TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5dd94acd9ed7a
Sample: 5dd94acd9ed7a

Download results

Summary
ID: 5dd94acd9ed7a
Date: Sat Nov 23 15:08:01 2019
Strain: root
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C0.720
gyrB6136c.897G>A0.700
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6202c.963C>T1.000
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C1.000
gyrB6223c.984G>C1.000
gyrB6343c.1104G>A1.000
gyrB6362c.1123T>C1.000
gyrB6382c.1143A>G1.000
gyrB6655c.1416T>C1.000
gyrB6664c.1425C>T1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>C1.000
gyrB6685c.1446C>A1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C0.729
gyrB6775c.1536G>C0.705
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6838c.1599C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>C1.000
gyrB6949c.1710A>G1.000
gyrB6967c.1728T>C1.000
gyrB6968p.Asp577Gln1.000
gyrB6982c.1743A>G1.000
gyrB6985c.1746C>T1.000
gyrB6988c.1749C>G1.000
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>C1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrB7123c.1884C>G1.000
gyrB7126c.1887G>C1.000
gyrB7129c.1890T>G1.000
gyrB7132c.1893T>C1.000
gyrB7135c.1896G>A1.000
gyrB7136c.1897T>C1.000
gyrB7141c.1902T>G1.000
gyrB7144c.1905A>G1.000
gyrB7150c.1911G>A1.000
gyrB7153c.1914G>C1.000
gyrB7168c.1929C>G1.000
gyrB7178c.1939T>C1.000
gyrB7186c.1947C>G1.000
gyrB7189c.1950C>T1.000
gyrB7198c.1959C>T1.000
gyrB7210p.Asp657Glu1.000
gyrB7213c.1974G>A1.000
gyrB7216c.1977G>C1.000
gyrB7225c.1986T>C1.000
gyrB7234c.1995C>A1.000
gyrA7343c.42G>C0.810
gyrA7355c.54T>A1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7412c.111C>G1.000
gyrA7421c.120G>C1.000
gyrA7424c.123G>C1.000
gyrA7427c.126G>C1.000
gyrA7433c.132G>C1.000
gyrA7439c.138C>T1.000
gyrA7442c.141G>C1.000
gyrA7451c.150C>A1.000
gyrA7457c.156T>C1.000
gyrA7463c.162G>C1.000
gyrA7466c.165G>C1.000
gyrA7469c.168C>G1.000
gyrA7472c.171T>C1.000
gyrA7475c.174A>G1.000
gyrA7480p.Phe60Tyr1.000
gyrA7484c.183T>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA7655c.354G>A1.000
gyrA7658c.357A>G1.000
gyrA7661c.360C>T1.000
gyrA7664c.363T>C1.000
gyrA7670c.369A>G1.000
gyrA7671p.Pro124Ala1.000
gyrA7676c.375G>T1.000
gyrA7679c.378G>C1.000
gyrA7683c.382A>C1.000
gyrA7694c.393A>G1.000
gyrA7697c.396C>T1.000
gyrA7703c.402G>C1.000
gyrA7706c.405C>G1.000
gyrA7710c.409T>C1.000
gyrA7715c.414G>C1.000
gyrA7725c.424C>T1.000
gyrA7728c.427A>C1.000
gyrA7739c.438C>T1.000
gyrA7745c.444G>A1.000
gyrA7760c.459C>T1.000
gyrA7763c.462T>G1.000
gyrA7778c.477G>C1.000
gyrA7781c.480G>C1.000
gyrA7782p.Gln161Met1.000
gyrA7796c.495G>A1.000
gyrA7797c.496C>T1.000
gyrA7802c.501C>G1.000
gyrA7811c.510C>T1.000
gyrA7814c.513C>G1.000
gyrA7832c.531G>T0.958
gyrA7835c.534A>G1.000
gyrA7841c.540C>T1.000
gyrA7847c.546G>C1.000
gyrA7853c.552C>T1.000
gyrA7859c.558A>C1.000
gyrA7865c.564T>C1.000
gyrA7868p.Ile189Met1.000
gyrA7886c.585T>C1.000
gyrA7890c.589C>T1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>T1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8312c.1011G>A1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8366c.1065G>A1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>T1.000
gyrA8642c.1341A>G0.977
gyrA8645c.1344C>G0.977
gyrA8649p.Arg450Lys0.977
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G1.000
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8780c.1479C>T1.000
gyrA8783c.1482G>C1.000
gyrA8786c.1485T>G1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8924c.1623C>T1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>A1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
gyrA9023c.1722A>C1.000
gyrA9026c.1725G>C1.000
gyrA9029c.1728T>C1.000
gyrA9032c.1731T>C1.000
gyrA9035c.1734G>C1.000
gyrA9044c.1743C>G1.000
gyrA9062c.1761C>T1.000
gyrA9063p.Ser588Ala1.000
gyrA9068c.1767G>C1.000
gyrA9071c.1770G>C1.000
gyrA9080c.1779G>C1.000
gyrA9089c.1788G>C1.000
gyrA9095c.1794C>T1.000
gyrA9099c.1798T>C1.000
gyrA9113c.1812C>G1.000
gyrA9116c.1815G>A1.000
gyrA9119c.1818A>G1.000
gyrA9122c.1821C>G1.000
gyrA9128c.1827C>G1.000
gyrA9251c.1950G>C1.000
gyrA9263c.1962C>T1.000
gyrA9267p.Asn656Gly1.000
gyrA9276c.1975C>T1.000
gyrA9281c.1980C>G1.000
gyrA9296c.1995T>C1.000
gyrA9304p.Gly668Glu1.000
gyrA9311c.2010C>T1.000
gyrA9330p.Asn677His1.000
gyrA9369c.2068C>T1.000
gyrA9377c.2076A>G1.000
gyrA9383c.2082T>C1.000
gyrA9386c.2085T>C1.000
gyrA9392c.2091C>T1.000
gyrA9395c.2094G>C1.000
rpoB759604c.-203A>G1.000
rpoB759606c.-201T>C1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760313c.507G>C1.000
rpoB760317c.511A>T1.000
rpoB760325c.519G>C1.000
rpoB760328c.522G>C1.000
rpoB760331c.525G>T1.000
rpoB760337c.531C>G1.000
rpoB760340c.534G>T1.000
rpoB760343c.537G>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C1.000
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>T0.982
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760567p.Ser254Trp1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile0.873
rpoB760591p.Val262Ala0.873
rpoB760595c.789C>T0.873
rpoB760596p.Thr264Pro0.873
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G0.984
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760793c.987A>G1.000
rpoB760799c.993C>T1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T0.984
rpoB760928c.1122G>C1.000
rpoB760934c.1128C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760979c.1173G>A1.000
rpoB760982c.1176G>T1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>C1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T0.980
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>T1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>T1.000
rpoB761219c.1413G>C1.000
rpoB761231c.1425C>T1.000
rpoB761234c.1428G>T1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C1.000
rpoB761264c.1458C>G1.000
rpoB761273c.1467T>C1.000
rpoB761276c.1470G>C1.000
rpoB761297c.1491C>T1.000
rpoB761318c.1512G>C1.000
rpoB761327c.1521A>G1.000
rpoB761339c.1533C>G0.907
rpoB761345c.1539G>C0.857
rpoB761346p.Val514Ser0.857
rpoB761354c.1548C>A1.000
rpoB761357c.1551G>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761373p.Val523His1.000
rpoB761387c.1581C>T1.000
rpoB761393c.1587G>A1.000
rpoB761414c.1608A>G1.000
rpoB761423c.1617T>C1.000
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761573c.1767C>G1.000
rpoB761579c.1773G>C1.000
rpoB761606c.1800C>G1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761648c.1842T>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>C1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761720c.1914C>G0.348
rpoB761722p.Glu639Gly0.714
rpoB761724p.Glu640Lys0.286
rpoB761727p.Ser641Ala1.000
rpoB761741c.1935G>A1.000
rpoB761750c.1944G>T1.000
rpoB761760p.Ile652Val1.000
rpoB761765c.1959T>C1.000
rpoB761772p.His656Ala1.000
rpoB761778p.Asn658Asp1.000
rpoB761789c.1983G>C1.000
rpoB761791p.Arg662Gln1.000
rpoB761794p.Thr663Ser1.000
rpoB761802p.Met666Leu1.000
rpoB761813c.2007T>C1.000
rpoB761819c.2013G>T1.000
rpoB761834c.2028T>C1.000
rpoB761847p.Cys681Lys1.000
rpoB761863p.Ala686Glu1.000
rpoB761868p.Asp688Gln1.000
rpoB761873c.2067A>G1.000
rpoB761891c.2085G>C1.000
rpoB761892p.Ile696Val1.000
rpoB761897c.2091C>G1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G0.983
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762239c.2433G>A1.000
rpoB762245c.2439G>C1.000
rpoB762254c.2448T>C1.000
rpoB762284c.2478G>T1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762314c.2508C>T1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762338c.2532T>C1.000
rpoB762341c.2535G>C1.000
rpoB762347c.2541T>C1.000
rpoB762350c.2544C>G1.000
rpoB762353c.2547C>T1.000
rpoB762356p.Glu850Asp0.952
rpoB762362p.Glu852Asp1.000
rpoB762368p.Glu854Asp1.000
rpoB762369c.2563T>C1.000
rpoB762374c.2568G>T1.000
rpoB762380c.2574T>C1.000
rpoB762383c.2577C>G1.000
rpoB762392c.2586G>C1.000
rpoB762395c.2589G>T1.000
rpoB762398c.2592T>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G0.849
rpoB762510p.Ala902Pro0.827
rpoB762515c.2709C>T0.838
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762557c.2751G>A1.000
rpoB762560c.2754A>C1.000
rpoB762563c.2757G>T1.000
rpoB762581c.2775T>C1.000
rpoB762587c.2781G>A1.000
rpoB762827c.3021G>C1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763064c.3258G>A1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T0.983
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T0.983
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763179c.3373C>T1.000
rpoB763193c.3387C>G1.000
rpoB763202c.3396A>G1.000
rpoB763205c.3399G>C1.000
rpoB763207p.Ser1134Lys1.000
rpoB763214c.3408T>C1.000
rpoB763217c.3411G>C1.000
rpoB763220c.3414G>C1.000
rpoB763226c.3420A>G1.000
rpoB763227p.Leu1141Met1.000
rpoB763235p.Glu1143Asp1.000
rpoB763238c.3432T>C1.000
rpoB763241p.Glu1145Asp1.000
rpoB763259c.3453G>C1.000
rpoB763262c.3456C>T1.000
rpoB763265c.3459G>C1.000
rpoB763268c.3462C>G1.000
rpoB763283c.3477T>C1.000
rpoB763295c.3489C>T1.000
rpoC763365c.-5G>GT1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763609c.240C>T1.000
rpoC763621c.252C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G0.964
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>G1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763774c.405G>C1.000
rpoC763781p.Ser138Thr1.000
rpoC763792c.423G>A1.000
rpoC763795c.426G>A1.000
rpoC763796p.Met143Leu1.000
rpoC763801c.432C>T1.000
rpoC763804c.435C>T1.000
rpoC763807c.438T>C1.000
rpoC763816c.447C>G1.000
rpoC763831c.462A>G1.000
rpoC763836p.Ala156Glu1.000
rpoC763840c.471G>C1.000
rpoC763844p.Arg159Lys1.000
rpoC763857p.Glu163Ala1.000
rpoC763861c.492C>T1.000
rpoC763870c.501C>T1.000
rpoC763872p.Gly168Ala1.000
rpoC763876p.Glu169Asp0.957
rpoC763879c.510A>G1.000
rpoC763888c.519G>T1.000
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763944c.1955 1957del0.905
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781721c.162C>T1.000
rpsL781725p.Lys56Arg1.000
rpsL781728c.169T>C1.000
rpsL781733c.174G>C1.000
rpsL781736c.177T>C1.000
rpsL781737p.Gln60Ala1.000
rpsL781742c.183C>G1.000
rpsL781751c.192G>C1.000
rpsL781754c.195G>T1.000
rpsL781760c.201T>C1.000
rpsL781763c.204C>G1.000
rpsL781766c.207C>T1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T0.986
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rplC800804c.-5G>GA1.000
rplC800806c.-3G>A1.000
rplC800808c.-1A>C1.000
rplC800815c.7C>A1.000
rplC800820c.12G>A1.000
rplC800823c.15C>A1.000
rplC800829c.21C>G1.000
rplC800832c.24T>C1.000
rplC800856c.48A>G1.000
rplC800865p.Glu19Asp1.000
rplC800867p.Ser20Asn1.000
rplC800872c.64A>C1.000
rplC800877c.69A>T1.000
rplC800880c.72A>C1.000
rplC800886c.78G>A1.000
rplC800892c.84G>C1.000
rplC800904c.96G>C1.000
rplC800910c.102C>T1.000
rplC800916c.108A>G1.000
rplC800928c.120C>G1.000
rplC800931c.123G>C1.000
rplC800932p.Pro42Thr1.000
rplC800937c.129A>G1.000
rplC800939p.Arg44Gln1.000
rplC800946c.138T>C1.000
rplC800949c.141T>C1.000
rplC800964c.156G>C1.000
rplC800967c.159C>G1.000
rplC800985c.177A>C1.000
rplC800994c.186C>G1.000
rplC800996p.Asn63Thr1.000
rplC801004p.Leu66Val1.000
rplC801009c.201A>C1.000
rplC801017p.Tyr70Phe1.000
rplC801019p.Thr71Ala1.000
rplC801027c.219C>G1.000
rplC801031p.Val75Ile1.000
rplC801039c.231A>G1.000
rplC801045c.237A>T1.000
rplC801046p.Tyr80His1.000
rplC801054c.246G>C1.000
rplC801183c.375C>A1.000
rplC801195c.387G>T1.000
rplC801210c.402T>C1.000
rplC801222c.414T>C1.000
rplC801231c.423C>G1.000
rplC801237c.429G>C1.000
rplC801246c.438C>T1.000
rplC801357c.549T>C1.000
rplC801381c.573G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472286r.441c>g1.000
rrs1472287r.442c>t1.000
rrs1472289r.444t>g1.000
rrs1472290r.445c>g1.000
rrs1472313r.468g>a1.000
rrs1472315r.470t>g1.000
rrs1472324r.479g>c1.000
rrs1472325r.480g>c1.000
rrs1472327r.482g>a1.000
rrs1472328r.483g>c1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c0.981
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c1.000
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac0.930
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474030r.373g>a1.000
rrl1474044r.387c>t1.000
rrl1474051r.394t>c1.000
rrl1474054r.397t>c1.000
rrl1474056r.399t>c1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474107r.450t>c0.147
rrl1474108r.451c>t0.147
rrl1474109r.452a>t0.147
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.918
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g0.978
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474291r.634tttcctctccggagga>t1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474412r.755ga>g1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c1.000
rrl1474632r.975g>t0.964
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474710r.1053tggtg>t0.907
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t0.960
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475291r.1634a>c1.000
rrl1475297r.1640c>g1.000
rrl1475315r.1658a>t1.000
rrl1475337r.1680c>t1.000
rrl1475343r.1686a>g1.000
rrl1475346r.1689c>t1.000
rrl1475353r.1696a>t1.000
rrl1475355r.1698c>t1.000
rrl1475358r.1701t>c1.000
rrl1475361r.1704g>a1.000
rrl1475369r.1712g>c1.000
rrl1475374r.1717g>gac1.000
rrl1475377r.1720g>c1.000
rrl1475379r.1722g>t1.000
rrl1475395r.1738t>g1.000
rrl1475396r.1739c>g1.000
rrl1475397r.1740g>t1.000
rrl1475398r.1741c>g1.000
rrl1475401r.1744ac>a1.000
rrl1475405r.1748a>c1.000
rrl1475406r.1749t>g1.000
rrl1475407r.1750c>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475606r.1949ta>t1.000
rrl1475614r.1957a>c1.000
rrl1475615r.1958c>cgg1.000
rrl1475616r.1959a>g0.958
rrl1475617r.1960c>g0.958
rrl1475618r.1961c>a0.958
rrl1475624r.1967g>t1.000
rrl1475625r.1968g>c1.000
rrl1475626r.1969t>c1.000
rrl1475628r.1971g>t1.000
rrl1475633r.1976g>t1.000
rrl1475635r.1978g>a1.000
rrl1475637r.1980t>c1.000
rrl1475638r.1981c>g1.000
rrl1475639r.1982c>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t0.980
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476030r.2373a>g1.000
rrl1476032r.2375c>a1.000
rrl1476033r.2376t>g1.000
rrl1476034r.2377c>g1.000
rrl1476035r.2378g>c1.000
rrl1476044r.2387t>g1.000
rrl1476045r.2388g>t1.000
rrl1476046r.2389g>t1.000
rrl1476047r.2390g>t1.000
rrl1476049r.2392c>t1.000
rrl1476056r.2399g>a1.000
rrl1476058r.2401t>c1.000
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t0.964
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T0.980
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.977
rpsA1833734p.Ala65Ser0.977
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T0.982
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>C1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T0.982
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834804c.1263C>T0.947
rpsA1834813c.1272G>T1.000
katG2154315c.1797T>G1.000
katG2154327c.1785T>C1.000
katG2154618c.1494G>C1.000
katG2154624c.1488G>A1.000
katG2154627c.1485A>T1.000
katG2154879c.1233G>C1.000
katG2155080c.1032C>G1.000
katG2155092c.1020C>T1.000
katG2155097p.Tyr339Asn1.000
katG2155101c.1011G>A1.000
katG2155113c.999G>C1.000
katG2155119c.993A>G1.000
katG2155196p.Thr306Ser1.000
katG2155200c.912A>G1.000
katG2155205p.Ser303Ala1.000
katG2155220p.Leu298Ile1.000
katG2155236c.876C>T1.000
katG2155239c.873A>G1.000
katG2155242c.870A>T1.000
katG2155251p.Glu287Asp1.000
katG2155257c.855G>T1.000
katG2155443c.669C>T1.000
katG2155446c.666C>T1.000
katG2155449c.663G>C1.000
katG2155452c.660C>T1.000
katG2155794c.318C>G1.000
katG2155803c.309G>A1.000
katG2155806c.306A>G1.000
katG2155811p.Leu101Met1.000
kasA2518205p.Ser31Gly1.000
kasA2518219c.105T>A1.000
kasA2518223p.Leu37Ile1.000
kasA2518231c.117C>G1.000
kasA2518567c.453G>C1.000
kasA2518624c.510C>G1.000
kasA2518630c.516G>C1.000
kasA2518633c.519G>C1.000
kasA2518639c.525G>C1.000
kasA2518642c.528A>G1.000
kasA2518645c.531G>C1.000
kasA2518651c.537C>G1.000
kasA2518654c.540C>T1.000
kasA2518663c.549T>C1.000
kasA2518681c.567C>T1.000
kasA2518684c.570C>A1.000
kasA2518688p.Val192Met1.000
kasA2518691p.Ala193Ile1.000
kasA2518711c.597A>G1.000
kasA2518714c.600A>C1.000
kasA2518715p.Pro201Met1.000
kasA2518723c.609G>A1.000
kasA2518726c.612G>C1.000
kasA2518738c.624G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C0.911
kasA2518822c.708C>A0.917
kasA2518825c.711T>C1.000
kasA2518846c.732G>T0.911
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
kasA2519029c.915C>T0.250
kasA2519036p.Val308Ile0.217
kasA2519044c.930G>T0.217
kasA2519305c.1191A>G1.000
kasA2519320c.1206C>T0.174
kasA2519323c.1209G>A0.174
kasA2519329c.1215C>T0.826
kasA2519332c.1218C>G0.174
kasA2519338c.1224T>C1.000
kasA2519341c.1227G>C0.211
ahpC2726576c.384C>T1.000
ahpC2726593p.Val134Ala1.000
ahpC2726600c.408T>C1.000
ahpC2726613p.Asn141Asp1.000
ahpC2726619p.Glu143Ile0.579
ahpC2726624c.432C>T0.579
ahpC2726636c.444G>C0.938
ahpC2726638p.Ala149Val1.000
ahpC2726642c.450C>G1.000
ahpC2726645c.453C>A1.000
ahpC2726651c.459G>C1.000
ahpC2726657c.465A>C1.000
ahpC2726666c.474C>G1.000
ahpC2726669c.477T>C1.000
ahpC2726675c.483A>G1.000
ahpC2726678c.486G>C1.000
ahpC2726681c.489A>C1.000
ahpC2726687c.495C>T1.000
ahpC2726693c.501C>G1.000
ahpC2726696c.504C>G1.000
ahpC2726717c.525A>C1.000
folC2747281c.318T>C1.000
folC2747289p.Pro104Ala1.000
folC2747290c.309T>G1.000
folC2747299c.300G>A1.000
folC2747302c.297T>C1.000
folC2747314c.285T>G1.000
thyX3067814c.132A>G1.000
thyX3067817c.129G>A1.000
thyX3067841c.105C>G1.000
thyX3067847c.99G>C1.000
thyX3067862c.84G>A1.000
thyX3067869p.Thr26Ser1.000
thyA3073925c.547A>G1.000
thyA3073926c.546C>T1.000
thyA3073929c.543A>G1.000
thyA3073938c.534G>A1.000
thyA3073950c.522C>G1.000
thyA3073953c.519A>C1.000
thyA3073956c.516C>G1.000
thyA3073959c.513A>G1.000
thyA3073962c.510C>T1.000
thyA3073965c.507G>A1.000
thyA3073980c.492G>A1.000
thyA3073983c.489G>C1.000
thyA3073989c.483A>G1.000
thyA3073992c.480G>A1.000
thyA3074000p.Arg158Lys1.000
thyA3074004c.468A>G1.000
thyA3074010c.462G>C1.000
thyA3074013c.459G>A1.000
thyA3074028c.444C>G1.000
thyA3074031c.441A>G1.000
thyA3074034c.438A>G1.000
thyA3074053p.Arg140Gln1.000
thyA3074057p.Glu139Pro1.000
thyA3074070c.402G>A1.000
thyA3074076c.396G>T1.000
thyA3074082c.390C>A1.000
thyA3074089p.Ile128Asn1.000
thyA3074091c.381G>C1.000
thyA3074094c.378C>G1.000
thyA3074097c.375G>C1.000
thyA3074103c.369G>C1.000
thyA3074108p.Asp122Asn1.000
thyA3074112c.360G>A1.000
thyA3074120c.352A>G1.000
thyA3074127c.345C>T1.000
thyA3074130c.342C>G1.000
thyA3074226c.246T>C1.000
thyA3074244c.228T>C1.000
thyA3074248p.His75Arg1.000
thyA3074253p.His73Gln1.000
thyA3074264p.Gly70Arg1.000
thyA3074267p.Ile69Val1.000
thyA3074274p.Asp66Glu1.000
thyA3074277c.195G>A1.000
thyA3074286c.186A>G1.000
fbiA3640319c.-224A>C1.000
fbiA3640320c.-223G>C1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044242p.Thr14Ala1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4239995p.Ile45Val1.000
embC4240006c.144A>G1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr0.964
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embC4241059c.1197G>A1.000
embC4241068c.1206C>T1.000
embC4241179c.1317G>C1.000
embC4241182c.1320G>C1.000
embC4241185c.1323G>C1.000
embC4241188c.1326C>T1.000
embC4241194c.1332C>G1.000
embC4241197c.1335G>C1.000
embC4241203c.1341T>C1.000
embC4241224c.1362G>A1.000
embC4241599p.Met579Ile1.000
embC4241611c.1749G>C1.000
embC4241614c.1752A>C1.000
embC4241626c.1764T>C1.000
embC4241635c.1773G>C1.000
embC4241647c.1785G>C1.000
embC4241648c.1786T>C1.000
embC4241765p.Ala635Ser1.000
embC4241770c.1908T>C1.000
embC4241791c.1929G>C1.000
embC4241809c.1947A>C1.000
embC4241818c.1956C>T1.000
embC4241824c.1962T>C1.000
embC4241828p.Lys656Gln1.000
embA4244041p.Thr270Ile1.000
embA4244043p.Ser271Thr1.000
embA4244351c.1119G>C1.000
embA4244657c.1425G>C1.000
embA4244666c.1434G>C1.000
embA4244669c.1437G>C1.000
embA4244678c.1446G>C1.000
embA4244681c.1449A>G1.000
embA4244690c.1458G>A1.000
embA4244694p.Lys488Val1.000
embA4244702c.1470C>T1.000
embA4244708c.1476C>G1.000
embA4244726p.Asp498Glu1.000
embA4244747c.1515T>G1.000
embA4245101c.1869G>C1.000
embA4245388p.Ala719Gly1.000
embA4245725c.2493A>G1.000
embA4245726c.2494T>C1.000
embA4245737c.2505A>C1.000
embA4245740c.2508T>C1.000
embB4247470c.957T>C1.000
embB4247494c.981G>A0.950
embB4247497c.984T>C1.000
embB4247500c.987C>G1.000
embB4247512c.999T>C1.000
embB4249008p.Pro832Arg0.200
embB4249018c.2505T>C0.200
ethA4326138c.1336G>A1.000
ethA4326142c.1332G>A1.000
ethA4326150p.Ser442Ala1.000
ethA4326156c.1318G>A1.000
ethA4326163c.1311A>G1.000
ethA4326166c.1308T>G1.000
ethA4326175p.Glu433Asp1.000
ethA4326289c.1185G>T1.000
ethA4326295c.1179C>G0.857
ethA4326310c.1164A>G0.882
ethA4326324p.Val384Ile1.000
ethA4326325c.1149C>G1.000
ethA4326329p.Tyr382Phe1.000
ethA4326331c.1143G>C1.000
ethA4327039p.Glu145Asp1.000
ethA4327061p.Ser138Thr1.000
kasA2518879Chromosome:g.2518879 2519364del1

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;