TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5ddc914854887
Sample: 5ddc914854887

Download results

Summary
ID: 5ddc914854887
Date: Tue Nov 26 02:44:53 2019
Strain: root
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB5452c.213G>A1.000
gyrB6454c.1215C>T1.000
gyrB6721c.1482C>T1.000
gyrB7093c.1854T>C1.000
gyrA7362p.Glu21Gln1.000
gyrA7585p.Ser95Thr1.000
gyrA7763c.462T>C1.000
gyrA7835c.534A>G1.000
gyrA7937c.636A>G1.000
gyrA7970c.669T>C1.000
gyrA7988c.687G>C1.000
gyrA8039c.738T>C0.981
gyrA8054c.753T>C0.982
gyrA8198c.897T>C0.983
gyrA8219c.918T>C0.983
gyrA8399c.1098T>C1.000
gyrA8756c.1455A>G1.000
gyrA8810c.1509A>C1.000
gyrA8813p.Asp504Glu1.000
gyrA8966c.1665C>G1.000
gyrA9089c.1788G>A1.000
gyrA9101c.1800A>G1.000
gyrA9143c.1842T>C1.000
gyrA9182c.1881T>C1.000
gyrA9200c.1899A>G1.000
gyrA9304p.Gly668Asp1.000
gyrA9377c.2076A>G1.000
gyrA9716c.2415T>C1.000
gyrA9740c.2439G>A1.000
gyrA9776c.2475T>C1.000
gyrA98179817AATCAGGCTCGCCCGACGACGATGCGGATCGCGTAGCGATCTGAGGAGGAATCG>A1.000
rpoB759741c.-66C>T0.982
rpoB763031c.3225T>C1.000
rpoC763660c.291T>C1.000
rpoC764152c.783C>T1.000
rpoC765478c.2109T>C1.000
Rv0678779283c.294C>T1.000
Rv0678779295c.306T>C1.000
Rv0678779431p.Asn148Gln0.981
Rv0678779472c.483C>T1.000
rpsL781395c.-165T>C1.000
rpsL781456c.-104A>G1.000
rplC800970c.162T>C1.000
rplC801003c.195G>A1.000
rplC801267c.459A>G1.000
embR1417294c.54T>C1.000
embR1417454c.-107C>A1.000
embR1417554c.-207C>G1.000
rrs1471845c.-1G>GT0.900
rrs1471851r.6t>g1.000
rrl1474438r.781a>g1.000
rrl1475266r.1609t>c1.000
inhA1674816c.615T>C1.000
rpsA1833381c.-161T>C1.000
rpsA1833554p.Thr5Ala1.000
rpsA1833568c.27G>C1.000
rpsA1834169p.Thr210Ala1.000
rpsA1834912c.1371A>G1.000
tlyA1917972c.33A>G1.000
katG2154724p.Arg463Leu1.000
katG2156055c.57G>A1.000
pncA2289104c.138T>C1.000
kasA2518132c.18C>T1.000
kasA2519287c.1173T>C0.957
eis2714714p.Ala207Thr1.000
eis2714994c.339A>G1.000
folC2747205p.Ala132Gln1.000
folC2747572c.27A>G1.000
folC2747575c.24C>G1.000
ribD2986929p.Leu31Phe1.000
thyX3067355c.591T>G1.000
thyX3067770p.Gly59Ala1.000
thyX3067980c.-35T>C1.000
thyA3074160c.312T>C1.000
thyA3074238c.234G>A1.000
thyA3074247c.225G>A1.000
ald3086788c.-32T>C1.000
ald3087122c.303T>C1.000
ald3087140c.321G>A1.000
alr3841365c.57 58insA1.000
alr3841419p.Val1Ala1.000
alr3841531c.-111A>G0.982
alr3841532c.-112A>G0.982
alr3841539c.-119C>T0.982
alr3841546c.-126C>G0.982
alr3841568c.-148G>A0.982
alr3841652c.-232A>T0.234
alr3841654c.-234A>C0.208
alr3841662c.-242A>G0.364
alr3841663c.-243G>A0.258
panD4043932p.Met117Thr1.000
panD4044243c.39G>C1.000
embC4240237c.375G>C1.000
embC4240671p.Thr270Ile1.000
embC4242643c.2781C>T1.000
embA4243377p.Ser49Arg1.000
embA4243690p.Met153Thr1.000
embA4243919c.687G>A1.000
embA4244154p.Thr308Pro1.000
embA4244312c.1080T>G1.000
embA4245023c.1791A>G1.000
embA4245701c.2469G>T1.000
embB4247590c.1077A>G1.000
embB4247646p.Glu378Ala1.000
embB4247815c.1302C>T1.000
embB4248195p.Lys561Met1.000
embB4248206p.Ser565Gly1.000
embB4248439c.1926C>T1.000
embB4248664c.2151G>A1.000
embB4248721c.2208C>T1.000
embB4248744p.Val744Ala1.000
embB4248853c.2340G>A1.000
embB4249069c.2556A>G1.000
ethA4326463c.1011G>A0.988
ethA4326740p.Arg245His1.000
ethA4327547c.-74C>TC1.000
gid4407588c.615T>C1.000
gid4408185c.18G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;