916c.1110C>T0.966
rpoB760928c.1122G>C0.964
rpoB760943c.1137C>T0.957
rpoB760946c.1140A>G0.978
rpoB760965p.Met387Leu0.949
rpoB760970c.1164G>C0.947
rpoB760973c.1167G>T0.944
rpoB760982c.1176G>C0.958
rpoB760985c.1179G>C0.917
rpoB760988c.1182C>G0.917
rpoB760991c.1185G>T0.957
rpoB760997c.1191G>C0.967
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761219c.1413G>C1.000
rpoB761234c.1428G>C1.000
rpoB761246c.1440C>T1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C0.980
rpoB761264c.1458C>G0.981
rpoB761273c.1467T>C1.000
rpoB761303c.1497G>C1.000
rpoB761318c.1512G>T1.000
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G1.000
rpoB761497p.Tyr564Phe0.909
rpoB761502p.Pro566Ser1.000
rpoB761505p.Ser567Ala1.000
rpoB761508p.Ser568Thr1.000
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761531c.1725C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G0.982
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T1.000
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761891c.2085G>C0.960
rpoB761909c.2103T>C0.962
rpoB761912c.2106T>C0.962
rpoB761915p.Asp703Glu0.962
rpoB761916p.Asp704Asn0.962
rpoB761924c.2118G>A0.968
rpoB761930c.2124G>C0.968
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C0.988
rpoB762236c.2430G>C0.988
rpoB762245c.2439G>C0.988
rpoB762275c.2469C>T0.986
rpoB762284c.2478G>C0.984
rpoB762293c.2487T>C0.983
rpoB762296c.2490G>C0.983
rpoB762317c.2511A>G0.980
rpoB762323c.2517C>A0.979
rpoB762329c.2523G>C0.977
rpoB762404c.2598T>C0.897
rpoB762410c.2604T>G0.898
rpoB762416c.2610A>G0.925
rpoB762449c.2643C>A0.921
rpoB762452c.2646G>C0.906
rpoB762470c.2664G>C0.892
rpoB762488c.2682G>C0.898
rpoB762491c.2685T>C0.898
rpoB762509c.2703T>G0.848
rpoB762510p.Ala902Pro0.844
rpoB762515c.2709C>T0.905
rpoB762533c.2727T>C0.929
rpoB762536c.2730T>C0.913
rpoB762537c.2731T>C0.913
rpoB762551c.2745C>T0.895
rpoB762557c.2751G>A0.800
rpoB762827c.3021G>C0.952
rpoB762830c.3024C>G0.955
rpoB762857c.3051C>G0.929
rpoB762860c.3054G>C0.929
rpoB762863c.3057T>C0.929
rpoB762866c.3060C>T0.929
rpoB762879p.Met1025Leu0.955
rpoB762894c.3088C>T0.960
rpoB762899c.3093G>C0.964
rpoB762917c.3111C>G0.960
rpoB762920c.3114C>T0.960
rpoB762923c.3117C>G0.960
rpoB762929c.3123G>C0.966
rpoB762959c.3153G>C0.968
rpoB762962c.3156C>T0.983
rpoB762995c.3189G>T0.984
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C0.986
rpoB763136c.3330C>T0.983
rpoB763145c.3339G>A0.983
rpoB763157c.3351G>T0.981
rpoB763166c.3360A>G0.980
rpoB763172c.3366G>C0.979
rpoB763193c.3387C>G0.951
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A0.971
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763879c.510A>G0.727
rpoC763888c.519G>T0.824
rpoC763891c.522G>C0.824
rpoC763894c.525A>G0.824
rpoC763900c.531G>C0.932
rpoC763933c.564C>T0.955
rpoC763940p.Ala191Ser0.953
rpoC763945c.576T>C0.977
rpoC763947p.Ala193Val0.977
rpoC763951c.582G>C0.977
rpoC763960c.591T>G0.977
rpoC763969c.600C>T0.977
rpoC763987c.618C>T0.966
rpoC763991p.Ile208Leu0.962
rpoC763996c.627T>C0.958
rpoC763999c.630C>T0.958
rpoC764002c.633C>G0.958
rpoC764003p.Ala212Ser0.958
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T1.000
rpoC764098c.729A>G1.000
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764176c.807C>T1.000
rpoC764177p.Ile270Leu0.909
rpoC764311c.942C>G0.938
rpoC764317c.948C>G0.947
rpoC764320c.951C>G0.947
rpoC764332c.963G>A0.963
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C0.984
rpoC764431c.1062G>C0.983
rpoC764434c.1065A>G0.983
rpoC764435c.1066A>C0.983
rpoC764458c.1089G>C0.986
rpoC764461c.1092A>G0.986
rpoC764497c.1128A>G0.984
rpoC764510c.1141C>T0.983
rpoC764524c.1155C>G0.981
rpoC764530c.1161C>G0.980
rpoC764534c.1165C>A0.979
rpoC764539c.1170C>T0.977
rpoC764542c.1173C>T0.978
rpoC764545c.1176C>A0.978
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.987
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G0.988
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C0.960
rpoC765007c.1638T>G0.958
rpoC765008c.1639T>C0.958
rpoC765011c.1642A>T0.958
rpoC765016c.1647C>G0.958
rpoC765019c.1650A>G0.960
rpoC765040c.1671T>C0.952
rpoC765041c.1672T>C0.952
rpoC765047c.1678T>C0.952
rpoC765055c.1686C>G0.952
rpoC765073c.1704G>C0.889
rpoC765076c.1707A>G0.880
rpoC765079c.1710T>G0.870
rpoC765082c.1713G>C0.833
rpoC765085c.1716T>C0.833
rpoC765089c.1720T>C0.833
rpoC765100c.1731G>C0.833
rpoC765103c.1734G>T0.833
rpoC765121c.1752G>T0.857
rpoC765129p.Tyr587Phe0.857
rpoC765143p.Val592Ile0.857
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>C0.963
rpoC765379c.2010G>C0.963
rpoC765382c.2013G>T0.963
rpoC765383p.Met672Leu0.963
rpoC765403c.2034G>C0.976
rpoC765405p.Leu679His0.976
rpoC765409c.2040T>G0.976
rpoC765421c.2052C>G0.980
rpoC765449p.Ala694Ser0.983
rpoC765454c.2085C>G0.984
rpoC765469c.2100G>C0.986
rpoC765478c.2109T>G0.985
rpoC765480p.Tyr704Phe0.985
rpoC765499c.2130C>G0.982
rpoC765511c.2142C>T0.980
rpoC765517c.2148C>G0.979
rpoC765533p.Tyr722His0.974
rpoC765544c.2175C>G0.963
rpoC765547c.2178C>T0.962
rpoC765548c.2179A>T0.962
rpoC765553c.2184C>T0.962
rpoC765556c.2187G>C0.962
rpoC765562c.2193G>T0.962
rpoC765826c.2457T>C0.966
rpoC765835c.2466C>T0.971
rpoC765841c.2472G>T0.973
rpoC765861p.Phe831Tyr0.976
rpoC765875p.Val836Ile0.981
rpoC765907c.2538G>T0.982
rpoC765910c.2541G>C0.982
rpoC765928c.2559C>G0.979
rpoC765940c.2571A>T0.957
rpoC765947c.2578T>C0.955
rpoC765962c.2593T>C0.909
rpoC765967c.2598C>T0.900
rpoC765973c.2604C>G0.941
rpoC765979c.2610C>G0.941
rpoC765982c.2613C>T0.941
rpoC765994c.2625A>T0.933
rpoC766003c.2634G>C0.923
rpoC766009c.2640G>C0.900
rpoC766012c.2643C>G0.900
rpoC766321c.2952C>G0.842
rpoC766333c.2964G>T0.917
rpoC766345c.2976T>C0.917
rpoC766348c.2979A>G0.917
rpoC766351c.2982C>G0.917
rpoC766353p.Val995Ala0.917
rpoC766369c.3000C>G0.959
rpoC766375c.3006C>G0.961
rpoC766381c.3012C>T0.961
rpoC766384c.3015A>G0.961
rpoC766390c.3021C>T0.963
rpoC766393c.3024C>T0.965
rpoC766408c.3039C>T0.968
rpoC766435p.Glu1022Asp0.984
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766642c.3273C>T1.000
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C0.960
rpoC766843c.3474T>G0.960
rpoC766846c.3477C>A0.960
rpoC766858c.3489C>T0.960
rpoC766861c.3492G>C0.960
rpoC766867c.3498C>G0.960
rpoC766876c.3507C>T0.960
rpoC766931p.Ala1188Ser0.955
rpoC766942c.3573C>T0.960
rpoC766945c.3576A>C0.962
rpoC766963c.3594T>C0.972
rpoC766996c.3627C>T0.989
rpoC767002c.3633G>C0.989
rpoC767008c.3639G>A0.989
rpoC767023c.3654C>T0.988
rpoC767044c.3675G>C0.988
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.968
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C0.983
rpsL781715c.156T>G0.981
rpsL781772c.213C>T0.977
rpsL781802c.243G>C0.981
rpsL781814c.255C>T0.982
rpsL781817c.258G>T0.982
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T0.971
rpsL781907c.348T>C0.964
rpsL781916c.357T>C0.952
rpsL781929p.Gly124Ser0.941
rpsL781933374G>A0.938
rplC800806c.-3G>A0.818
rplC800808c.-1A>C0.818
rplC800815c.7C>A0.818
rplC800820c.12G>A0.818
rplC800823c.15C>A0.818
rplC800829c.21C>G0.818
rplC800832c.24T>C0.818
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472061r.216a>t0.977
rrs1472106r.261g>a0.955
rrs1472108r.263c>t0.955
rrs1472113r.268t>c0.957
rrs1472150r.305t>a0.976
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c0.973
rrs1472446r.601t>a0.919
rrs1472452r.607g>a0.921
rrs1472464r.619a>g0.929
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c1.000
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473707r.50t>a0.923
rrl1473717r.60g>a0.933
rrl1473731r.74t>a0.947
rrl1473746r.89t>c0.909
rrl1473756r.99g>t0.917
rrl1473758r.101g>t0.917
rrl1473770r.113t>c0.893
rrl1473806r.149c>t0.889
rrl1473812r.155g>a0.875
rrl1473814r.157a>t0.875
rrl1473815r.158t>g0.875
rrl1473829r.172g>c0.900
rrl1473831r.174g>t0.900
rrl1473832r.175c>t0.839
rrl1473839r.182g>a0.914
rrl1473876r.219g>a0.929
rrl1473887r.230t>c0.960
rrl1473888r.231t>c0.960
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474056r.399t>c1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.818
rrl1474184r.527c>a0.962
rrl1474185r.528ga>g1.000
rrl1474186r.529a>ag1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474290r.633ttttcctctccggagg>t1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c0.974
rrl1474362r.705a>g0.973
rrl1474387r.730c>t1.000
rrl1474413r.756a>c0.941
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.938
rrl1474496r.839c>g0.968
rrl1474497r.840g>c0.969
rrl1474506r.849c>g0.968
rrl1474507r.850g>c0.968
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c0.960
rrl1475209r.1552g>a0.952
rrl1475213r.1556c>t0.952
rrl1475220r.1563g>t0.952
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.962
rrl1475977r.2320a>g0.962
rrl1475988r.2331a>g0.955
rrl1475989r.2332t>c0.952
rrl1475993r.2336c>t0.952
rrl1475997r.2340a>t0.952
rrl1476085r.2428g>a0.947
rrl1476086r.2429g>a0.947
rrl1476088r.2431a>c0.947
rrl1476099r.2442a>g0.947
rrl1476103r.2446c>g0.947
rrl1476105r.2448g>a0.947
rrl1476106r.2449a>t0.947
rrl1476110r.2453g>c0.947
rrl1476114r.2457t>c0.947
rrl1476115r.2458t>c0.947
rrl1476131r.2474c>t0.967
rrl1476160r.2503t>c0.971
rrl1476214r.2557g>t0.969
rrl1476215r.2558c>t0.968
rrl1476221r.2564t>c0.968
rrl1476224r.2567a>g0.969
rrl1476251r.2594t>c0.969
rrl1476281r.2624t>c0.971
rrl1476297r.2640c>t0.972
rrl1476299r.2642c>t0.972
rrl1476584r.2927c>t0.976
rrl1476594r.2937c>t0.974
rrl1476597r.2940g>a0.972
rrl1476603r.2946g>a0.971
rrl1476608r.2951c>g0.973
rrl1476619r.2962c>t0.966
rrl1476628r.2971t>a0.962
rrl1476665r.3008t>a0.929
rrl1476666r.3009c>t0.929
rrl1476674r.3017t>c0.929
inhA1674855c.654C>G0.917
inhA1674858c.657G>A0.917
inhA1674876c.675C>T0.938
inhA1674879c.678T>C0.938
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C0.947
rpsA1833595c.54T>G0.921
rpsA1833596p.Ser19Ala0.921
rpsA1833604c.63C>T0.936
rpsA1833616c.75A>T0.939
rpsA1833619c.78A>C0.939
rpsA1833625c.84A>G0.942
rpsA1833664c.123C>G0.950
rpsA1833676c.135A>G0.943
rpsA1833679c.138G>T0.943
rpsA1833685c.144G>C0.940
rpsA1833691c.150G>A0.933
rpsA1833694c.153G>T0.930
rpsA1833697c.156C>T0.932
rpsA1833700c.159C>T0.953
rpsA1833709c.168C>T0.955
rpsA1833724c.183C>T0.969
rpsA1833727c.186G>C0.968
rpsA1833733c.192C>G0.935
rpsA1833734p.Ala65Ser0.935
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G0.981
rpsA1833811c.270G>T0.981
rpsA1833823c.282G>A0.981
rpsA1833832c.291G>A0.981
rpsA1833838c.297G>C0.981
rpsA1833841c.300C>G0.981
rpsA1833847c.306C>G0.981
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T0.983
rpsA1833874c.333T>G0.986
rpsA1833886c.345C>G0.987
rpsA1833894p.Ala118Glu0.987
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C0.985
rpsA1833991c.450C>G0.971
rpsA1834000c.459G>C0.986
rpsA1834009c.468C>T0.984
rpsA1834012c.471G>C0.984
rpsA1834015c.474G>C0.984
rpsA1834021c.480C>T0.984
rpsA1834030c.489C>G0.984
rpsA1834033c.492C>T0.984
rpsA1834073p.Lys178Arg0.980
rpsA1834096c.555G>C0.978
rpsA1834099c.558C>G0.977
rpsA1834108c.567C>G0.951
rpsA1834114c.573G>C0.974
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834420c.879C>T0.982
rpsA1834423c.882G>C0.983
rpsA1834429c.888C>T0.986
rpsA1834438c.897C>T0.986
rpsA1834451c.910T>C0.986
rpsA1834456c.915T>G0.986
rpsA1834468c.927A>G0.987
rpsA1834477c.936C>T0.987
rpsA1834489c.948T>C0.987
rpsA1834519c.978G>C0.980
rpsA1834520p.Ala327Ser0.980
rpsA1834528c.987T>C0.980
rpsA1834534c.993C>T0.980
rpsA1834543c.1002C>G0.979
rpsA1834546c.1005T>C0.979
rpsA1834552c.1011G>T0.957
rpsA1834555c.1014T>G0.979
rpsA1834557p.Ala339Gly0.979
rpsA1834606c.1065C>T0.985
rpsA1834609c.1068T>C0.984
rpsA1834619c.1078T>C0.980
rpsA1834622c.1081T>A0.979
rpsA1834633c.1092A>G0.984
rpsA1834639c.1098T>C0.985
rpsA1834645c.1104C>T0.973
rpsA1834666c.1125G>C0.970
rpsA1834667p.Ala376Ser0.970
rpsA1834690c.1149T>C0.986
rpsA1834701p.Gln387Pro0.967
rpsA1834720c.1179C>G0.971
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C0.983
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T0.977
rpsA1834776p.Ala412Glu0.977
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C0.875
kasA2518756c.642G>C0.914
kasA2518768c.654C>G0.949
kasA2518771c.657C>G0.925
kasA2518774c.660C>T0.925
kasA2518783c.669T>G0.949
kasA2518787p.Arg225Lys0.925
kasA2518792c.678C>T0.949
kasA2518795c.681C>T0.949
kasA2518798c.684G>C0.925
kasA2518822c.708C>A0.984
kasA2518825c.711T>C0.984
kasA2518846c.732G>T0.983
kasA2518849c.735G>C0.983
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G0.929
panD4044150c.132T>G0.929
panD4044156c.126T>C0.929
panD4044167c.115G>A0.929
panD4044171c.111G>A0.929
panD4044174c.108G>A0.929
panD4044180p.Asp34Glu0.929
panD4044188c.94C>G0.929
panD4044189c.93G>A0.929
panD4044194p.Ala30Pro0.929
panD4044195c.87A>G0.929
panD4044219c.63G>A0.867
panD4044233p.Cys17His0.933
panD4044234c.48G>C0.933
panD4044249c.33G>A0.933
panD4044266p.Leu6Met0.923
embC4240729c.867C>G0.969
embC4240735c.873C>G0.970
embC4240741c.879C>T0.970
embC4240756c.894G>C0.971
embC4240771c.909G>C0.964
embC4240772p.Ser304Ala0.962
embC4240778p.His306Gly0.962
embC4240781p.Ala307Ser0.943
embC4240789c.927T>C0.970
embC4240819c.957A>C0.962
embC4240826p.Ala322Ser0.959
embC4240831c.969T>G0.976
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248206p.Ser565Gly0.917
embB4248220c.1707A>G0.973
embB4248226c.1713G>C0.974
embB4248232c.1719G>T0.974
embB4248233p.Leu574Val0.974
embB4248236p.Met575Leu0.974
embB4248245p.Ile578Val0.980
embB4248250c.1737C>T0.981
embB4248259p.Met582Ile0.982
embB4248275p.Thr588Ala0.982
embB4248292c.1779G>A0.982

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;