TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d809ee531062
Sample: 5d809ee531062

Download results

Summary
ID: 5d809ee531062
Date: Tue Sep 17 10:46:02 2019
Strain: lineage2.2.1;lineage4.3
Drug-resistance: Drug-resistant

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
StreptomycinRrrs r.462c>t (0.13)
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6115c.876A>G0.207
gyrB6121c.882C>T0.142
gyrB6127c.888G>C0.220
gyrB6133c.894G>C0.125
gyrB6136c.897G>A0.212
gyrB6151c.912C>T0.118
gyrB6172c.933C>T0.133
gyrB6184c.945C>T0.139
gyrB6238c.999G>A0.126
gyrB6242p.Arg335Lys0.120
gyrB6250c.1011A>G0.167
gyrB6256c.1017G>A0.133
gyrB6268c.1029C>G0.131
gyrB6280c.1041T>C0.122
gyrB6292c.1053G>C0.114
gyrB6307c.1068T>G0.118
gyrB6673c.1434A>C0.127
gyrB6676c.1437T>G0.150
gyrB6700c.1461T>C0.165
gyrB6703c.1464G>C0.165
gyrB6709c.1470A>G0.140
gyrB6712c.1473G>C0.137
gyrB6728c.1489C>T0.179
gyrB6739c.1500C>T0.158
gyrB6745c.1506T>C0.198
gyrB6754c.1515C>T0.178
gyrB6763c.1524G>C0.270
gyrB6775c.1536G>C0.279
gyrB6793c.1554T>C0.283
gyrB6798p.Gly520Ala0.284
gyrB6808c.1569C>G0.217
gyrB6824c.1585C>T0.200
gyrB6838c.1599C>T0.174
gyrB6841c.1602T>C0.221
gyrB6862c.1623C>G0.188
gyrB6869c.1630T>C0.148
gyrB6872c.1633T>C0.134
gyrB6878c.1639T>C0.132
gyrB7015c.1776G>A0.124
gyrB7033c.1794G>C0.152
gyrB7051p.Glu604Asp0.135
gyrB7084c.1845A>G0.141
gyrB7090c.1851C>T0.149
gyrB7093c.1854T>C0.118
gyrB7178c.1939T>C0.105
gyrB7186c.1947C>G0.106
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T0.162
gyrA7394c.93T>C0.158
gyrA7412c.111C>G0.114
gyrA7442c.141G>C0.107
gyrA7499c.198G>C0.155
gyrA7511c.210C>T0.167
gyrA7523c.222C>G0.209
gyrA7526c.225G>C0.156
gyrA7547c.246C>T0.219
gyrA7559c.258G>C0.167
gyrA7565c.264C>T0.169
gyrA7574c.273G>C0.196
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.174
gyrA7595c.294C>T0.180
gyrA7607c.306C>T0.171
gyrA7637c.336C>A0.144
gyrA8121c.820T>C0.165
gyrA8129c.828T>C0.154
gyrA8156c.855T>C0.194
gyrA8168c.867A>G0.179
gyrA8177c.876A>C0.196
gyrA8198c.897T>C0.193
gyrA8207c.906T>C0.200
gyrA8219c.918T>C0.122
gyrA8225c.924T>C0.119
gyrA8234c.933T>C0.108
gyrA8237c.936A>G0.106
gyrA8249p.Ile316Met0.104
gyrA8267c.966G>C0.238
gyrA8283p.Ile328Leu0.277
gyrA8288c.987T>C0.277
gyrA8294c.993T>C0.295
gyrA8327c.1026C>T0.222
gyrA8330c.1029C>G0.299
gyrA8339c.1038A>G0.302
gyrA8340p.Ala347Ser0.302
gyrA8354c.1053G>C0.212
gyrA8366c.1065G>A0.190
gyrA8372c.1071G>T0.207
gyrA8382c.1081C>T0.139
gyrA8393c.1092T>C0.117
gyrA8420c.1119T>C0.168
gyrA8442c.1141C>T0.161
gyrA8453c.1152A>C0.158
gyrA8462c.1161A>T0.128
gyrA8465c.1164C>G0.127
gyrA8471c.1170T>C0.126
gyrA8472c.1171C>T0.127
gyrA8486c.1185T>C0.148
gyrA8516c.1215T>C0.124
gyrA8519c.1218A>C0.117
gyrA8520c.1219C>T0.116
gyrA8528c.1227G>C0.110
gyrA8543c.1242C>G0.152
gyrA8546c.1245T>C0.152
gyrA8552c.1251C>A0.153
gyrA8561c.1260A>G0.161
gyrA8576c.1275C>G0.211
gyrA8579c.1278C>T0.140
gyrA8588c.1287G>A0.176
gyrA8597c.1296C>G0.176
gyrA8603c.1302A>G0.193
gyrA8619c.1318T>C0.250
gyrA8624c.1323G>C0.207
gyrA8636c.1335A>C0.233
gyrA8642c.1341A>G0.287
gyrA8672c.1371A>G0.255
gyrA8693c.1392T>C0.149
gyrA8696c.1395G>C0.125
gyrA8699c.1398A>G0.125
gyrA8711c.1410A>C0.124
gyrA8714c.1413A>G0.113
gyrA8852c.1551T>C0.138
gyrA8858c.1557T>C0.179
gyrA8870c.1569G>C0.234
gyrA8873c.1572A>G0.168
gyrA8891c.1590G>A0.116
gyrA8897c.1596T>C0.306
gyrA8903c.1602T>C0.322
gyrA8915c.1614A>G0.233
gyrA8924c.1623C>T0.211
gyrA8933c.1632G>C0.122
gyrA8942c.1641G>C0.298
gyrA8945c.1644G>C0.190
gyrA8946c.1645T>C0.298
gyrA8967p.Ala556Lys0.178
gyrA8978c.1677C>T0.174
gyrA8987c.1686C>G0.230
gyrA8990c.1689C>G0.230
gyrA8993c.1692C>T0.147
gyrA8996c.1695T>C0.216
gyrA8998p.Leu566Trp0.219
gyrA9304p.Gly668Asp1.000
rpoB759343c.-464C>G0.989
rpoB759606c.-201T>C0.124
rpoB760079c.273G>A0.144
rpoB760091c.285G>C0.275
rpoB760101c.295T>C0.292
rpoB760110c.304T>A0.195
rpoB760118c.312T>G0.284
rpoB760121c.315T>C0.297
rpoB760130p.Asp108Glu0.337
rpoB760139c.333A>G0.320
rpoB760142c.336C>T0.256
rpoB760181c.375T>C0.355
rpoB760184c.378A>G0.342
rpoB760196c.390C>G0.355
rpoB760223c.417T>C0.113
rpoB760235c.429T>C0.323
rpoB760244c.438G>C0.211
rpoB760256c.450C>T0.204
rpoB760274p.Glu156Asp0.146
rpoB760276p.Lys157Met0.148
rpoB760283c.477G>C0.247
rpoB760298c.492G>C0.198
rpoB760307c.501T>C0.202
rpoB760361c.555T>C0.155
rpoB760370c.564C>G0.182
rpoB760376p.Asp190Glu0.184
rpoB760382c.576G>C0.114
rpoB760400c.594G>C0.117
rpoB760406c.600G>C0.179
rpoB760415c.609C>T0.119
rpoB760418c.612G>C0.127
rpoB760430c.624T>C0.211
rpoB760460c.654G>C0.175
rpoB760475c.669A>G0.271
rpoB760481c.675G>T0.234
rpoB760484c.678A>G0.279
rpoB760499c.693G>A0.198
rpoB760502c.696C>G0.210
rpoB760522p.Ser239Asn0.292
rpoB760532c.726T>C0.305
rpoB760541c.735G>C0.297
rpoB760553c.747C>G0.242
rpoB760567p.Ser254Trp0.128
rpoB760571c.765G>C0.128
rpoB760588p.Thr261Ile0.165
rpoB760591p.Val262Ala0.273
rpoB760595c.789C>T0.165
rpoB760596p.Thr264Pro0.176
rpoB760608c.802C>T0.236
rpoB760611c.805T>C0.345
rpoB760634c.828T>C0.235
rpoB760646c.840C>G0.291
rpoB760655c.849A>G0.256
rpoB760661c.855A>G0.212
rpoB760668p.Thr288Ala0.167
rpoB760674c.868T>C0.214
rpoB760679c.873A>G0.217
rpoB760683c.877T>C0.221
rpoB760703c.897C>T0.157
rpoB760721c.915C>G0.129
rpoB760727c.921C>G0.122
rpoB760730c.924T>C0.157
rpoB760736c.930C>G0.119
rpoB760805c.999G>C0.115
rpoB760817c.1011A>G0.112
rpoB760820c.1014T>C0.112
rpoB760826c.1020C>G0.141
rpoB760830c.1024T>C0.163
rpoB760841c.1035T>C0.188
rpoB760858p.Val351Ala0.139
rpoB760862c.1056G>C0.167
rpoB760886p.Glu360Asp0.165
rpoB760887p.Thr361Val0.158
rpoB760910c.1104C>T0.156
rpoB760916c.1110C>T0.147
rpoB760928c.1122G>C0.238
rpoB760946c.1140A>G0.229
rpoB760970c.1164G>C0.124
rpoB760985c.1179G>C0.190
rpoB760991c.1185G>C0.210
rpoB760997c.1191G>C0.183
rpoB761006c.1200C>G0.268
rpoB761015c.1209G>C0.339
rpoB761027c.1221A>C0.279
rpoB761036c.1230G>C0.392
rpoB761037c.1231T>C0.385
rpoB761051c.1245G>T0.252
rpoB761054c.1248G>C0.260
rpoB761060c.1254C>G0.291
rpoB761063c.1257C>G0.268
rpoB761084c.1278C>A0.298
rpoB761097c.1291A>T0.252
rpoB761102c.1296A>G0.362
rpoB761132c.1326G>T0.264
rpoB761133c.1327T>C0.258
rpoB761147c.1341C>T0.147
rpoB761150c.1344A>T0.157
rpoB761165c.1359G>C0.236
rpoB761171c.1365C>T0.126
rpoB761178p.Ser458Thr0.111
rpoB761189c.1383T>C0.178
rpoB761195c.1389G>C0.175
rpoB761219c.1413G>C0.190
rpoB761231c.1425C>T0.129
rpoB761234c.1428G>T0.137
rpoB761249c.1443A>G0.215
rpoB761255c.1449T>G0.205
rpoB761258c.1452G>A0.130
rpoB761261c.1455G>C0.147
rpoB761264c.1458C>G0.134
rpoB761273c.1467T>C0.190
rpoB761297c.1491C>T0.179
rpoB761318c.1512G>C0.148
rpoB761327c.1521A>G0.184
rpoB761339c.1533C>G0.123
rpoB761360c.1554T>C0.125
rpoB761362p.Ser519Thr0.124
rpoB761375c.1569G>C0.113
rpoB761528c.1722C>T0.145
rpoB761537c.1731C>G0.250
rpoB761555c.1749G>C0.198
rpoB761558c.1752C>G0.195
rpoB761564c.1758G>C0.214
rpoB761573c.1767C>G0.303
rpoB761579c.1773G>C0.351
rpoB761588c.1782C>T0.114
rpoB761606c.1800C>G0.386
rpoB761612c.1806G>T0.305
rpoB761615c.1809A>C0.395
rpoB761636c.1830G>T0.398
rpoB761645c.1839C>G0.377
rpoB761648c.1842T>C0.374
rpoB761657c.1851C>T0.296
rpoB761669c.1863C>T0.208
rpoB761675c.1869G>C0.315
rpoB761687c.1881C>T0.143
rpoB761690c.1884G>C0.142
rpoB761693c.1887G>C0.133
rpoB761705c.1899C>A0.113
rpoB761747c.1941G>C0.116
rpoB761750c.1944G>C0.146
rpoB761765c.1959T>C0.152
rpoB761772p.His656Ala0.146
rpoB761778p.Asn658Asp0.157
rpoB761791p.Arg662His0.149
rpoB761813c.2007T>C0.105
rpoB761834c.2028T>C0.107
rpoB761891c.2085G>C0.133
rpoB761892p.Ile696Val0.124
rpoB761909c.2103T>C0.255
rpoB761912c.2106T>C0.255
rpoB761915p.Asp703Glu0.248
rpoB761916p.Asp704Asn0.248
rpoB761924c.2118G>A0.160
rpoB761930c.2124G>C0.174
rpoB761933c.2127G>C0.174
rpoB761936c.2130C>T0.167
rpoB761948c.2142G>C0.285
rpoB761954c.2148C>A0.222
rpoB761955p.Ile717Val0.212
rpoB761969c.2163G>A0.245
rpoB761990c.2184G>C0.255
rpoB762008c.2202C>T0.295
rpoB762014c.2208C>G0.231
rpoB762038c.2232C>T0.206
rpoB762047c.2241G>A0.194
rpoB762053c.2247T>C0.258
rpoB762056c.2250G>A0.183
rpoB762065c.2259T>G0.155
rpoB762083c.2277T>C0.237
rpoB762086c.2280G>C0.237
rpoB762101c.2295C>G0.228
rpoB762114p.Ile770Val0.191
rpoB762122c.2316C>T0.106
rpoB762131c.2325C>G0.196
rpoB762134c.2328C>A0.126
rpoB762140c.2334G>C0.194
rpoB762143c.2337T>C0.207
rpoB762158c.2352G>C0.126
rpoB762167c.2361T>C0.216
rpoB762176c.2370T>C0.209
rpoB762185c.2379G>C0.239
rpoB762194c.2388G>C0.149
rpoB762233c.2427G>C0.318
rpoB762236c.2430G>C0.181
rpoB762239c.2433G>A0.179
rpoB762245c.2439G>C0.194
rpoB762254c.2448T>C0.214
rpoB762284c.2478G>T0.185
rpoB762293c.2487T>C0.250
rpoB762296c.2490G>C0.145
rpoB762314c.2508C>T0.194
rpoB762317c.2511A>G0.207
rpoB762323c.2517C>A0.135
rpoB762329c.2523G>C0.217
rpoB762338c.2532T>C0.124
rpoB762347c.2541T>C0.115
rpoB762362p.Glu852Asp0.126
rpoB762369c.2563T>C0.111
rpoB762398c.2592T>C0.157
rpoB762401c.2595G>C0.118
rpoB762404c.2598T>C0.155
rpoB762410c.2604T>G0.162
rpoB762416c.2610A>G0.200
rpoB762434c.2628T>C0.117
rpoB762449c.2643C>A0.212
rpoB762452c.2646G>C0.117
rpoB762470c.2664G>C0.125
rpoB762488c.2682G>C0.178
rpoB762491c.2685T>C0.117
rpoB762509c.2703T>G0.152
rpoB762510p.Ala902Pro0.151
rpoB762533c.2727T>C0.112
rpoB762536c.2730T>C0.113
rpoB762537c.2731T>C0.113
rpoB762827c.3021G>C0.225
rpoB762857c.3051C>G0.267
rpoB762860c.3054G>C0.246
rpoB762863c.3057T>C0.240
rpoB762866c.3060C>T0.159
rpoB762879p.Met1025Leu0.188
rpoB762894c.3088C>T0.198
rpoB762899c.3093G>C0.224
rpoB762917c.3111C>G0.221
rpoB762920c.3114C>T0.229
rpoB762923c.3117C>G0.241
rpoB762929c.3123G>C0.363
rpoB762959c.3153G>C0.234
rpoB762962c.3156C>T0.250
rpoB762989c.3183G>C0.121
rpoB762995c.3189G>T0.379
rpoB763013c.3207C>G0.124
rpoB763028c.3222T>C0.126
rpoB763031c.3225T>C0.327
rpoB763034c.3228C>G0.327
rpoB763040c.3234C>G0.333
rpoB763070c.3264T>C0.294
rpoB763082c.3276C>T0.173
rpoB763088c.3282C>G0.173
rpoB763094c.3288G>C0.193
rpoB763115c.3309T>C0.298
rpoB763127c.3321G>C0.147
rpoB763136c.3330C>T0.255
rpoB763145c.3339G>A0.127
rpoB763157c.3351G>T0.118
rpoB763166c.3360A>G0.234
rpoB763172c.3366G>C0.118
rpoB763190c.3384C>T0.133
rpoB763193c.3387C>G0.112
rpoB763202c.3396A>G0.141
rpoB763205c.3399G>C0.139
rpoB763206c.3400A>T0.153
rpoB763214c.3408T>C0.176
rpoB763226c.3420A>G0.177
rpoB763227c.3421C>T0.150
rpoB763238c.3432T>C0.193
rpoB763253c.3447G>C0.105
rpoC763351c.-19T>C0.117
rpoC763352c.-18T>A0.123
rpoC763402c.33C>G0.124
rpoC763411c.42T>G0.133
rpoC763414c.45T>C0.140
rpoC763441c.72C>T0.112
rpoC763444c.75T>C0.169
rpoC763450c.81G>A0.116
rpoC763456c.87A>G0.250
rpoC763468c.99G>C0.162
rpoC763486c.117T>C0.194
rpoC763492c.123G>C0.236
rpoC763528c.159G>A0.238
rpoC763531c.162G>T0.160
rpoC763546c.177A>G0.306
rpoC763570c.201G>C0.336
rpoC763573c.204G>C0.122
rpoC763594c.225C>T0.370
rpoC763609c.240C>T0.244
rpoC763621c.252C>T0.272
rpoC763633c.264T>C0.314
rpoC763657c.288G>A0.350
rpoC763660c.291T>G0.357
rpoC763666c.297G>C0.258
rpoC763669c.300C>G0.254
rpoC763675c.306C>G0.353
rpoC763696c.327T>C0.262
rpoC763699c.330G>T0.171
rpoC763702c.333C>G0.248
rpoC763708c.339G>C0.175
rpoC763711c.342G>C0.163
rpoC763714c.345G>C0.168
rpoC763717c.348T>C0.269
rpoC763723c.354G>C0.252
rpoC763732c.363C>G0.255
rpoC763741c.372C>T0.221
rpoC763744c.375G>C0.191
rpoC763747c.378G>A0.120
rpoC763765c.396T>C0.140
rpoC763891c.522G>C0.111
rpoC763894c.525A>G0.115
rpoC763900c.531G>C0.155
rpoC763945c.576T>C0.179
rpoC763951c.582G>C0.182
rpoC763987c.618C>T0.113
rpoC764024c.655T>C0.121
rpoC764040p.Ser224Thr0.173
rpoC764044c.675T>C0.175
rpoC764059c.690G>T0.193
rpoC764083c.714A>G0.208
rpoC764084p.Asn239Val0.124
rpoC764098c.729A>G0.198
rpoC764110c.741C>T0.137
rpoC764150p.Ile261Val0.103
rpoC764236c.867G>A0.105
rpoC764248c.879C>G0.106
rpoC764257c.888G>C0.103
rpoC764266c.897T>C0.102
rpoC764338c.969G>A0.198
rpoC764353c.984G>T0.144
rpoC764362c.993C>T0.126
rpoC764365c.996C>T0.210
rpoC764371c.1002G>C0.130
rpoC764377c.1008C>G0.147
rpoC764380c.1011G>C0.212
rpoC764387c.1018T>C0.223
rpoC764405c.1036A>C0.236
rpoC764428c.1059G>T0.138
rpoC764431c.1062G>C0.198
rpoC764434c.1065A>G0.189
rpoC764435c.1066A>C0.117
rpoC764452c.1083T>C0.232
rpoC764458c.1089G>C0.232
rpoC764461c.1092A>G0.232
rpoC764497c.1128A>G0.247
rpoC764509c.1140G>A0.181
rpoC764510c.1141C>T0.210
rpoC764521c.1152T>C0.206
rpoC764527c.1158C>T0.194
rpoC764530c.1161C>T0.161
rpoC764533c.1164C>A0.163
rpoC764536c.1167G>T0.163
rpoC764539c.1170C>G0.172
rpoC764545c.1176C>A0.221
rpoC764575c.1206T>G0.259
rpoC764593c.1224C>T0.248
rpoC764611c.1242G>T0.275
rpoC764626c.1257C>T0.193
rpoC764632c.1263T>C0.189
rpoC764650c.1281G>T0.177
rpoC764668c.1299C>T0.140
rpoC764683c.1314G>A0.157
rpoC764713c.1344G>T0.144
rpoC764716c.1347G>C0.147
rpoC764746c.1377G>T0.130
rpoC764752c.1383G>C0.194
rpoC764758c.1389C>G0.141
rpoC764764c.1395T>C0.189
rpoC764791c.1422C>G0.215
rpoC764803c.1434C>T0.224
rpoC764809c.1440C>T0.268
rpoC764810p.Pro481Ala0.224
rpoC764815c.1446A>G0.274
rpoC764824c.1455T>C0.209
rpoC764827c.1458G>C0.263
rpoC764858c.1489T>C0.263
rpoC764869c.1500C>T0.212
rpoC764875c.1506C>A0.235
rpoC764887c.1518G>C0.245
rpoC764888c.1519T>C0.363
rpoC764911c.1542A>G0.331
rpoC764912p.Met515Gln0.215
rpoC764932c.1563C>A0.350
rpoC764948c.1579T>C0.344
rpoC764968c.1599T>C0.339
rpoC764995c.1626C>G0.126
rpoC765007c.1638T>G0.125
rpoC765008c.1639T>C0.125
rpoC765011c.1642A>T0.124
rpoC765019c.1650A>G0.154
rpoC765034c.1665T>C0.160
rpoC765040c.1671T>C0.136
rpoC765041c.1672T>C0.137
rpoC765047c.1678T>C0.139
rpoC765055c.1686C>G0.134
rpoC765292c.1923G>C0.124
rpoC765298c.1929G>C0.127
rpoC765300p.Val644Ala0.127
rpoC765319c.1950A>G0.150
rpoC765326p.His653Ala0.147
rpoC765330p.Ser654Asn0.143
rpoC765346c.1977C>G0.106
rpoC765352c.1983G>C0.178
rpoC765370c.2001G>A0.160
rpoC765379c.2010G>C0.163
rpoC765382c.2013G>T0.163
rpoC765383p.Met672Leu0.281
rpoC765403c.2034G>C0.204
rpoC765404p.Leu679Asp0.119
rpoC765409c.2040T>G0.259
rpoC765421c.2052C>G0.404
rpoC765449p.Ala694Ser0.315
rpoC765454c.2085C>G0.330
rpoC765469c.2100G>C0.316
rpoC765478c.2109T>G0.356
rpoC765480p.Tyr704Phe0.330
rpoC765499c.2130C>G0.354
rpoC765517c.2148C>G0.209
rpoC765529c.2160C>T0.247
rpoC765533p.Tyr722His0.182
rpoC765553c.2184C>T0.134
rpoC765556c.2187G>C0.132
rpoC765700c.2331T>C0.140
rpoC765734c.2365T>C0.116
rpoC765784c.2415C>G0.124
rpoC765793c.2424C>G0.126
rpoC765796c.2427C>T0.140
rpoC765811c.2442T>C0.151
rpoC765814c.2445A>G0.149
rpoC765826c.2457T>C0.153
rpoC765835c.2466C>T0.231
rpoC765841c.2472G>T0.143
rpoC765850c.2481G>C0.124
rpoC765861p.Phe831Tyr0.171
rpoC765875p.Val836Ile0.200
rpoC765883c.2514C>G0.119
rpoC765886c.2517C>G0.120
rpoC765892c.2523T>C0.125
rpoC765895c.2526G>A0.207
rpoC765907c.2538G>T0.195
rpoC765910c.2541G>C0.182
rpoC765928c.2559C>G0.157
rpoC765940c.2571A>T0.143
rpoC765947c.2578T>C0.206
rpoC765967c.2598C>T0.159
rpoC765994c.2625A>T0.147
rpoC766021c.2652G>C0.119
rpoC766096c.2727G>C0.127
rpoC766321c.2952C>G0.123
rpoC766345c.2976T>C0.234
rpoC766348c.2979A>G0.239
rpoC766351c.2982C>G0.150
rpoC766354c.2985C>G0.130
rpoC766369c.3000C>G0.198
rpoC766375c.3006C>G0.198
rpoC766381c.3012C>T0.312
rpoC766384c.3015A>G0.316
rpoC766390c.3021C>T0.298
rpoC766393c.3024C>T0.245
rpoC766408c.3039C>T0.286
rpoC766426c.3057C>T0.125
rpoC766435p.Glu1022Asp0.234
rpoC766447c.3078T>C0.116
rpoC766462c.3093G>C0.112
rpoC766531c.3162G>C0.157
rpoC766540p.Asp1057Glu0.183
rpoC766549c.3180G>C0.243
rpoC766570c.3201T>C0.163
rpoC766573c.3204T>G0.185
rpoC766594c.3225G>T0.195
rpoC766597c.3228C>G0.116
rpoC766607p.Ile1080Leu0.286
rpoC766618c.3249G>T0.126
rpoC766624c.3255G>C0.131
rpoC766630c.3261G>C0.204
rpoC766657c.3288A>G0.138
rpoC766726c.3357T>C0.170
rpoC766738c.3369G>C0.146
rpoC766765c.3396A>C0.151
rpoC766774c.3405T>C0.163
rpoC766801c.3432C>G0.128
rpoC766804c.3435A>G0.145
rpoC766861c.3492G>C0.115
rpoC766864c.3495G>C0.137
rpoC766931p.Ala1188Ser0.138
rpoC766942c.3573C>T0.153
rpoC766945c.3576A>C0.169
rpoC766963c.3594T>C0.269
rpoC766975c.3606C>T0.198
rpoC766996c.3627C>T0.295
rpoC767002c.3633G>C0.224
rpoC767008c.3639G>A0.241
rpoC767023c.3654C>T0.259
rpoC767044c.3675G>C0.257
rpoC767080c.3711G>C0.227
rpoC767098c.3729T>C0.317
rpoC767104c.3735C>G0.198
rpoC767107c.3738C>T0.200
rpoC767119c.3750A>G0.322
rpoC767125c.3756G>C0.207
rpoC767134c.3765C>T0.235
rpoC767138c.3769C>T0.189
rpoC767149c.3780C>T0.217
rpoC767158c.3789T>C0.314
rpoC7671801271A>1271*0.217
rpoC767191c.3822C>G0.287
rpoC767197c.3828G>A0.177
rpoC767203c.3834C>G0.156
rpoC767206c.3837C>G0.244
rpoC767209c.3840T>C0.241
rpoC767212c.3843G>C0.241
rpoC767221c.3852C>G0.256
rpoC767230c.3861G>C0.244
rpoC767233c.3864T>C0.262
rpoC767254c.3885G>C0.163
rpoC767264p.Ala1299Ser0.128
rpoC767267p.Ala1300Asn0.120
rpoC767281c.3912C>G0.155
rpoC767284c.3915C>G0.123
rpsL781395c.-165T>C1.000
rpsL781595c.36T>C0.186
rpsL781608p.Ser17Ala0.206
rpsL781616c.57C>G0.150
rpsL781628c.69T>C0.313
rpsL781631c.72G>C0.155
rpsL781649c.90T>C0.336
rpsL781655c.96T>C0.324
rpsL781658c.99A>C0.186
rpsL781670c.111G>C0.167
rpsL781682c.123T>C0.140
rpsL781700c.141G>C0.135
rpsL781703c.144G>T0.137
rpsL781706c.147T>C0.129
rpsL781715c.156T>C0.159
rpsL781728c.169T>C0.144
rpsL781736c.177T>C0.132
rpsL781742c.183C>T0.119
rpsL781748c.189C>G0.117
rpsL781760c.201T>C0.121
rpsL781802c.243G>C0.147
rpsL781814c.255C>T0.162
rpsL781817c.258G>T0.155
rpsL781829c.270G>C0.157
rpsL781832c.273T>C0.236
rpsL781859c.300T>C0.163
rpsL781868c.309T>C0.228
rpsL781871c.312G>C0.223
rpsL781877c.318T>A0.167
rpsL781892c.333A>G0.206
rpsL781898c.339A>T0.202
rpsL781916c.357T>C0.200
rpsL781929p.Gly124Ser0.183
rrs1471922r.77gt>g0.289
rrs1471923r.78t>c0.127
rrs1471925r.80t>c0.342
rrs1471932r.87a>g0.125
rrs1471934r.89a>g0.348
rrs1471985r.140t>c0.211
rrs1471986r.141c>t0.214
rrs1472030r.185g>a0.136
rrs1472031r.186g>c0.119
rrs1472032r.187g>a0.129
rrs1472033r.188a>c0.115
rrs1472035r.190g>t0.103
rrs1472061r.216a>t0.306
rrs1472106r.261g>a0.226
rrs1472108r.263c>t0.308
rrs1472113r.268t>c0.247
rrs1472150r.305t>a0.284
rrs1472251r.406g>a0.229
rrs1472337r.492c>g0.122
rrs1472380r.535g>c0.216
rrs1472446r.601t>a0.236
rrs1472452r.607g>a0.227
rrs1472464r.619a>g0.224
rrs1472612r.767g>t0.167
rrs1472734r.889c>t0.228
rrs1472741r.896g>a0.225
rrs1472846r.1001c>t0.236
rrs1472847r.1002g>a0.244
rrs1472860r.1015c>t0.242
rrs1472861r.1016g>a0.242
rrs1472956r.1111t>c0.221
rrs1472957r.1112c>t0.221
rrs1472969r.1124a>g0.390
rrs1472970r.1125c>g0.397
rrs1472977r.1132g>c0.390
rrs1472978r.1133t>c0.390
rrs1472989r.1144g>a0.242
rrs1472990r.1145a>g0.246
rrs1473082r.1237g>a0.197
rrs1473088r.1243a>g0.203
rrs1473099r.1254t>a0.151
rrs1473104r.1259c>t0.147
rrs1473105r.1260g>a0.392
rrs1473110r.1265t>g0.147
rrs1473111r.1266a>g0.147
rrs1473121r.1276t>c0.176
rrs1473123r.1278a>t0.392
rrs1473129r.1284c>t0.160
rrs1473145r.1300c>t0.419
rrs1473166r.1321g>a0.410
rrs1473288r.1443c>t0.128
rrs1473290r.1445c>t0.231
rrs1473291r.1446g>t0.128
rrl1473707r.50t>a0.103
rrl1473717r.60g>a0.111
rrl1473731r.74t>a0.114
rrl1473746r.89t>c0.158
rrl1473756r.99g>t0.189
rrl1473758r.101g>t0.250
rrl1473770r.113t>c0.170
rrl1473806r.149c>t0.300
rrl1473812r.155g>a0.161
rrl1473814r.157a>t0.153
rrl1473815r.158t>g0.155
rrl1473829r.172g>c0.171
rrl1473831r.174g>t0.171
rrl1473832r.175c>t0.167
rrl1473839r.182g>a0.213
rrl1473876r.219g>a0.207
rrl1473877r.220g>a0.126
rrl1473887r.230t>c0.190
rrl1473888r.231t>c0.177
rrl1473898r.241c>t0.310
rrl1473899r.242a>g0.146
rrl1473916r.259c>a0.141
rrl1473923r.266c>g0.148
rrl1473937r.280c>t0.147
rrl1473943r.286g>t0.236
rrl1473945r.288t>a0.222
rrl1473946r.289a>t0.222
rrl1473950r.293g>t0.107
rrl1473986r.329t>c0.132
rrl1473987r.330g>a0.130
rrl1473995r.338g>t0.143
rrl1474001r.344c>t0.152
rrl1474009r.352a>g0.143
rrl1474012r.355c>t0.131
rrl1474074r.417c>t0.127
rrl1474089r.432c>t0.122
rrl1474093r.436g>t0.154
rrl1474099r.442g>a0.139
rrl1474100r.443c>t0.129
rrl1474103r.446a>t0.183
rrl1474130r.473c>t0.195
rrl1474140r.483c>t0.337
rrl1474151r.494c>t0.337
rrl1474181r.524c>t0.138
rrl1474184r.527c>a0.212
rrl1474249r.592g>t0.368
rrl1474263r.606g>a0.205
rrl1474282r.625g>a0.185
rrl1474291r.634tttcctctccggagga>t0.321
rrl1474308r.651g>t0.275
rrl1474310r.653t>g0.275
rrl1474356r.699t>c0.352
rrl1474362r.705a>g0.338
rrl1474387r.730c>t0.209
rrl1474413r.756a>c0.200
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c0.210
rrl1474496r.839c>g0.159
rrl1474497r.840g>c0.159
rrl1474506r.849c>g0.186
rrl1474507r.850g>c0.169
rrl1474626r.969t>c0.186
rrl1474632r.975g>t0.179
rrl1474636r.979a>t0.150
rrl1474637r.980c>t0.150
rrl1474638r.981c>g0.150
rrl1474639r.982g>a0.196
rrl1474640r.983c>t0.150
rrl1474717r.1060a>g0.206
rrl1474722r.1065t>c0.229
rrl1474743r.1086t>g0.250
rrl1474760r.1103a>g0.263
rrl1474794r.1137c>t0.342
rrl1474803r.1146g>a0.293
rrl1474812r.1155g>a0.333
rrl1474830r.1173a>g0.263
rrl1474904r.1247g>a0.121
rrl1474913r.1256t>c0.262
rrl1474932r.1275c>t0.254
rrl1474956r.1299c>t0.159
rrl1474960r.1303c>g0.133
rrl1474963r.1306g>t0.128
rrl1474964r.1307t>a0.125
rrl1474965r.1308g>c0.130
rrl1474970r.1313g>a0.149
rrl1475006r.1349a>t0.179
rrl1475031r.1374g>c0.286
rrl1475061r.1404c>t0.111
rrl1475061r.1404ca>c0.328
rrl1475076r.1419c>a0.329
rrl1475090r.1433a>t0.314
rrl1475114r.1457c>t0.257
rrl1475120r.1463g>t0.239
rrl1475129r.1472g>a0.230
rrl1475199r.1542g>a0.117
rrl1475202r.1545g>c0.186
rrl1475206r.1549c>t0.125
rrl1475209r.1552g>a0.196
rrl1475213r.1556c>t0.302
rrl1475220r.1563g>t0.130
rrl1475249r.1592t>c0.116
rrl1475252r.1595c>t0.119
rrl1475266r.1609t>c0.125
rrl1475267r.1610g>a0.125
rrl1475275r.1618c>t0.135
rrl1475276r.1619t>c0.143
rrl1475291r.1634a>c0.114
rrl1475429r.1772g>a0.267
rrl1475443r.1786g>a0.186
rrl1475452r.1795c>a0.209
rrl1475475r.1818c>t0.278
rrl1475479r.1822c>t0.257
rrl1475480r.1823a>t0.257
rrl1475505r.1848g>a0.333
rrl1475526r.1869c>a0.333
rrl1475531r.1874c>t0.231
rrl1475608r.1951t>c0.108
rrl1475649r.1992a>g0.172
rrl1475657r.2000a>g0.117
rrl1475659r.2002g>a0.208
rrl1475763r.2106c>t0.148
rrl1475764r.2107a>t0.200
rrl1475765r.2108a>t0.200
rrl1475881r.2224t>c0.104
rrl1475975r.2318c>t0.273
rrl1475977r.2320a>g0.273
rrl1475988r.2331a>g0.280
rrl1475989r.2332t>c0.216
rrl1475993r.2336c>t0.216
rrl1475997r.2340a>t0.219
rrl1476085r.2428g>a0.123
rrl1476086r.2429g>a0.246
rrl1476088r.2431a>c0.127
rrl1476099r.2442a>g0.140
rrl1476103r.2446c>g0.125
rrl1476105r.2448g>a0.143
rrl1476106r.2449a>t0.226
rrl1476110r.2453g>c0.123
rrl1476114r.2457t>c0.121
rrl1476115r.2458t>c0.241
rrl1476131r.2474c>t0.190
rrl1476160r.2503t>c0.258
rrl1476214r.2557g>t0.348
rrl1476215r.2558c>t0.288
rrl1476221r.2564t>c0.271
rrl1476224r.2567a>g0.429
rrl1476251r.2594t>c0.387
rrl1476281r.2624t>c0.531
rrl1476297r.2640c>t0.355
rrl1476299r.2642c>t0.349
rrl1476584r.2927c>t0.363
rrl1476594r.2937c>t0.344
rrl1476597r.2940g>a0.337
rrl1476603r.2946g>a0.305
rrl1476608r.2951c>g0.309
rrl1476619r.2962c>t0.228
rrl1476628r.2971t>a0.315
rrl1476665r.3008t>a0.182
rrl1476666r.3009c>t0.178
rrl1476674r.3017t>c0.176
rrl1476716r.3059a>c0.108
rrl1476726r.3069a>g0.120
rrl1476732r.3075t>c0.111
fabG11673482p.Ser15Ala0.103
fabG11673487c.48T>C0.105
fabG11673490c.51A>G0.103
fabG11673523c.84G>T0.119
fabG11673535c.96A>G0.116
fabG11673547c.108T>C0.111
fabG11674079p.Pro214Ala0.173
fabG11674114c.675T>A0.217
fabG11674123c.684T>C0.211
fabG11674126c.687G>C0.200
fabG11674132c.693T>C0.194
fabG11674136p.Ser233Ala0.194
fabG11674141c.702T>C0.197
fabG11674156c.717C>G0.158
fabG11674171c.732T>C0.143
inhA1674582c.381T>C0.115
inhA1674585c.384T>C0.115
inhA1674630c.429C>G0.117
inhA1674660c.459G>C0.112
inhA1674703c.502T>C0.111
inhA1674822c.621C>G0.140
inhA1674828c.627G>A0.140
inhA1674846p.Ile215Met0.133
inhA1674864c.663C>T0.124
inhA1674870c.669T>C0.128
inhA1674879c.678T>C0.127
rpsA1833541c.-1T>C0.108
rpsA1833547c.6G>A0.136
rpsA1833568c.27G>C0.111
rpsA1833589c.48A>C0.165
rpsA1833595c.54T>G0.157
rpsA1833596p.Ser19Ala0.140
rpsA1833604c.63C>T0.209
rpsA1833616c.75A>T0.208
rpsA1833619c.78A>C0.208
rpsA1833625c.84A>G0.200
rpsA1833661c.120A>G0.105
rpsA1833664c.123C>G0.193
rpsA1833667c.126C>G0.115
rpsA1833676c.135A>G0.148
rpsA1833679c.138G>T0.145
rpsA1833685c.144G>C0.138
rpsA1833691c.150G>A0.129
rpsA1833694c.153G>T0.130
rpsA1833697c.156C>T0.148
rpsA1833700c.159C>T0.148
rpsA1833709c.168C>T0.195
rpsA1833724c.183C>T0.190
rpsA1833727c.186G>C0.259
rpsA1833733c.192C>G0.170
rpsA1833734p.Ala65Ser0.169
rpsA1833745c.204G>C0.233
rpsA1833748c.207C>G0.236
rpsA1833760c.219C>T0.154
rpsA1833787c.246C>G0.258
rpsA1833790c.249T>C0.258
rpsA1833802c.261A>G0.242
rpsA1833811c.270G>T0.240
rpsA1833823c.282G>A0.181
rpsA1833832c.291G>A0.156
rpsA1833835c.294C>T0.141
rpsA1833838c.297G>C0.220
rpsA1833841c.300C>G0.220
rpsA1833847c.306C>G0.250
rpsA1833862c.321G>T0.198
rpsA1833874c.333T>G0.211
rpsA1833877c.336C>G0.192
rpsA1833886c.345C>G0.214
rpsA1833894p.Ala118Glu0.238
rpsA1833928c.387G>C0.344
rpsA1833949c.408T>C0.242
rpsA1833958c.417C>T0.227
rpsA1833961c.420C>G0.232
rpsA1833970c.429G>T0.225
rpsA1833979c.438T>C0.318
rpsA1833991c.450C>G0.225
rpsA1834000c.459G>C0.354
rpsA1834009c.468C>T0.180
rpsA1834012c.471G>C0.183
rpsA1834015c.474G>C0.181
rpsA1834021c.480C>T0.317
rpsA1834030c.489C>G0.305
rpsA1834073p.Lys178Arg0.126
rpsA1834096c.555G>C0.125
rpsA1834099c.558C>G0.253
rpsA1834102c.561T>C0.112
rpsA1834105c.564C>G0.112
rpsA1834108c.567C>G0.236
rpsA1834114c.573G>C0.118
rpsA1834123c.582C>G0.146
rpsA1834177c.636A>C1.000
rpsA1834222c.681T>C0.124
rpsA1834228c.687C>A0.144
rpsA1834231c.690T>G0.174
rpsA1834234c.693G>T0.149
rpsA1834240c.699T>C0.126
rpsA1834246c.705G>T0.130
rpsA1834249c.708T>C0.276
rpsA1834252c.711C>G0.134
rpsA1834261c.720A>G0.295
rpsA1834264c.723G>C0.295
rpsA1834279c.738C>T0.164
rpsA1834294c.753G>T0.173
rpsA1834297c.756C>T0.198
rpsA1834303c.762T>G0.206
rpsA1834306c.765T>C0.269
rpsA1834327c.786G>T0.193
rpsA1834348c.807T>C0.300
rpsA1834357c.816T>C0.195
rpsA1834366c.825A>G0.289
rpsA1834375c.834G>T0.200
rpsA1834396c.855G>C0.296
rpsA1834411c.870T>G0.264
rpsA1834414c.873C>T0.241
rpsA1834417c.876G>C0.313
rpsA1834423c.882G>C0.305
rpsA1834429c.888C>T0.257
rpsA1834438c.897C>T0.244
rpsA1834451c.910T>C0.309
rpsA1834456c.915T>G0.217
rpsA1834468c.927A>G0.294
rpsA1834477c.936C>T0.210
rpsA1834489c.948T>C0.321
rpsA1834516c.975G>A0.220
rpsA1834519c.978G>C0.214
rpsA1834520p.Ala327Ser0.211
rpsA1834528c.987T>C0.324
rpsA1834543c.1002C>G0.195
rpsA1834546c.1005T>C0.256
rpsA1834552c.1011G>T0.177
rpsA1834555c.1014T>G0.174
rpsA1834557p.Ala339Gly0.171
rpsA1834606c.1065C>T0.225
rpsA1834609c.1068T>C0.290
rpsA1834619c.1078T>C0.160
rpsA1834622c.1081T>A0.170
rpsA1834633c.1092A>G0.266
rpsA1834639c.1098T>C0.274
rpsA1834645c.1104C>T0.198
rpsA1834666c.1125G>C0.216
rpsA1834667p.Ala376Ser0.225
rpsA1834690c.1149T>C0.309
rpsA1834700p.Gln387Ala0.175
rpsA1834705c.1164C>G0.173
rpsA1834720c.1179C>G0.208
rpsA1834732c.1191T>C0.356
rpsA1834738c.1197A>G0.336
rpsA1834747c.1206A>G0.240
rpsA1834759c.1218A>C0.233
rpsA1834765p.Glu408Asp0.331
rpsA1834774c.1233C>T0.197
rpsA1834776p.Ala412Glu0.197
rpsA1834780c.1239A>G0.296
rpsA1834789c.1248T>C0.296
rpsA1834813c.1272G>T0.167
rpsA1834830p.Ala430Val0.160
tlyA1917972c.33A>G1.000
tlyA1917981c.42G>C0.122
tlyA1918036p.Arg33Ser0.128
katG2154724p.Arg463Leu1.000
kasA2518132c.18C>T0.109
kasA2518138c.24T>C0.111
kasA2518146p.Phe11Tyr0.106
kasA2518162c.48G>A0.130
kasA2518174c.60A>G0.114
kasA2518190p.Ser26Ala0.123
kasA2518199p.Ile29Val0.118
kasA2518220c.106C>T0.111
kasA2518561c.447T>C0.121
kasA2518768c.654C>G0.126
kasA2518783c.669T>C0.138
kasA2518789c.675G>C0.111
kasA2518792c.678C>A0.112
kasA2518795c.681C>G0.142
kasA2518822c.708C>A0.162
kasA2518825c.711T>C0.302
kasA2518846c.732G>T0.143
kasA2518849c.735G>C0.145
kasA2518853p.Leu247Val0.140
kasA2518864c.750G>C0.275
kasA2518879c.765A>G0.133
kasA2518885c.771T>C0.146
kasA2518898c.784T>C0.111
ahpC2726591c.399C>G0.152
ahpC2726593p.Val134Ala0.152
ahpC2726600c.408T>C0.150
ahpC2726601p.Ile137Leu0.150
ahpC2726638p.Ala149Val0.122
ahpC2726645c.453C>G0.128
folC2747239c.360A>G0.126
folC2747248c.351C>G0.121
folC2747264p.Gly112Ala0.120
folC2747266c.333G>A0.120
folC2747275c.324A>G0.128
folC2747289p.Pro104Ala0.127
folC2747290c.309T>C0.132
folC2747293c.306C>T0.131
folC2747302c.297T>C0.145
folC2747314c.285T>G0.151
folC2747317c.282G>C0.149
folC2747343p.Val86Ile0.145
ribD2987026p.Ala63Gly0.109
ribD2987042c.204A>G0.109
ribD2987046p.Val70Ile0.113
ribD2987058c.220T>C0.111
ribD2987066c.228A>G0.112
ribD2987069c.231T>C0.112
thyX3067316c.630T>C0.109
thyX3067325c.621T>C0.116
thyX3067355c.591T>G0.144
thyX3067367c.579C>G0.115
thyX3067373c.573G>C0.140
thyX3067391c.555C>G0.125
thyX3067556p.His130Gln0.115
thyX3067559c.387G>C0.123
thyX3067565p.Asp127Glu0.122
thyX3067570p.Ala126Pro0.124
thyX3067577c.369C>T0.125
thyX3067602p.Arg115His0.119
thyX3067611p.Lys112Thr0.146
thyX3067619c.327T>G0.147
thyX3067631c.315G>C0.144
thyX3067634c.312G>C0.148
thyX3067652c.294A>G0.140
thyX3067661c.285G>C0.156
thyX3067685c.261T>G0.129
thyX3067694c.252C>G0.114
thyX3067721c.225A>G0.110
thyX3067727c.219T>G0.110
thyX3067793c.153A>G0.123
thyX3067814c.132A>G0.144
thyX3067850c.96T>G0.129
thyX3067869p.Thr26Ser0.120
thyX3067874c.72G>C0.120
thyX3067877c.69C>G0.119
thyX3067883c.63G>C0.117
thyX3067886c.60T>G0.118
thyX3067889c.57G>C0.119
thyX3067898p.Asp16Glu0.161
thyX3067935p.Thr4Ile0.117
thyA3074127c.345C>G0.140
thyA3074130c.342C>G0.132
thyA3074147p.Ile109Val0.129
thyA3074172c.300C>G0.108
thyA3074175c.297T>C0.109
thyA3074181c.291T>C0.149
thyA3074187c.285A>G0.156
thyA3074205p.Glu89Asp0.156
thyA3074214c.258A>G0.143
thyA3074244c.228T>C0.134
ald3086788c.-32T>C1.000
ald3087704c.885T>C0.122
ald3087716c.897G>C0.122
ald3087726p.Ala303Ser0.118
ald3087729p.Ser304Ala0.120
ald3087737c.918G>C0.116
fbiA3640291c.-252T>C0.145
fbiA3640307c.-236C>A0.153
fbiA3640347c.-196A>G0.143
fbiA3640349c.-194A>G0.143
fbiA3640350c.-193C>T0.143
fbiA3640365c.-178C>G0.148
panD4044188c.94A>G0.116
panD4044189c.93G>A0.105
panD4044195c.87A>G0.116
embC4240729c.867C>G0.171
embC4240735c.873C>G0.174
embC4240741c.879C>T0.191
embC4240756c.894G>C0.188
embC4240771c.909G>C0.158
embC4240772p.Ser304Ala0.159
embC4240778p.His306Gly0.157
embC4240781p.Ala307Ser0.157
embC4240789c.927T>C0.311
embC4240819c.957A>C0.215
embC4240826p.Ala322Ser0.186
embC4240831c.969T>G0.291
embC4240856p.Ala332Thr0.122
embC4240859p.Leu333Ile0.122
embC4240885c.1023T>C0.175
embC4240897c.1035C>G0.156
embC4240900c.1038A>G0.150
embC4241089c.1227C>G0.144
embC4241095c.1233C>T0.143
embC4241107c.1245G>C0.143
embC4241140c.1278A>G0.148
embC4241146c.1284C>G0.128
embC4241383c.1521G>C0.106
embC4241449c.1587C>G0.168
embC4241453p.Ile531Val0.168
embC4241479c.1617C>G0.180
embC4241480c.1618T>C0.182
embC4241488c.1626G>C0.172
embC4241496p.Ala545Gly0.132
embC4241500c.1638A>C0.133
embC4241501p.Ser547Thr0.136
embC4241506c.1644G>C0.120
embC4241518c.1656A>G0.125
embC4241521c.1659T>C0.106
embC4242643c.2781C>T1.000
embA4243460c.228C>T0.989
embA4245137c.1905T>C0.125
embA4245146c.1914G>A0.137
embA4245149c.1917C>G0.135
embA4245153p.Ile641Val0.146
embA4245182c.1950T>C0.126
embA4245189c.1957C>T0.127
embA4245198p.Leu656Ile0.123
embA4245207c.1975T>C0.113
embA4245764c.2532G>C0.115
embA4246292c.3060A>G0.126
embB4246544p.Thr11Pro0.111
embB4246548p.Pro12Gln0.128
embB4246555c.42G>C0.128
embB4246556p.Ala15Pro0.125
embB4246563p.Leu17Trp0.184
embB4246567c.54G>T0.148
embB4247464c.951C>G0.121
embB4247470c.957T>C0.147
embB4247491c.978G>C0.132
embB4247497c.984T>C0.150
embB4247512c.999T>C0.149
embB4247539c.1026T>C0.112
embB4247914c.1401G>C0.110
embB4247932c.1419C>G0.144
embB4247940p.Leu476Trp0.126
embB4247945c.1432T>C0.133
embB4247951p.Ser480Ala0.131
embB4247956c.1443G>C0.128
embB4247974c.1461C>G0.122
embB4248007c.1494C>G0.135
embB4248011p.Ser500Arg0.125
embB4248014p.Thr501Ala0.121
embB4248035p.Val508Ile0.139
embB4248040c.1527C>G0.125
embB4248041p.Ala510Thr0.135
embB4248044p.Lys511Ala0.135
embB4248070c.1557T>C0.185
embB4248085c.1572T>C0.198
embB4248097c.1584C>G0.179
embB4248130c.1617G>C0.172
embB4248142c.1629T>C0.153
embB4248143c.1630T>C0.153
embB4248157c.1644A>G0.164
embB4248172c.1659G>C0.143
embB4248199c.1686A>G0.143
embB4248200p.Ile563Val0.150
embB4248205c.1692C>G0.140
embB4248206p.Ser565Gly0.148
embB4248220c.1707A>C0.164
embB4248304c.1791G>C0.149
embB4248319c.1806A>G0.107
embB4249469p.Leu986Met0.108
ethA4327396c.78A>G0.137
ethA4327399p.Asp25Glu0.139
ethA4327423c.51G>C0.127
gid4407588c.615T>C1.000
gid4407927p.Glu92Asp1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;