TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5de3f5075a5e3
Sample: 5de3f5075a5e3

Download results

Summary
ID: 5de3f5075a5e3
Date: Sun Dec 1 17:17:24 2019
Strain: lineage4.3.1;lineage4.2.2.1;lineage4.1.1.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.1.1.1Euro-American (X-type)X2RD183

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6022c.783G>C1.000
gyrB6025c.786A>G1.000
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6202c.963C>T0.980
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C1.000
gyrB6223c.984G>C1.000
gyrB6229c.990G>A1.000
gyrB6326p.Ser363Gly1.000
gyrB6331c.1092A>G1.000
gyrB6334c.1095G>A1.000
gyrB6343c.1104G>A1.000
gyrB6362c.1123T>C1.000
gyrB6382c.1143A>G1.000
gyrB6385c.1146G>C1.000
gyrB6610c.1371C>G1.000
gyrB6613c.1374A>G1.000
gyrB6616c.1377A>G1.000
gyrB6634c.1395T>C1.000
gyrB6637c.1398T>G1.000
gyrB6640c.1401A>C1.000
gyrB6643c.1404A>G1.000
gyrB6646c.1407C>T1.000
gyrB6655c.1416T>C1.000
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C0.910
gyrB6772c.1533C>G0.833
gyrB6775c.1536G>C0.833
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>T1.000
gyrB6949c.1710A>G1.000
gyrB6966p.Ser576Thr1.000
gyrB6968p.Asp577Gln1.000
gyrB6982c.1743A>G1.000
gyrB6985c.1746C>T1.000
gyrB6988c.1749C>G1.000
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>C1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7078c.1839A>G0.974
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrB7123c.1884C>G1.000
gyrB7126c.1887G>C1.000
gyrB7129c.1890T>G1.000
gyrB7132c.1893T>C1.000
gyrB7135c.1896G>A1.000
gyrB7136c.1897T>C1.000
gyrB7141c.1902T>G1.000
gyrB7144c.1905A>G1.000
gyrB7150c.1911G>A1.000
gyrB7153c.1914G>C1.000
gyrB7168c.1929C>G1.000
gyrB7178c.1939T>C1.000
gyrB7186c.1947C>G1.000
gyrB7189c.1950C>T1.000
gyrB7198c.1959C>T1.000
gyrB7210p.Asp657Glu1.000
gyrB7213c.1974G>A1.000
gyrB7216c.1977G>C1.000
gyrB7225c.1986T>C1.000
gyrB7234c.1995C>A1.000
gyrA7343c.42G>C0.857
gyrA7355c.54T>A1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7403c.102C>T1.000
gyrA7412c.111C>G1.000
gyrA7421c.120G>C1.000
gyrA7424c.123G>C1.000
gyrA7427c.126G>C1.000
gyrA7433c.132G>C1.000
gyrA7439c.138C>T1.000
gyrA7442c.141G>C1.000
gyrA7451c.150C>A1.000
gyrA7457c.156T>C1.000
gyrA7463c.162G>C1.000
gyrA7466c.165G>C1.000
gyrA7469c.168C>G1.000
gyrA7472c.171T>C1.000
gyrA7475c.174A>G1.000
gyrA7480p.Phe60Tyr1.000
gyrA7484c.183T>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7553c.252C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA7655c.354G>A1.000
gyrA7658c.357A>G1.000
gyrA7661c.360C>T1.000
gyrA7664c.363T>C1.000
gyrA7670c.369A>G1.000
gyrA7671p.Pro124Ala1.000
gyrA7676c.375G>C1.000
gyrA7679c.378G>C1.000
gyrA7683c.382A>C1.000
gyrA7694c.393A>G1.000
gyrA7697c.396C>T1.000
gyrA7703c.402G>C1.000
gyrA7706c.405C>G1.000
gyrA7710c.409T>C1.000
gyrA7715c.414G>C1.000
gyrA7725c.424C>T1.000
gyrA7728c.427A>C1.000
gyrA7739c.438C>T1.000
gyrA7745c.444G>A1.000
gyrA7760c.459C>T1.000
gyrA7763c.462T>G1.000
gyrA7778c.477G>C1.000
gyrA7781c.480G>C1.000
gyrA7782p.Gln161Met1.000
gyrA7797c.496C>T1.000
gyrA7802c.501C>G1.000
gyrA7811c.510C>T1.000
gyrA7814c.513C>G1.000
gyrA7832c.531G>T1.000
gyrA7835c.534A>G1.000
gyrA7841c.540C>T1.000
gyrA7847c.546G>C1.000
gyrA7853c.552C>T1.000
gyrA7859c.558A>C1.000
gyrA7865c.564T>C1.000
gyrA7868p.Ile189Met1.000
gyrA7890c.589C>T1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8218c.918 920del1.000
gyrA8228c.927G>T1.000
gyrA8234c.933T>C1.000
gyrA8235c.934T>C1.000
gyrA8240c.939C>A1.000
gyrA8246c.945C>G1.000
gyrA8247p.Ile316Val1.000
gyrA8251p.Glu317Val1.000
gyrA8253p.Ile318Leu1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8585c.1284C>T1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>C1.000
gyrA8642c.1341A>G0.935
gyrA8645c.1344C>G0.935
gyrA8649p.Arg450Lys0.935
gyrA8666c.1365G>C1.000
gyrA8672c.1371A>G0.811
gyrA8693c.1392T>C1.000
gyrA8696c.1395G>C1.000
gyrA8699c.1398A>G1.000
gyrA8783c.1482G>C1.000
gyrA8786c.1485T>G1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8804c.1503C>G1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8921c.1620C>T1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8957c.1656C>T1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
gyrA9023c.1722A>C1.000
gyrA9026c.1725G>C1.000
gyrA9029c.1728T>C1.000
gyrA9035c.1734G>C1.000
gyrA9044c.1743C>G1.000
gyrA9047c.1746C>T1.000
gyrA9062c.1761C>T1.000
gyrA9063p.Ser588Ala1.000
gyrA9068c.1767G>C1.000
gyrA9071c.1770G>C1.000
gyrA9080c.1779G>C1.000
gyrA9089c.1788G>C1.000
gyrA9095c.1794C>T1.000
gyrA9099c.1798T>C1.000
gyrA9113c.1812C>G1.000
gyrA9116c.1815G>A1.000
gyrA9119c.1818A>G1.000
gyrA9128c.1827C>G1.000
gyrA9251c.1950G>C1.000
gyrA9263c.1962C>T1.000
gyrA9267p.Asn656Gly1.000
gyrA9276c.1975C>T1.000
gyrA9281c.1980C>G1.000
gyrA9296c.1995T>C1.000
gyrA9304p.Gly668Glu1.000
gyrA9311c.2010C>T1.000
gyrA9330p.Asn677His1.000
gyrA9345c.2044A>C1.000
gyrA9351c.2050T>A1.000
gyrA9356c.2055G>C1.000
gyrA9369c.2068C>T1.000
gyrA9377c.2076A>G1.000
gyrA9383c.2082T>C1.000
gyrA9386c.2085T>C1.000
gyrA9392c.2091C>T1.000
gyrA9395c.2094G>C1.000
gyrA9413c.2112G>C1.000
rpoB759604c.-203A>G1.000
rpoB759606c.-201T>C1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760313c.507G>C1.000
rpoB760316c.510C>G1.000
rpoB760317c.511A>T1.000
rpoB760325c.519G>C1.000
rpoB760328c.522G>C1.000
rpoB760331c.525G>T1.000
rpoB760337c.531C>G1.000
rpoB760340c.534G>T0.957
rpoB760343c.537G>C0.957
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.983
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG0.983
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile0.851
rpoB760591p.Val262Ala0.851
rpoB760595c.789C>T0.851
rpoB760596p.Thr264Pro0.851
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760793c.987A>G1.000
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T0.987
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761219c.1413G>C1.000
rpoB761234c.1428G>C1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C1.000
rpoB761264c.1458C>G1.000
rpoB761273c.1467T>C1.000
rpoB761318c.1512G>T0.959
rpoB761327c.1521A>G1.000
rpoB761333c.1527G>T1.000
rpoB761339c.1533C>G0.754
rpoB761345c.1539G>C0.600
rpoB761346p.Val514Ser0.600
rpoB761354c.1548C>A1.000
rpoB761357c.1551G>T1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761369p.Glu521Asp1.000
rpoB761373p.Val523His1.000
rpoB761384c.1578C>G1.000
rpoB761393c.1587G>A1.000
rpoB761414c.1608A>G1.000
rpoB761423c.1617T>C1.000
rpoB761516c.1710G>C1.000
rpoB761528c.1722C>T1.000
rpoB761537c.1731C>G1.000
rpoB761555c.1749G>C1.000
rpoB761558c.1752C>G1.000
rpoB761564c.1758G>C1.000
rpoB761570c.1764T>C1.000
rpoB761573c.1767C>G1.000
rpoB761579c.1773G>C1.000
rpoB761612c.1806G>T1.000
rpoB761615c.1809A>C1.000
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761657c.1851C>T1.000
rpoB761666c.1860G>C1.000
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>T0.979
rpoB761681c.1875G>A1.000
rpoB761682c.1876C>T1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761720c.1914C>G0.500
rpoB761722p.Glu639Gly0.500
rpoB761724p.Glu640Lys0.500
rpoB761727p.Ser641Ala1.000
rpoB761732c.1926C>T1.000
rpoB761741c.1935G>A1.000
rpoB761750c.1944G>T1.000
rpoB761760p.Ile652Val1.000
rpoB761765c.1959T>C1.000
rpoB761772p.His656Ala1.000
rpoB761778p.Asn658Asp1.000
rpoB761791p.Arg662Gln1.000
rpoB761794p.Thr663Ser1.000
rpoB761802p.Met666Leu1.000
rpoB761813c.2007T>C1.000
rpoB761819c.2013G>C1.000
rpoB761834c.2028T>C1.000
rpoB761847p.Cys681Lys1.000
rpoB761863p.Ala686Glu1.000
rpoB761867c.2061C>G1.000
rpoB761868p.Asp688Gln1.000
rpoB761873c.2067A>G1.000
rpoB761891c.2085G>C1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T1.000
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A1.000
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762338c.2532T>C1.000
rpoB762341c.2535G>C1.000
rpoB762347c.2541T>C1.000
rpoB762350c.2544C>G1.000
rpoB762353c.2547C>T1.000
rpoB762356p.Glu850Asp1.000
rpoB762362p.Glu852Asp1.000
rpoB762368p.Glu854Asp1.000
rpoB762369c.2563T>C1.000
rpoB762374c.2568G>T1.000
rpoB762380c.2574T>C1.000
rpoB762383c.2577C>G1.000
rpoB762386c.2580C>T1.000
rpoB762392c.2586G>C1.000
rpoB762395c.2589G>T1.000
rpoB762398c.2592T>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G1.000
rpoB762510p.Ala902Pro0.968
rpoB762515c.2709C>T0.968
rpoB762533c.2727T>C1.000
rpoB762536c.2730T>C1.000
rpoB762537c.2731T>C1.000
rpoB762551c.2745C>T1.000
rpoB762557c.2751G>A1.000
rpoB762560c.2754A>C1.000
rpoB762563c.2757G>T1.000
rpoB762581c.2775T>C1.000
rpoB762587c.2781G>A1.000
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763193c.3387C>G1.000
rpoB763202c.3396A>G1.000
rpoB763205c.3399G>C1.000
rpoB763207p.Ser1134Lys1.000
rpoB763214c.3408T>C1.000
rpoB763217c.3411G>C1.000
rpoB763220c.3414G>C1.000
rpoB763226c.3420A>G1.000
rpoB763227p.Leu1141Met1.000
rpoB763235p.Glu1143Asp1.000
rpoB763238c.3432T>C1.000
rpoB763241p.Glu1145Asp1.000
rpoB763259c.3453G>C1.000
rpoB763262c.3456C>T1.000
rpoB763265c.3459G>C1.000
rpoB763268c.3462C>G1.000
rpoB763283c.3477T>C1.000
rpoB763295c.3489C>T1.000
rpoC763365c.-5G>GT1.000
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T0.986
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>A1.000
rpoC763741c.372C>T0.988
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763774c.405G>C1.000
rpoC763781p.Ser138Ala1.000
rpoC763792p.Glu141Asp1.000
rpoC763796p.Met143Leu1.000
rpoC763801c.432C>T1.000
rpoC763804c.435C>T1.000
rpoC763807c.438T>C1.000
rpoC763816c.447C>G1.000
rpoC763831c.462A>G1.000
rpoC763836p.Ala156Glu1.000
rpoC763840c.471G>C1.000
rpoC763844p.Arg159Lys1.000
rpoC763857p.Glu163Ala1.000
rpoC763861c.492C>T1.000
rpoC763870c.501C>T1.000
rpoC763872p.Gly168Ala1.000
rpoC763876p.Glu169Asp1.000
rpoC763879c.510A>G1.000
rpoC763888c.519G>T0.979
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763945c.576T>C1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T0.985
rpoC764098c.729A>G1.000
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764176c.807C>T1.000
rpoC764177p.Ile270Leu1.000
rpoC764182c.813C>T1.000
rpoC764188c.819A>G1.000
rpoC764195p.Ser276Asn1.000
rpoC764203c.834G>C1.000
rpoC764206p.Asp279Glu1.000
rpoC764207p.Val280Thr1.000
rpoC764215c.846A>C1.000
rpoC764217p.Asn283Ser1.000
rpoC764242c.873C>T1.000
rpoC764254c.885G>C1.000
rpoC764266c.897T>G1.000
rpoC764278c.909A>G1.000
rpoC764279p.Gln304Asn1.000
rpoC764284c.915G>C1.000
rpoC764285p.Gly306Thr1.000
rpoC764293c.924G>A1.000
rpoC764296c.927G>C1.000
rpoC764297p.Met310Gly1.000
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764332c.963G>A1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A1.000
rpoC764539c.1170C>T1.000
rpoC764542c.1173C>T0.985
rpoC764545c.1176C>A1.000
rpoC764560c.1191T>C1.000
rpoC764575c.1206T>G1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.986
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G1.000
rpoC764912p.Met515Gln1.000
rpoC764932c.1563C>A1.000
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC765004c.1635G>C1.000
rpoC765007c.1638T>G1.000
rpoC765008c.1639T>C1.000
rpoC765011c.1642A>T1.000
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765121c.1752G>T1.000
rpoC765129p.Tyr587Phe0.971
rpoC765143p.Val592Ile1.000
rpoC765283c.1914C>G1.000
rpoC765288p.Leu640Gln1.000
rpoC765292c.1923G>T0.980
rpoC765300p.Val644Ala0.898
rpoC765305p.Ile646Val0.898
rpoC765319c.1950A>G1.000
rpoC765323c.1955 1957del1.000
rpoC765330p.Ser654Asn1.000
rpoC765334c.1965C>T1.000
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>C1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G0.985
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His1.000
rpoC765544c.2175C>G1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T1.000
rpoC765590c.2222 2224del1.000
rpoC765648p.Phe760Tyr1.000
rpoC765658c.2289C>T1.000
rpoC765670p.His767Gln1.000
rpoC765671p.Asp768Gln1.000
rpoC765679c.2310C>T1.000
rpoC765680p.Asn771Arg1.000
rpoC765685p.Glu772Asp1.000
rpoC765694c.2325G>C1.000
rpoC765695p.Glu776Lys1.000
rpoC765700c.2331T>C1.000
rpoC765704p.Lys779Gln1.000
rpoC765709c.2340A>G1.000
rpoC765728p.Gln787Lys1.000
rpoC765734c.2365T>C1.000
rpoC765737p.Arg790Glu1.000
rpoC765751c.2382C>G1.000
rpoC765753p.Asp795Ala1.000
rpoC765826c.2457T>C1.000
rpoC765835c.2466C>T1.000
rpoC765841c.2472G>T1.000
rpoC765861p.Phe831Tyr1.000
rpoC765875p.Val836Ile1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G1.000
rpoC766021c.2652G>C1.000
rpoC766027c.2658G>C1.000
rpoC766030c.2661C>T1.000
rpoC766108c.2739C>T1.000
rpoC766109p.Pro914Ala1.000
rpoC766112p.Tyr915His1.000
rpoC766126c.2757G>C1.000
rpoC766135c.2766G>A1.000
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766456c.3087C>G1.000
rpoC766459c.3090G>T1.000
rpoC766462c.3093G>C1.000
rpoC766463p.Gln1032Thr1.000
rpoC766480c.3111C>G0.889
rpoC766483c.3114G>T0.889
rpoC766486c.3117A>T1.000
rpoC766489c.3120G>C1.000
rpoC766490p.Arg1041Lys1.000
rpoC766501c.3132G>C1.000
rpoC766507c.3138C>T1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A1.000
rpoC766528c.3159T>G1.000
rpoC766531c.3162G>C1.000
rpoC766534c.3165C>G1.000
rpoC766537c.3168G>A1.000
rpoC766540p.Asp1057Glu1.000
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766624c.3255G>C1.000
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766642c.3273C>T1.000
rpoC766645c.3276A>G1.000
rpoC766651c.3282T>G1.000
rpoC766657c.3288A>G1.000
rpoC766690c.3321G>C1.000
rpoC766693c.3324C>A1.000
rpoC766702c.3333G>C1.000
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766883p.Ser1172Ala1.000
rpoC766891c.3522G>A1.000
rpoC766894c.3525T>C1.000
rpoC766895c.3526T>C1.000
rpoC766900c.3531T>C1.000
rpoC766909c.3540G>C1.000
rpoC766911p.Ile1181Thr1.000
rpoC766915p.Asp1182Glu1.000
rpoC766918c.3549C>T1.000
rpoC766921c.3552G>C1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T0.977
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781721c.162C>T1.000
rpsL781725p.Lys56Arg1.000
rpsL781728c.169T>C1.000
rpsL781733c.174G>C1.000
rpsL781736c.177T>C1.000
rpsL781737p.Gln60Ala1.000
rpsL781742c.183C>G1.000
rpsL781751c.192G>C1.000
rpsL781754c.195G>T1.000
rpsL781760c.201T>C1.000
rpsL781763c.204C>G1.000
rpsL781766c.207C>T0.978
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rplC800796c.-13ATTGG>A1.000
rplC800801c.-8A>AC1.000
rplC800804c.-5G>GA1.000
rplC800806c.-3G>A1.000
rplC800808c.-1A>C1.000
rplC800815c.7C>A1.000
rplC800820c.12G>A1.000
rplC800823c.15C>A1.000
rplC800829c.21C>G1.000
rplC800832c.24T>C1.000
rplC800856c.48A>G1.000
rplC800865p.Glu19Asp1.000
rplC800867p.Ser20Asn1.000
rplC800872c.64A>C1.000
rplC800877c.69A>T1.000
rplC800880c.72A>C1.000
rplC800886c.78G>A1.000
rplC800892c.84G>C1.000
rplC800904c.96G>C1.000
rplC800910c.102C>T1.000
rplC800916c.108A>G1.000
rplC800928c.120C>G1.000
rplC800931c.123G>C1.000
rplC800932p.Pro42Thr1.000
rplC800937c.129A>G1.000
rplC800939p.Arg44Gln1.000
rplC800946c.138T>C1.000
rplC800949c.141T>C1.000
rplC800964c.156G>C1.000
rplC800967c.159C>G1.000
rplC800985c.177A>C1.000
rplC800994c.186C>G1.000
rplC800996p.Asn63Thr1.000
rplC801004p.Leu66Val1.000
rplC801009c.201A>C1.000
rplC801017p.Tyr70Phe1.000
rplC801019p.Thr71Ala1.000
rplC801027c.219C>G1.000
rplC801031p.Val75Ile1.000
rplC801039c.231A>G1.000
rplC801045c.237A>T1.000
rplC801046p.Tyr80His1.000
rplC801054c.246G>C1.000
rplC801183c.375C>A1.000
rplC801195c.387G>T1.000
rplC801210c.402T>C1.000
rplC801222c.414T>C1.000
rplC801231c.423C>G1.000
rplC801357c.549T>C1.000
rplC801381c.573G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a0.951
rrs1472286r.441c>g0.977
rrs1472287r.442c>t0.976
rrs1472289r.444t>g1.000
rrs1472290r.445c>g1.000
rrs1472297r.452ggtccgggttctct>g1.000
rrs1472300r.455ccgggttctctcgga>c1.000
rrs1472313r.468g>a1.000
rrs1472315r.470t>g1.000
rrs1472324r.479g>c1.000
rrs1472325r.480g>c1.000
rrs1472327r.482g>a0.976
rrs1472328r.483g>c0.977
rrs1472337r.492c>g0.908
rrs1472380r.535g>c0.883
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472537r.692c>t0.196
rrs1472598r.753a>c0.204
rrs1472612r.767g>t0.838
rrs1472616r.771g>a0.208
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t0.988
rrs1472847r.1002g>a0.988
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t0.989
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.990
rrs1473088r.1243a>g0.990
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t0.987
rrs1473105r.1260g>a0.987
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g0.987
rrs1473121r.1276t>c0.975
rrs1473123r.1278a>t0.987
rrs1473129r.1284c>t0.988
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac0.982
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at0.984
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474030r.373g>a1.000
rrl1474044r.387c>t1.000
rrl1474051r.394t>c1.000
rrl1474054r.397t>c1.000
rrl1474056r.399t>c1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474130r.473c>t0.977
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474184r.527c>a0.987
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474290r.633ttttcctctccggagg>t1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.951
rrl1474497r.840g>c0.951
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474710r.1053tggtg>t0.938
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t0.982
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475291r.1634a>c1.000
rrl1475297r.1640c>g1.000
rrl1475315r.1658a>t1.000
rrl1475337r.1680c>t1.000
rrl1475343r.1686a>g1.000
rrl1475346r.1689c>t1.000
rrl1475353r.1696a>t1.000
rrl1475355r.1698c>t1.000
rrl1475358r.1701t>c1.000
rrl1475361r.1704g>a1.000
rrl1475369r.1712g>c1.000
rrl1475377r.1720g>c1.000
rrl1475379r.1722g>t1.000
rrl1475395r.1738t>g1.000
rrl1475396r.1739c>a1.000
rrl1475397r.1740g>t1.000
rrl1475398r.1741c>g1.000
rrl1475405r.1748a>c1.000
rrl1475406r.1749t>g1.000
rrl1475407r.1750c>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475601r.1944cggaata>c0.985
rrl1475609r.1952c>cgcttg0.968
rrl1475614r.1957a>c1.000
rrl1475616r.1959a>g1.000
rrl1475617r.1960c>g1.000
rrl1475618r.1961c>a1.000
rrl1475624r.1967g>t1.000
rrl1475625r.1968g>c1.000
rrl1475626r.1969t>c1.000
rrl1475628r.1971g>t1.000
rrl1475633r.1976g>t1.000
rrl1475635r.1978g>a1.000
rrl1475637r.1980t>c1.000
rrl1475638r.1981c>g1.000
rrl1475639r.1982c>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475953r.2296a>c1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476030r.2373a>g1.000
rrl1476032r.2375c>a1.000
rrl1476033r.2376t>g1.000
rrl1476034r.2377c>g1.000
rrl1476035r.2378g>c1.000
rrl1476044r.2387t>g1.000
rrl1476045r.2388g>t1.000
rrl1476046r.2389g>t1.000
rrl1476047r.2390g>t1.000
rrl1476049r.2392c>t1.000
rrl1476056r.2399g>a1.000
rrl1476058r.2401t>c1.000
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a0.989
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
rrl1476684r.3027c>t1.000
inhA1674656p.Ser152Thr1.000
inhA1674669c.468G>T1.000
inhA1674687c.486G>C1.000
inhA1674690c.489C>G1.000
inhA1674703c.502T>C1.000
inhA1674855c.654C>G1.000
inhA1674858c.657G>A1.000
inhA1674876c.675C>T1.000
inhA1674879c.678T>C1.000
inhA1674892p.Asn231Asp1.000
inhA1674903c.702T>C1.000
inhA1674904p.Ala235Pro1.000
inhA1674909c.708G>A1.000
inhA1674912c.711G>C1.000
inhA1674915c.714C>G1.000
inhA1674942c.741T>C1.000
inhA1674949c.748C>T1.000
inhA1674954c.753G>C1.000
inhA1674957c.756G>C1.000
inhA1674963c.762G>C1.000
inhA1674966c.765T>C1.000
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
inhA1674993c.792G>T1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834534c.993C>T1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834698386EQG>386DAG0.932
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
tlyA1918269c.330C>G1.000
tlyA1918296c.357G>T1.000
katG2154315c.1797T>G1.000
katG2154327c.1785T>C1.000
katG2154618c.1494G>C1.000
katG2154624c.1488G>A1.000
katG2154627c.1485A>T1.000
katG2155068c.1044A>G1.000
katG2155080c.1032C>G1.000
katG2155092c.1020C>T1.000
katG2155097p.Tyr339Asn1.000
katG2155101c.1011G>A1.000
katG2155113c.999G>C1.000
katG2155119c.993A>G1.000
katG2155434c.678C>T1.000
katG2155443c.669C>T1.000
katG2155446c.666C>T1.000
katG2155449c.663G>C1.000
katG2155653c.459C>T1.000
katG2155673c.439G>A1.000
katG2155674c.438C>G1.000
katG2155758c.354G>T0.667
katG2155761c.351G>A0.667
katG2155766p.His116Gly0.667
katG2155785c.327A>G1.000
katG2155794c.318C>G1.000
katG2155803c.309G>A1.000
katG2155806c.306A>G1.000
katG2155811p.Leu101Met1.000
katG2155823p.His97Asn1.000
katG2155824c.288G>A1.000
katG2155828p.Tyr95Phe1.000
katG2155833c.279G>C1.000
pncA2289194c.48A>T1.000
kasA2518205p.Ser31Gly1.000
kasA2518219c.105T>A1.000
kasA2518223p.Leu37Ile1.000
kasA2518231c.117C>G1.000
kasA2518567c.453G>C1.000
kasA2518624c.510C>G1.000
kasA2518630c.516G>C1.000
kasA2518633c.519G>C1.000
kasA2518639c.525G>C1.000
kasA2518642c.528A>G1.000
kasA2518645c.531G>C1.000
kasA2518651c.537C>G1.000
kasA2518663c.549T>C1.000
kasA2518681c.567C>T1.000
kasA2518684c.570C>A1.000
kasA2518688p.Val192Met1.000
kasA2518691p.Ala193Ile1.000
kasA2518702c.588C>T1.000
kasA2518711c.597A>G1.000
kasA2518714c.600A>C1.000
kasA2518715p.Pro201Met1.000
kasA2518723c.609G>A1.000
kasA2518726c.612G>C1.000
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C0.945
kasA2518822c.708C>A0.932
kasA2518825c.711T>C1.000
kasA2518846c.732G>T0.912
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
kasA2518930c.816G>C1.000
kasA2519056c.942G>C0.900
kasA2519059c.945G>C1.000
kasA2519122c.1008G>C1.000
kasA2519131c.1017G>A1.000
kasA2519137c.1023T>G1.000
kasA2519143c.1029G>C1.000
kasA2519161c.1047G>C1.000
kasA2519305c.1191A>G1.000
kasA2519320c.1206C>T0.188
kasA2519323c.1209G>A0.188
kasA2519329c.1215C>T0.806
kasA2519332c.1218C>G0.194
kasA2519338c.1224T>C1.000
kasA2519341c.1227G>C0.200
ahpC2726336c.144G>T1.000
ahpC2726340p.Val50Ile1.000
ahpC2726348c.156T>C1.000
ahpC2726354c.162G>C1.000
ahpC2726357c.165A>G1.000
ahpC2726360c.168C>T1.000
ahpC2726366c.174G>C1.000
ahpC2726378c.186T>C1.000
ahpC2726390c.198G>C1.000
ahpC2726576c.384C>T1.000
ahpC2726593p.Val134Ala1.000
ahpC2726600c.408T>C1.000
ahpC2726613p.Asn141Asp1.000
ahpC2726619p.Glu143Ile1.000
ahpC2726624c.432C>T1.000
ahpC2726636c.444G>C1.000
ahpC2726638p.Ala149Val1.000
ahpC2726642c.450C>G1.000
ahpC2726645c.453C>A1.000
ahpC2726651c.459G>C1.000
ahpC2726657c.465A>C1.000
ahpC2726666c.474C>G1.000
ahpC2726669c.477T>C1.000
ahpC2726675c.483A>G1.000
ahpC2726678c.486G>C1.000
ahpC2726681c.489A>C1.000
ahpC2726687c.495C>T1.000
ahpC2726693c.501C>G1.000
ahpC2726696c.504C>G1.000
ahpC2726717c.525A>C1.000
folC2747281c.318T>C1.000
folC2747289p.Pro104Ala1.000
folC2747290c.309T>G1.000
folC2747299c.300G>A1.000
folC2747302c.297T>C1.000
folC2747314c.285T>G1.000
folC2747335c.264C>T1.000
folC2747338c.261G>C1.000
folC2747343p.Val86Leu1.000
folC2747344c.255C>G1.000
folC2747355p.Val82Ile1.000
folC2747361c.238G>C1.000
folC2747364p.Ala79Thr1.000
folC2747386c.213G>A1.000
folC2747505p.His32Tyr1.000
folC2747511p.Val30Ile1.000
folC2747523p.Ser26Ala1.000
thyX3067340c.606C>T1.000
thyX3067351c.595G>T1.000
thyX3067355c.591T>C1.000
thyX3067367c.579C>T1.000
thyX3067385c.561G>C1.000
thyX3067391c.555C>G1.000
thyX3067394c.552C>G1.000
thyX3067402c.544G>C1.000
thyX3067406c.540T>C1.000
thyX3067409c.537G>C1.000
thyX3067412c.534G>A1.000
thyX3067429p.Ala173Ser0.929
thyX3067430c.516G>C1.000
thyX3067439c.507T>C1.000
thyX3067445c.501G>T1.000
thyX3067457c.489G>C1.000
thyX3067646c.300G>C1.000
thyX3067652c.294A>G1.000
thyX3067655c.291C>G1.000
thyX3067658c.288G>A1.000
thyX3067661c.285G>C1.000
thyX3067669c.277G>A1.000
thyX3067676c.270G>A1.000
thyX3067679c.267G>A1.000
thyX3067682c.264C>G1.000
thyX3067685c.261T>C1.000
thyX3067694c.252C>A1.000
thyX3067862c.84G>A0.438
thyX3067869p.Thr26Ser0.400
thyA3073925c.547A>G1.000
thyA3073926c.546C>T1.000
thyA3073929c.543A>G1.000
thyA3073950c.522C>G1.000
thyA3073953c.519A>C1.000
thyA3073956c.516C>G1.000
thyA3073959c.513A>G1.000
thyA3073962c.510C>T1.000
thyA3073965c.507G>A1.000
thyA3073980c.492G>A1.000
thyA3073983c.489G>C1.000
thyA3073989c.483A>G1.000
thyA3073992c.480G>A1.000
thyA3074000p.Arg158Lys1.000
thyA3074004c.468A>G1.000
thyA3074010c.462G>C1.000
thyA3074013c.459G>A1.000
thyA3074028c.444C>G1.000
thyA3074031c.441A>G1.000
thyA3074034c.438A>G1.000
thyA3074053p.Arg140Gln1.000
thyA3074057p.Glu139Pro1.000
thyA3074070c.402G>A1.000
thyA3074076c.396G>T1.000
thyA3074082c.390C>A1.000
thyA3074089p.Ile128Asn1.000
thyA3074091c.381G>C1.000
thyA3074094c.378C>G1.000
thyA3074097c.375G>C1.000
thyA3074103c.369G>C1.000
thyA3074108p.Asp122Asn1.000
thyA3074112c.360G>A1.000
thyA3074120c.352A>G1.000
thyA3074127c.345C>T1.000
thyA3074130c.342C>G1.000
thyA3074226c.246T>C1.000
thyA3074244c.228T>C1.000
thyA3074248p.His75Arg1.000
thyA3074253p.His73Gln1.000
thyA3074256c.216C>G1.000
thyA3074264p.Gly70Arg1.000
thyA3074267p.Ile69Val1.000
thyA3074274p.Asp66Glu1.000
thyA3074277c.195G>A1.000
thyA3074286c.186A>G1.000
panD4044102c.180G>A0.857
panD4044115p.Val56Glu0.857
panD4044120c.162T>C1.000
panD4044123c.159A>G1.000
panD4044126c.156A>C1.000
panD4044138c.144A>G1.000
panD4044150c.132T>G1.000
panD4044156c.126T>C1.000
panD4044167c.115G>A1.000
panD4044171c.111G>A1.000
panD4044174c.108G>A1.000
panD4044180p.Asp34Glu1.000
panD4044188c.94C>G1.000
panD4044189c.93G>A1.000
panD4044194p.Ala30Pro1.000
panD4044195c.87A>G1.000
panD4044219c.63G>A1.000
panD4044233p.Cys17His1.000
panD4044234c.48G>C1.000
panD4044249c.33G>A1.000
panD4044266p.Leu6Met1.000
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240006c.144A>G1.000
embC4240444c.582C>G1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser0.968
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embC4241059c.1197G>A1.000
embC4241068c.1206C>T1.000
embC4241074c.1212G>C1.000
embC4241084c.1222C>T1.000
embC4241104c.1242G>A1.000
embC4241108p.Ala416Ser1.000
embC4241111p.Val417Ile1.000
embC4241121p.Ser420Asn1.000
embC4241134c.1272G>T1.000
embC4241136p.Val425Ala1.000
embC4241140c.1278A>C1.000
embC4241141p.Ile427Ala1.000
embC4241158c.1296T>C1.000
embC4241161c.1299C>G1.000
embC4241162c.1300T>C1.000
embC4241168c.1306C>T1.000
embC4241179c.1317G>C1.000
embC4241182c.1320G>C1.000
embC4241185c.1323G>C1.000
embC4241188c.1326C>T1.000
embC4241194c.1332C>G1.000
embC4241197c.1335G>C1.000
embC4241203c.1341T>C1.000
embC4241224c.1362G>A1.000
embC4241599p.Met579Ile1.000
embC4241611c.1749G>C1.000
embC4241614c.1752A>C1.000
embC4241626c.1764T>C1.000
embC4241635c.1773G>C1.000
embC4241647c.1785G>C1.000
embC4241648c.1786T>C1.000
embC4241765p.Ala635Ser1.000
embC4241770c.1908T>C1.000
embC4241791c.1929G>C1.000
embC4241809c.1947A>C1.000
embC4241818c.1956C>T1.000
embC4241824c.1962T>C1.000
embC4241828p.Lys656Gln1.000
embA4244041p.Thr270Ile1.000
embA4244043p.Ser271Thr1.000
embA4244351c.1119G>T1.000
embA4244657c.1425G>C1.000
embA4244666c.1434G>C1.000
embA4244669c.1437G>C1.000
embA4244678c.1446G>C1.000
embA4244681c.1449A>G1.000
embA4244690c.1458G>A1.000
embA4244693c.1461C>T1.000
embA4244694p.Lys488Val1.000
embA4244702c.1470C>T1.000
embA4244708c.1476C>G1.000
embA4244726p.Asp498Glu1.000
embA4244747c.1515T>G1.000
embA4245056c.1824C>G1.000
embA4245059c.1827G>T1.000
embA4245060c.1828T>C1.000
embA4245069p.Val613Ile1.000
embA4245077c.1845G>C1.000
embA4245081p.Ala617Ser1.000
embA4245101c.1869G>C1.000
embA4245125c.1893G>C1.000
embA4245388p.Ala719Gly1.000
embA4245725c.2493A>G1.000
embA4245726c.2494T>C1.000
embA4245737c.2505A>C1.000
embA4245740c.2508T>C1.000
embB4247038c.525C>A1.000
embB4247047c.534C>T1.000
embB4247062c.549G>A1.000
embB4247077c.564G>C1.000
embB4247446p.Asp311Glu1.000
embB4247452c.939C>G1.000
embB4247455c.942C>G1.000
embB4247462p.Ser317Ala1.000
embB4247470c.957T>C1.000
embB4247494c.981G>A1.000
embB4247497c.984T>C1.000
embB4247500c.987C>G1.000
embB4247512c.999T>C1.000
embB4247968c.1455C>T1.000
embB4247971c.1458C>A1.000
embB4247984p.Thr491Pro1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000
embB4249008p.Pro832Arg0.474
embB4249018c.2505T>C0.474
embB4249478p.Ala989Thr1.000
embB4249483c.2970C>G1.000
embB4249486c.2973T>A1.000
embB4249487c.2974T>C1.000
embB4249491p.Ala993Val1.000
embB4249507p.Gln998His1.000
ethA4326295c.1179C>G0.953
ethA4326310c.1164A>G0.950
ethA4326324p.Val384Ile1.000
ethA4326325c.1149C>G1.000
ethA4326329p.Tyr382Phe1.000
ethA4326331c.1143G>C1.000
ethA4326591p.Leu295Val1.000
ethA4326598c.876T>A1.000
ethA4326603p.Gln291Glu1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;