TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d8090674f515
Sample: 5d8090674f515

Download results

Summary
ID: 5d8090674f515
Date: Tue Sep 17 09:29:33 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.921
gyrB6115c.876A>G0.949
gyrB6121c.882C>T0.925
gyrB6127c.888G>C0.925
gyrB6133c.894G>C0.925
gyrB6136c.897G>A0.925
gyrB6151c.912C>T0.949
gyrB6172c.933C>T0.949
gyrB6184c.945C>T0.923
gyrB6193c.954G>A0.882
gyrB6196c.957C>T0.846
gyrB6202c.963C>T0.818
gyrB6203p.Ser322Ala0.818
gyrB6214c.975G>C0.900
gyrB6223c.984G>C0.900
gyrB6229c.990G>A0.900
gyrB6634c.1395T>C0.882
gyrB6637c.1398T>G0.882
gyrB6640c.1401A>C0.882
gyrB6643c.1404A>G0.882
gyrB6646c.1407C>T0.895
gyrB6655c.1416T>C0.885
gyrB6673c.1434A>C0.949
gyrB6676c.1437T>G0.953
gyrB6703c.1464G>C0.957
gyrB6706c.1467G>A0.957
gyrB6709c.1470A>G0.957
gyrB6712c.1473G>C0.961
gyrB6727c.1488G>T0.980
gyrB6728c.1489C>T0.980
gyrB6739c.1500C>T0.984
gyrB6745c.1506T>C0.984
gyrB6754c.1515C>T0.986
gyrB6763c.1524G>C0.987
gyrB6772c.1533C>G0.939
gyrB6775c.1536G>C0.936
gyrB6793c.1554T>C0.989
gyrB6798p.Gly520Ala0.989
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A0.947
gyrB7018c.1779G>C0.947
gyrB7024c.1785G>C0.947
gyrB7033c.1794G>C0.947
gyrB7051p.Glu604Asp0.947
gyrB7060c.1821T>C0.947
gyrB7066c.1827G>T0.947
gyrB7078c.1839A>G0.947
gyrB7081c.1842T>C0.947
gyrB7084c.1845A>G0.900
gyrB7090c.1851C>T0.900
gyrB7093c.1854T>C0.900
gyrB7100c.1861T>C0.900
gyrA7499c.198G>C0.977
gyrA7511c.210C>T0.982
gyrA7523c.222C>G0.971
gyrA7526c.225G>A0.972
gyrA7547c.246C>T0.979
gyrA7553c.252C>T0.980
gyrA7559c.258G>C0.981
gyrA7565c.264C>T0.982
gyrA7574c.273G>C0.983
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.984
gyrA7595c.294C>T0.984
gyrA7607c.306C>T0.991
gyrA7637c.336C>A0.979
gyrA8121c.820T>C0.917
gyrA8129c.828T>C0.917
gyrA8156c.855T>C0.917
gyrA8159c.858G>C0.917
gyrA8168c.867A>G0.917
gyrA8174c.873C>G0.917
gyrA8177c.876A>C0.917
gyrA8187p.Leu296Ile0.917
gyrA8192c.891C>G0.917
gyrA8198c.897T>C0.957
gyrA8207c.906T>C0.917
gyrA8267c.966G>C0.976
gyrA8283p.Ile328Leu0.977
gyrA8288c.987T>C0.978
gyrA8294c.993T>C0.981
gyrA8327c.1026C>T0.984
gyrA8330c.1029C>G0.984
gyrA8339c.1038A>G0.984
gyrA8340p.Ala347Ser0.984
gyrA8354c.1053G>C0.982
gyrA8382c.1081C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C0.941
gyrA8642c.1341A>G0.941
gyrA8645c.1344C>G0.941
gyrA8649p.Arg450Lys0.941
gyrA8666c.1365G>C0.941
gyrA8672c.1371A>G0.941
gyrA8693c.1392T>C0.941
gyrA8696c.1395G>C0.941
gyrA8699c.1398A>G0.941
gyrA8792c.1491G>C0.800
gyrA8799p.Ala500Ser0.842
gyrA8810c.1509A>G0.857
gyrA8817p.Ser506Ala0.864
gyrA8828c.1527T>C0.864
gyrA8829c.1528T>C0.864
gyrA8837c.1536C>G0.909
gyrA8846c.1545C>T0.932
gyrA8852c.1551T>C0.933
gyrA8858c.1557T>C0.957
gyrA8870c.1569G>C0.964
gyrA8873c.1572A>G0.947
gyrA8897c.1596T>C0.959
gyrA8903c.1602T>C0.986
gyrA8915c.1614A>G0.988
gyrA8942c.1641G>T0.985
gyrA8945c.1644G>C0.985
gyrA8946c.1645T>C0.985
gyrA8957c.1656C>T0.984
gyrA8967p.Ala556Lys0.981
gyrA8978c.1677C>T0.981
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
gyrA9023c.1722A>C1.000
gyrA9026c.1725G>C1.000
gyrA9029c.1728T>C1.000
gyrA9035c.1734G>C1.000
gyrA9044c.1743C>G1.000
gyrA9047c.1746C>T1.000
rpoB760070c.264T>G0.818
rpoB760079c.273G>A0.938
rpoB760091c.285G>C0.947
rpoB760101c.295T>C0.951
rpoB760110c.304T>A0.951
rpoB760118c.312T>G0.955
rpoB760121c.315T>C0.955
rpoB760130p.Asp108Glu0.968
rpoB760139c.333A>G0.968
rpoB760142c.336C>T0.971
rpoB760181c.375T>C0.987
rpoB760184c.378A>G0.987
rpoB760196c.390C>G0.988
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T0.980
rpoB760274p.Glu156Asp0.977
rpoB760276p.Lys157Met0.976
rpoB760283c.477G>C0.975
rpoB760298c.492G>C0.941
rpoB760307c.501T>C0.970
rpoB760357p.Thr184Ser0.935
rpoB760361c.555T>C0.939
rpoB760370c.564C>G0.941
rpoB760376p.Asp190Glu0.947
rpoB760382c.576G>C0.929
rpoB760400c.594G>C0.940
rpoB760406c.600G>C0.940
rpoB760407p.Ser201Gly0.961
rpoB760415c.609C>T0.965
rpoB760418c.612G>C0.967
rpoB760430c.624T>C0.968
rpoB760460c.654G>C0.986
rpoB760475c.669A>G0.957
rpoB760481c.675G>T0.955
rpoB760484c.678A>G0.955
rpoB760502c.696C>G0.955
rpoB760522p.Ser239Asn0.958
rpoB760532c.726T>C0.972
rpoB760541c.735G>C0.957
rpoB760567p.Ser254Trp0.925
rpoB760571c.765G>C0.929
rpoB760588p.Thr261Ile0.943
rpoB760591p.Val262Ala0.943
rpoB760595c.789C>T0.943
rpoB760596p.Thr264Pro0.944
rpoB760608c.802C>T0.950
rpoB760611c.805T>C0.952
rpoB760634c.828T>C0.984
rpoB760646c.840C>G0.967
rpoB760655c.849A>G0.965
rpoB760661c.855A>G0.962
rpoB760668p.Thr288Ala0.946
rpoB760674c.868T>C0.944
rpoB760679c.873A>G0.944
rpoB760683c.877T>C0.971
rpoB760703c.897C>T0.970
rpoB760721c.915C>G0.960
rpoB760727c.921C>G0.950
rpoB760730c.924T>C0.950
rpoB760736c.930C>G0.950
rpoB760793c.987A>G0.846
rpoB760799c.993C>T0.941
rpoB760805c.999G>C0.947
rpoB760817c.1011A>G0.958
rpoB760820c.1014T>C0.963
rpoB760826c.1020C>G0.931
rpoB760830c.1024T>C0.938
rpoB760841c.1035T>C0.957
rpoB760858p.Val351Ala0.982
rpoB760862c.1056G>C0.982
rpoB760886p.Glu360Asp0.984
rpoB760887p.Thr361Val0.984
rpoB760910c.1104C>T0.987
rpoB760916c.1110C>T0.987
rpoB760928c.1122G>C0.986
rpoB760946c.1140A>G0.986
rpoB760965p.Met387Leu0.952
rpoB760970c.1164G>C0.946
rpoB760973c.1167G>T0.972
rpoB760979c.1173G>A0.970
rpoB760982c.1176G>T0.968
rpoB760985c.1179G>C0.968
rpoB760988c.1182C>G0.968
rpoB760991c.1185G>C0.970
rpoB760997c.1191G>C0.984
rpoB761006c.1200C>G0.973
rpoB761015c.1209G>C0.974
rpoB761027c.1221A>C0.976
rpoB761036c.1230G>C0.961
rpoB761037c.1231T>C0.961
rpoB761051c.1245G>T0.962
rpoB761054c.1248G>C0.962
rpoB761060c.1254C>G0.963
rpoB761063c.1257C>G0.965
rpoB761084c.1278C>A0.967
rpoB761097c.1291A>T0.960
rpoB761102c.1296A>G0.972
rpoB761132c.1326G>T0.975
rpoB761133c.1327T>C0.975
rpoB761147c.1341C>T0.971
rpoB761150c.1344A>T0.985
rpoB761165c.1359G>C0.983
rpoB761178p.Ser458Thr0.982
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>T1.000
rpoB761219c.1413G>C1.000
rpoB761231c.1425C>T1.000
rpoB761234c.1428G>T1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C0.981
rpoB761264c.1458C>G0.981
rpoB761273c.1467T>C1.000
rpoB761276c.1470G>C1.000
rpoB761297c.1491C>T0.985
rpoB761318c.1512G>C0.981
rpoB761327c.1521A>G0.980
rpoB761339c.1533C>G0.973
rpoB761345c.1539G>C0.867
rpoB761346p.Val514Ser0.929
rpoB761354c.1548C>A0.929
rpoB761357c.1551G>T0.929
rpoB761360c.1554T>C0.929
rpoB761362p.Ser519Thr0.929
rpoB761373p.Val523His0.929
rpoB761387c.1581C>T0.929
rpoB761393c.1587G>A0.929
rpoB761414c.1608A>G0.917
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T0.978
rpoB761537c.1731C>G0.967
rpoB761555c.1749G>C0.971
rpoB761558c.1752C>G0.973
rpoB761564c.1758G>C0.975
rpoB761573c.1767C>G0.976
rpoB761579c.1773G>C0.978
rpoB761606c.1800C>G0.981
rpoB761612c.1806G>T0.971
rpoB761615c.1809A>C0.963
rpoB761636c.1830G>T0.965
rpoB761645c.1839C>G0.963
rpoB761648c.1842T>C0.963
rpoB761669c.1863C>T0.956
rpoB761675c.1869G>C0.955
rpoB761687c.1881C>T0.971
rpoB761690c.1884G>C0.971
rpoB761693c.1887G>C0.971
rpoB761705c.1899C>A0.966
rpoB761722p.Glu639Gly0.931
rpoB761727p.Ser641Gly0.931
rpoB761741c.1935G>A0.929
rpoB761750c.1944G>T0.929
rpoB761760p.Ile652Val0.895
rpoB761765c.1959T>C1.000
rpoB761891c.2085G>C0.958
rpoB761892p.Ile696Val0.958
rpoB761897c.2091C>G0.960
rpoB761909c.2103T>C0.923
rpoB761912c.2106T>C0.923
rpoB761915p.Asp703Glu0.923
rpoB761916p.Asp704Asn0.923
rpoB761924c.2118G>A0.933
rpoB761930c.2124G>C0.933
rpoB761933c.2127G>C0.933
rpoB761936c.2130C>T0.935
rpoB761948c.2142G>C0.957
rpoB761954c.2148C>A0.957
rpoB761955p.Ile717Val0.958
rpoB761969c.2163G>A0.983
rpoB761990c.2184G>C0.986
rpoB762008c.2202C>T0.986
rpoB762014c.2208C>G0.986
rpoB762038c.2232C>T0.982
rpoB762047c.2241G>A0.981
rpoB762053c.2247T>C0.981
rpoB762056c.2250G>A0.980
rpoB762065c.2259T>G0.979
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val0.980
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C0.990
rpoB762233c.2427G>C0.989
rpoB762236c.2430G>C0.989
rpoB762239c.2433G>A0.989
rpoB762245c.2439G>C0.991
rpoB762254c.2448T>C0.992
rpoB762284c.2478G>T0.980
rpoB762293c.2487T>C0.966
rpoB762296c.2490G>C0.966
rpoB762317c.2511A>G0.962
rpoB762323c.2517C>A0.958
rpoB762329c.2523G>C0.955
rpoB762404c.2598T>C0.929
rpoB762410c.2604T>G0.939
rpoB762416c.2610A>G0.943
rpoB762449c.2643C>A0.967
rpoB762452c.2646G>C0.967
rpoB762470c.2664G>C0.967
rpoB762488c.2682G>C0.979
rpoB762491c.2685T>C0.978
rpoB762509c.2703T>G0.949
rpoB762510p.Ala902Pro0.949
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G0.988
rpoB762920c.3114C>T0.988
rpoB762923c.3117C>G0.988
rpoB762929c.3123G>C0.989
rpoB762959c.3153G>C0.979
rpoB762962c.3156C>T0.978
rpoB762995c.3189G>T0.978
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G0.987
rpoB763040c.3234C>G0.987
rpoB763070c.3264T>C0.987
rpoB763082c.3276C>T0.986
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C0.984
rpoB763127c.3321G>C0.981
rpoB763136c.3330C>T0.979
rpoB763145c.3339G>A0.957
rpoB763157c.3351G>T0.974
rpoB763166c.3360A>G0.972
rpoB763172c.3366G>C0.969
rpoB763179c.3373C>T0.962
rpoB763193c.3387C>G0.955
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A0.982
rpoC763456c.87A>G0.983
rpoC763468c.99G>C0.984
rpoC763486c.117T>C0.986
rpoC763492c.123G>C0.986
rpoC763528c.159G>A0.973
rpoC763531c.162G>T0.972
rpoC763546c.177A>G0.969
rpoC763570c.201G>C0.971
rpoC763594c.225C>T0.969
rpoC763609c.240C>T0.969
rpoC763621c.252C>T0.968
rpoC763633c.264T>C0.967
rpoC763657c.288G>A0.982
rpoC763660c.291T>G0.982
rpoC763666c.297G>C0.980
rpoC763669c.300C>G0.962
rpoC763675c.306C>G0.980
rpoC763696c.327T>C0.882
rpoC763699c.330G>T0.867
rpoC763702c.333C>G0.867
rpoC763708c.339G>C0.867
rpoC763711c.342G>C0.867
rpoC763714c.345G>C0.867
rpoC763717c.348T>C0.867
rpoC763723c.354G>C0.812
rpoC763732c.363C>G0.733
rpoC763741c.372C>T0.733
rpoC763744c.375G>C0.733
rpoC763747c.378G>A0.733
rpoC763765c.396T>C0.667
rpoC763774c.405G>C0.636
rpoC763781p.Ser138Thr0.600
rpoC763891c.522G>C0.900
rpoC763894c.525A>G0.929
rpoC763900c.531G>C0.943
rpoC763933c.564C>T0.973
rpoC763940p.Ala191Ser0.973
rpoC763945c.576T>C0.973
rpoC763947p.Ala193Val0.973
rpoC763951c.582G>C0.973
rpoC763960c.591T>G0.973
rpoC763969c.600C>T0.973
rpoC763987c.618C>T0.923
rpoC763991p.Ile208Leu0.913
rpoC763996c.627T>C0.913
rpoC763999c.630C>T0.913
rpoC764002c.633C>G0.913
rpoC764003p.Ala212Ser0.913
rpoC764024c.655T>C0.900
rpoC764029p.Glu220Asp0.905
rpoC764032p.Asp221Glu0.926
rpoC764040p.Ser224Thr0.912
rpoC764044c.675T>C0.912
rpoC764054c.685C>T0.944
rpoC764059c.690G>T0.946
rpoC764083c.714A>G0.950
rpoC764084p.Asn239Val0.950
rpoC764098c.729A>G0.950
rpoC764110c.741C>T0.950
rpoC764143c.774G>C0.917
rpoC764147p.Ser260Ala0.917
rpoC764150p.Ile261Val0.917
rpoC764165p.Glu266Gln0.917
rpoC764311c.942C>G0.900
rpoC764317c.948C>G0.900
rpoC764320c.951C>G0.900
rpoC764332c.963G>A0.920
rpoC764338c.969G>A0.926
rpoC764353c.984G>T0.944
rpoC764362c.993C>T0.944
rpoC764365c.996C>T0.944
rpoC764371c.1002G>C0.972
rpoC764377c.1008C>G0.972
rpoC764380c.1011G>C0.973
rpoC764387c.1018T>C0.973
rpoC764405c.1036A>C0.978
rpoC764428c.1059G>T0.980
rpoC764431c.1062G>C0.980
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764452c.1083T>C0.984
rpoC764458c.1089G>C0.985
rpoC764461c.1092A>G0.985
rpoC764497c.1128A>G0.986
rpoC764509c.1140G>A0.986
rpoC764510c.1141C>T0.986
rpoC764521c.1152T>C0.986
rpoC764527c.1158C>T0.984
rpoC764530c.1161C>T0.984
rpoC764533c.1164C>A0.984
rpoC764536c.1167G>T0.969
rpoC764539c.1170C>G0.985
rpoC764575c.1206T>G0.986
rpoC764593c.1224C>T0.986
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T0.985
rpoC764716c.1347G>C0.986
rpoC764746c.1377G>T0.983
rpoC764752c.1383G>C0.983
rpoC764758c.1389C>G0.984
rpoC764764c.1395T>C0.968
rpoC764791c.1422C>G0.985
rpoC764803c.1434C>T0.984
rpoC764809c.1440C>T0.983
rpoC764810p.Pro481Ala0.983
rpoC764815c.1446A>G0.984
rpoC764824c.1455T>C0.984
rpoC764827c.1458G>C0.984
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C0.988
rpoC764968c.1599T>C0.987
rpoC765004c.1635G>T0.895
rpoC765007c.1638T>G0.895
rpoC765008c.1639T>C0.895
rpoC765011c.1642A>T0.895
rpoC765016c.1647C>G0.895
rpoC765019c.1650A>G0.900
rpoC765040c.1671T>C0.926
rpoC765041c.1672T>C0.926
rpoC765047c.1678T>C0.926
rpoC765055c.1686C>G0.926
rpoC765073c.1704G>C0.833
rpoC765076c.1707A>G0.833
rpoC765079c.1710T>G0.833
rpoC765082c.1713G>C0.833
rpoC765085c.1716T>C0.833
rpoC765089c.1720T>C0.833
rpoC765343c.1974G>A0.929
rpoC765352c.1983G>C0.929
rpoC765356p.Met663Val0.929
rpoC765370c.2001G>A0.955
rpoC765379c.2010G>C0.958
rpoC765382c.2013G>T0.958
rpoC765383p.Met672Leu0.960
rpoC765403c.2034G>C0.938
rpoC765405p.Leu679His0.938
rpoC765409c.2040T>G0.941
rpoC765421c.2052C>G0.979
rpoC765449p.Ala694Ser0.983
rpoC765454c.2085C>G0.984
rpoC765469c.2100G>C0.987
rpoC765478c.2109T>G0.985
rpoC765480p.Tyr704Phe0.985
rpoC765499c.2130C>G0.985
rpoC765517c.2148C>G0.983
rpoC765529c.2160C>T0.982
rpoC765533p.Tyr722His0.963
rpoC765544c.2175C>G0.939
rpoC765547c.2178C>T0.968
rpoC765548c.2179A>T0.968
rpoC765553c.2184C>T0.968
rpoC765556c.2187G>C0.968
rpoC765562c.2193G>C0.968
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765895c.2526G>A0.985
rpoC765907c.2538G>T0.984
rpoC765910c.2541G>C0.983
rpoC765928c.2559C>G0.978
rpoC765940c.2571A>T0.977
rpoC765947c.2578T>C0.976
rpoC765962c.2593T>C0.966
rpoC765967c.2598C>T0.966
rpoC765973c.2604C>G0.963
rpoC765979c.2610C>G0.960
rpoC765982c.2613C>T0.960
rpoC765994c.2625A>T0.941
rpoC766003c.2634G>C0.923
rpoC766321c.2952C>G0.875
rpoC766333c.2964G>T0.905
rpoC766345c.2976T>C0.905
rpoC766348c.2979A>G0.905
rpoC766351c.2982C>G0.900
rpoC766353p.Val995Ala0.905
rpoC766369c.3000C>G0.952
rpoC766375c.3006C>G0.953
rpoC766381c.3012C>T0.955
rpoC766384c.3015A>G0.955
rpoC766390c.3021C>T0.956
rpoC766393c.3024C>T0.979
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A0.938
rpoC766528c.3159T>G0.938
rpoC766531c.3162G>C0.938
rpoC766534c.3165C>G0.938
rpoC766537c.3168G>A0.941
rpoC766540p.Asp1057Glu0.947
rpoC766549c.3180G>C0.970
rpoC766570c.3201T>C0.970
rpoC766573c.3204T>G0.970
rpoC766588c.3219G>A0.970
rpoC766594c.3225G>T0.970
rpoC766607p.Ile1080Leu0.970
rpoC766618c.3249G>T0.970
rpoC766624c.3255G>C0.969
rpoC766630c.3261G>C0.935
rpoC766633c.3264G>C0.931
rpoC766642c.3273C>T0.909
rpoC766645c.3276A>G0.909
rpoC766792c.3423C>G0.885
rpoC766799p.Ala1144Ser0.885
rpoC766804c.3435A>G0.920
rpoC766837c.3468G>C0.920
rpoC766843c.3474T>G0.958
rpoC766846c.3477C>A0.958
rpoC766858c.3489C>T0.958
rpoC766861c.3492G>C0.958
rpoC766867c.3498C>G0.958
rpoC766876c.3507C>T0.958
rpoC766931p.Ala1188Ser0.964
rpoC766942c.3573C>T0.969
rpoC766945c.3576A>C0.970
rpoC766963c.3594T>C0.974
rpoC766996c.3627C>T0.979
rpoC767002c.3633G>C0.979
rpoC767008c.3639G>A0.979
rpoC767023c.3654C>T0.978
rpoC767044c.3675G>C0.987
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T0.988
rpoC767158c.3789T>C0.975
rpoC767179c.3810C>T0.974
rpoC767180p.Ala1271Ser0.974
rpoC767191c.3822C>G0.976
rpoC767197c.3828G>A0.976
rpoC767203c.3834C>G0.972
rpoC767206c.3837C>G0.957
rpoC767209c.3840T>C0.970
rpoC767212c.3843G>C0.973
rpoC767221c.3852C>G0.978
rpoC767230c.3861G>C0.978
rpoC767233c.3864T>C0.978
rpoC767254c.3885G>C0.978
rpoC767264p.Ala1299Ser0.956
rpoC767267p.Ala1300Asn0.971
rpoC767281c.3912C>G0.971
rpoC767284c.3915C>G0.971
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781751c.192G>C1.000
rpsL781754c.195G>T1.000
rpsL781760c.201T>C1.000
rpsL781763c.204C>G1.000
rpsL781766c.207C>T0.846
rpsL781772c.213C>T0.981
rpsL781802c.243G>C0.984
rpsL781814c.255C>T0.984
rpsL781817c.258G>T0.984
rpsL781829c.270G>C0.986
rpsL781832c.273T>C0.986
rpsL781859c.300T>C0.970
rpsL781868c.309T>C0.966
rpsL781871c.312G>C0.966
rpsL781877c.318T>A0.964
rpsL781892c.333A>G0.957
rpsL781898c.339A>T0.951
rpsL781907c.348T>C0.974
rpsL781916c.357T>C0.969
rpsL781929p.Gly124Ser0.964
rpsL781933374G>A0.963
rrs1471922r.77gt>g0.981
rrs1471925r.80t>c0.978
rrs1471931r.86ga>g0.979
rrs1471934r.89a>g0.979
rrs1471985r.140t>c0.959
rrs1471986r.141c>t0.959
rrs1472030r.185g>a0.909
rrs1472031r.186g>c0.909
rrs1472032r.187g>a0.909
rrs1472033r.188a>c0.909
rrs1472035r.190g>t0.909
rrs1472040r.195t>g0.909
rrs1472041r.196c>t0.909
rrs1472042r.197t>g0.909
rrs1472043r.198t>a0.909
rrs1472050r.205g>c0.909
rrs1472061r.216a>t0.967
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a0.955
rrs1472251r.406g>a0.938
rrs1472337r.492c>g0.971
rrs1472380r.535g>c0.980
rrs1472446r.601t>a0.975
rrs1472452r.607g>a0.974
rrs1472464r.619a>g0.974
rrs1472612r.767g>t0.955
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c0.964
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c0.951
rrs1472957r.1112c>t0.951
rrs1472969r.1124a>g0.931
rrs1472970r.1125c>g0.931
rrs1472977r.1132g>c0.931
rrs1472978r.1133t>c0.931
rrs1472989r.1144g>a0.946
rrs1472990r.1145a>g0.946
rrs1473082r.1237g>a0.977
rrs1473088r.1243a>g0.977
rrs1473099r.1254t>a0.971
rrs1473104r.1259c>t0.969
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.947
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473697r.40c>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a0.971
rrl1473923r.266c>g0.968
rrl1473937r.280c>t0.966
rrl1473943r.286g>t0.962
rrl1473945r.288t>a0.962
rrl1473946r.289a>t0.962
rrl1473950r.293g>t0.962
rrl1474074r.417c>t0.917
rrl1474089r.432c>t0.923
rrl1474093r.436g>a0.923
rrl1474100r.443c>t0.857
rrl1474103r.446a>c0.857
rrl1474130r.473c>t0.920
rrl1474140r.483c>t0.920
rrl1474151r.494c>t0.920
rrl1474184r.527c>a0.960
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.969
rrl1474282r.625g>a0.966
rrl1474306r.649a>c0.950
rrl1474308r.651g>t0.950
rrl1474310r.653t>g0.955
rrl1474356r.699t>c0.976
rrl1474362r.705a>g0.977
rrl1474387r.730c>t0.974
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.939
rrl1474497r.840g>c0.939
rrl1474506r.849c>g0.968
rrl1474507r.850g>c0.968
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c0.952
rrl1475061r.1404ca>c0.960
rrl1475076r.1419c>a0.963
rrl1475090r.1433a>t0.966
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a0.970
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t0.933
rrl1475479r.1822c>t0.933
rrl1475480r.1823a>t0.933
rrl1475505r.1848g>a0.933
rrl1475526r.1869c>a0.941
rrl1475531r.1874c>t0.941
rrl1475573r.1916g>a0.938
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.933
rrl1475977r.2320a>g0.933
rrl1475988r.2331a>g0.929
rrl1475989r.2332t>c0.929
rrl1475993r.2336c>t0.929
rrl1475997r.2340a>t0.929
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674855c.654C>G0.733
inhA1674858c.657G>A0.667
inhA1674876c.675C>T0.824
inhA1674879c.678T>C0.882
inhA1674892p.Asn231Asp0.824
inhA1674903c.702T>C0.882
inhA1674904p.Ala235Pro0.882
inhA1674909c.708G>A0.882
inhA1674912c.711G>C0.778
inhA1674915c.714C>G0.737
inhA1674942c.741T>C0.778
inhA1674949c.748C>T0.737
inhA1674954c.753G>C0.737
inhA1674957c.756G>C0.737
inhA1674963c.762G>C0.778
inhA1674966c.765T>C0.824
inhA1674975c.774C>T0.824
inhA1674977p.Tyr259Phe0.812
inhA1674993c.792G>T0.800
rpsA1833536c.-6A>C0.947
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A0.962
rpsA1833589c.48A>C0.978
rpsA1833595c.54T>G0.978
rpsA1833596p.Ser19Ala0.978
rpsA1833604c.63C>T0.983
rpsA1833616c.75A>T0.983
rpsA1833619c.78A>C0.984
rpsA1833625c.84A>G0.985
rpsA1833664c.123C>G0.972
rpsA1833676c.135A>G0.966
rpsA1833679c.138G>T0.966
rpsA1833685c.144G>C0.966
rpsA1833691c.150G>A0.965
rpsA1833694c.153G>T0.981
rpsA1833697c.156C>T0.963
rpsA1833700c.159C>T0.964
rpsA1833709c.168C>T0.969
rpsA1833724c.183C>T0.963
rpsA1833727c.186G>C0.962
rpsA1833733c.192C>G0.942
rpsA1833734p.Ala65Ser0.943
rpsA1833745c.204G>C0.964
rpsA1833748c.207C>G0.962
rpsA1833760c.219C>T0.965
rpsA1833787c.246C>G0.966
rpsA1833790c.249T>C0.967
rpsA1833802c.261A>G0.967
rpsA1833811c.270G>T0.968
rpsA1833823c.282G>A0.966
rpsA1833832c.291G>A0.964
rpsA1833835c.294C>T0.945
rpsA1833838c.297G>C0.945
rpsA1833841c.300C>G0.945
rpsA1833847c.306C>G0.966
rpsA1833862c.321G>T0.983
rpsA1833874c.333T>G0.983
rpsA1833877c.336C>G0.984
rpsA1833886c.345C>G0.984
rpsA1833894p.Ala118Glu0.984
rpsA1833928c.387G>C0.985
rpsA1833949c.408T>C0.986
rpsA1833958c.417C>T0.984
rpsA1833961c.420C>G0.984
rpsA1833970c.429G>T0.985
rpsA1833979c.438T>C0.984
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A0.985
rpsA1834231c.690T>G0.985
rpsA1834234c.693G>T0.985
rpsA1834240c.699T>C0.985
rpsA1834246c.705G>T0.985
rpsA1834249c.708T>C0.985
rpsA1834252c.711C>G0.985
rpsA1834261c.720A>G0.988
rpsA1834264c.723G>C0.977
rpsA1834279c.738C>T0.978
rpsA1834294c.753G>T0.977
rpsA1834297c.756C>T0.976
rpsA1834303c.762T>G0.964
rpsA1834306c.765T>C0.964
rpsA1834327c.786G>T0.965
rpsA1834348c.807T>C0.976
rpsA1834357c.816T>C0.975
rpsA1834366c.825A>G0.976
rpsA1834375c.834G>T0.976
rpsA1834396c.855G>C0.975
rpsA1834411c.870T>G0.970
rpsA1834414c.873C>T0.984
rpsA1834417c.876G>C0.985
rpsA1834423c.882G>C0.986
rpsA1834429c.888C>T0.986
rpsA1834438c.897C>T0.986
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834516c.975G>A0.985
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T0.965
rpsA1834555c.1014T>G0.982
rpsA1834557p.Ala339Gly0.982
rpsA1834606c.1065C>T0.972
rpsA1834609c.1068T>C0.971
rpsA1834619c.1078T>C0.964
rpsA1834622c.1081T>A0.957
rpsA1834633c.1092A>G0.968
rpsA1834639c.1098T>C0.970
rpsA1834645c.1104C>T0.972
rpsA1834666c.1125G>C0.985
rpsA1834667p.Ala376Ser0.986
rpsA1834690c.1149T>C0.987
rpsA1834700p.Gln387Ala0.984
rpsA1834705c.1164C>G0.984
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834747c.1206A>G1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp0.986
rpsA1834774c.1233C>T0.982
rpsA1834776p.Ala412Glu0.982
rpsA1834780c.1239A>G0.982
rpsA1834789c.1248T>C0.982
rpsA1834813c.1272G>T0.959
rpsA1834830p.Ala430Val0.950
kasA2518738c.624G>C0.903
kasA2518756c.642G>C0.925
kasA2518768c.654C>G0.933
kasA2518771c.657C>G0.933
kasA2518774c.660C>T0.933
kasA2518783c.669T>G0.955
kasA2518787p.Arg225Lys0.955
kasA2518792c.678C>T0.955
kasA2518795c.681C>T0.955
kasA2518798c.684G>C0.957
kasA2518822c.708C>A0.971
kasA2518825c.711T>C0.957
kasA2518846c.732G>T0.969
kasA2518849c.735G>C0.968
kasA2518853p.Leu247Val0.984
kasA2518864c.750G>C0.982
panD4044150c.132T>G0.818
panD4044156c.126T>C0.818
panD4044167c.115G>A0.818
panD4044171c.111G>A0.818
panD4044174c.108G>A0.818
panD4044180p.Asp34Glu0.818
panD4044188c.94C>G0.818
panD4044189c.93G>A0.818
panD4044194p.Ala30Pro0.818
panD4044195c.87A>G0.818
panD4044219c.63G>A0.818
panD4044233p.Cys17His0.900
panD4044234c.48G>C0.900
panD4044240c.42C>G0.900
panD4044249c.33G>A0.900
embC4240729c.867C>G0.985
embC4240735c.873C>G0.986
embC4240741c.879C>T0.974
embC4240756c.894G>C0.975
embC4240771c.909G>C0.970
embC4240772p.Ser304Ala0.970
embC4240778p.His306Gly0.968
embC4240781p.Ala307Ser0.968
embC4240789c.927T>C0.977
embC4240819c.957A>C0.976
embC4240826p.Ala322Ser0.976
embC4240831c.969T>G0.987
embC4240856p.Ala332Thr0.978
embC4240859p.Leu333Ile0.978
embC4240876c.1014C>T0.974
embC4240879c.1017G>T0.972
embC4240885c.1023T>C0.969
embC4240886p.Ile342Val0.969
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248208p.Ser565Arg0.909
embB4248220c.1707A>G0.969
embB4248226c.1713G>C0.970
embB4248232c.1719G>T0.971
embB4248233p.Leu574Val0.971
embB4248236p.Met575Leu0.973
embB4248245p.Ile578Val0.980
embB4248250c.1737C>T0.981
embB4248259p.Met582Ile0.982
embB4248275p.Thr588Ala0.982
embB4248292c.1779G>A0.982

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;