TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d19c9e731f82
Sample: 5d19c9e731f82

Download results

Summary
ID: 5d19c9e731f82
Date: Mon Jul 1 09:55:47 2019
Strain: lineage2.2.1
Drug-resistance: Drug-resistant

Drug1ResistanceSupporting Mutations (frequency)
IsoniazidRkatG p.Ser140Asn (0.94)
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
FluoroquinolonesRgyrB p.Thr500Asn (0.93), gyrA p.Ser91Ala (0.92)
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6098p.Val287Leu1.000
gyrB6103c.864G>A1.000
gyrB6104p.Ile289Val1.000
gyrB6115c.876A>G1.000
gyrB6122p.Ala295Ser1.000
gyrB6127c.888G>C1.000
gyrB6130c.891T>C1.000
gyrB6133c.894G>C1.000
gyrB6190c.951A>G1.000
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C1.000
gyrB6215p.Ser326Thr1.000
gyrB6223c.984G>C1.000
gyrB6703c.1464G>C0.909
gyrB6709c.1470A>G0.909
gyrB6722p.Arg495Lys0.923
gyrB6727c.1488G>C0.923
gyrB6730c.1491A>C0.923
gyrB6742c.1503A>G0.938
gyrB6745c.1506T>C1.000
gyrB6749p.Ala504Ser1.000
gyrB6760c.1521G>C1.000
gyrB6764p.Leu509Phe1.000
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C1.000
gyrB6797p.Gly520Ser1.000
gyrB6811c.1572C>T1.000
gyrB6841c.1602T>C1.000
gyrB6844c.1605T>C1.000
gyrB6853c.1614A>G1.000
gyrB6856c.1617T>C1.000
gyrB6859c.1620T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C0.955
gyrB6872c.1633T>C0.955
gyrB6878c.1639T>C1.000
gyrB6881c.1642T>C1.000
gyrB6898c.1659G>C0.929
gyrA7355c.54T>C1.000
gyrA7362p.Glu21Gln1.000
gyrA7377p.Arg26Asn0.963
gyrA7391c.90C>T0.969
gyrA7394c.93T>C0.970
gyrA7412c.111C>G0.943
gyrA7442c.141G>C0.912
gyrA7451c.150C>G0.906
gyrA7569p.Ala90Ser0.920
gyrA7585p.Ser95Thr1.000
gyrA7601c.300C>G0.958
gyrA7607c.306C>G0.958
gyrA7611p.Ser104Ala0.958
gyrA7614p.Leu105Met1.000
gyrA7619c.318C>G1.000
gyrA7631c.330G>C1.000
gyrA8264c.963T>C1.000
gyrA8270c.969G>C1.000
gyrA8279c.978G>C0.955
gyrA8283p.Ile328Leu0.955
gyrA8288c.987T>C0.955
gyrA8294c.993T>G0.970
gyrA8324c.1023T>C0.974
gyrA8339c.1038A>G0.974
gyrA8340p.Ala347Ser0.974
gyrA8354c.1053G>C0.974
gyrA8382p.Leu361Met0.963
gyrA8828c.1527T>C0.846
gyrA8829c.1528T>C0.867
gyrA8849c.1548C>G0.913
gyrA8852c.1551T>C0.962
gyrA8858c.1557T>C0.963
gyrA8867c.1566A>G0.926
gyrA8870c.1569G>C0.963
gyrA8873c.1572A>C0.962
gyrA8903c.1602T>C0.968
gyrA8907c.1606A>T0.935
gyrA8915c.1614A>G0.968
gyrA8930c.1629C>T0.967
gyrA8939c.1638T>C0.967
gyrA8945c.1644G>T1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys1.000
gyrA8982p.Cys561Thr1.000
gyrA9275c.1974G>A1.000
gyrA9278c.1977G>C1.000
gyrA9284c.1983T>C1.000
gyrA9293c.1992G>C1.000
gyrA9296c.1995T>C1.000
gyrA9304p.Gly668Asp1.000
gyrA9318c.2017C>T1.000
gyrA9326c.2025G>C1.000
gyrA9330p.Asn677Gln1.000
gyrA9335c.2034G>C1.000
gyrA9341c.2040C>G1.000
gyrA9345c.2044A>C1.000
gyrA9356c.2055G>C1.000
gyrA9377c.2076A>G1.000
rpoB760160p.Asp118Glu0.917
rpoB760172c.366G>C0.923
rpoB760181c.375T>G0.966
rpoB760184c.378A>G1.000
rpoB760199c.393C>G0.941
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760313c.507G>C0.900
rpoB760317c.511A>T0.900
rpoB760331c.525G>T1.000
rpoB760340c.534G>T0.889
rpoB760424c.618C>G0.985
rpoB760430c.624T>C1.000
rpoB760452p.Val216Leu0.427
rpoB760475c.669A>G1.000
rpoB760481c.675G>T1.000
rpoB760484c.678A>G1.000
rpoB760490c.684C>G0.412
rpoB760493c.687C>G0.412
rpoB760522p.Ser239Thr1.000
rpoB760527p.Gln241Glu0.977
rpoB760532c.726T>C1.000
rpoB760534p.Val243Ala1.000
rpoB760541c.735G>C1.000
rpoB760547c.741G>C1.000
rpoB760563p.Arg253Met1.000
rpoB760568c.762G>C1.000
rpoB760571c.765G>C0.971
rpoB760591p.Val262Ala1.000
rpoB760596p.Thr264Gln0.969
rpoB760611c.805T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760670c.864G>C1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760682c.876C>T1.000
rpoB760683c.877T>C1.000
rpoB760715c.909C>G1.000
rpoB760724c.918T>C1.000
rpoB760730c.924T>C1.000
rpoB760734p.Val310Ile1.000
rpoB760880c.1074G>C0.929
rpoB760883c.1077G>C0.929
rpoB760886c.1080A>G0.964
rpoB760887p.Thr361Val0.929
rpoB760916c.1110C>T0.952
rpoB760925c.1119T>C0.977
rpoB760928c.1122G>C0.978
rpoB760946c.1140A>G0.968
rpoB760958c.1152G>C0.162
rpoB760961c.1155C>G0.167
rpoB760964c.1158C>T0.169
rpoB760965p.Met387Leu0.954
rpoB760970c.1164G>C0.203
rpoB760973c.1167G>C0.684
rpoB760979c.1173G>A0.307
rpoB760982c.1176G>C0.627
rpoB760985c.1179G>C0.609
rpoB760988c.1182C>G0.969
rpoB760991c.1185G>T0.600
rpoB760997c.1191G>C0.974
rpoB761015c.1209G>C0.986
rpoB761021c.1215G>C0.592
rpoB761027c.1221A>G0.986
rpoB761034p.Thr410Ser0.400
rpoB761037c.1231T>C0.986
rpoB761042p.Ile412Met0.394
rpoB761057c.1251G>C0.586
rpoB761060c.1254C>G0.580
rpoB761063c.1257C>G0.391
rpoB761069p.Ile421Met0.377
rpoB761088c.1282A>T1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761126c.1320G>C1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C1.000
rpoB761150c.1344A>C1.000
rpoB761153c.1347G>C1.000
rpoB761165c.1359G>C1.000
rpoB761180c.1374A>C1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761201c.1395G>A0.674
rpoB761204c.1398C>G0.682
rpoB761219c.1413G>C1.000
rpoB761228c.1422C>T0.538
rpoB761234c.1428G>C0.520
rpoB761249c.1443A>G1.000
rpoB761252c.1446C>G0.490
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A0.500
rpoB761261c.1455G>C0.500
rpoB761264c.1458C>G1.000
rpoB761273c.1467T>C1.000
rpoB761279p.Ile491Met0.429
rpoB761282c.1476C>T0.421
rpoB761284p.Ser493Tyr0.421
rpoB761318c.1512G>C0.175
rpoB761322p.Ile506Val0.158
rpoB761327c.1521A>G1.000
rpoB761330c.1524G>C1.000
rpoB761345c.1539G>C1.000
rpoB761355p.Val517Arg1.000
rpoB761360c.1554T>C1.000
rpoB761362p.Ser519Thr1.000
rpoB761370p.Ile522Val1.000
rpoB761375c.1569G>C1.000
rpoB761381c.1575G>C1.000
rpoB761402c.1596C>G1.000
rpoB761936c.2130C>T1.000
rpoB761946c.2140C>T1.000
rpoB761954c.2148C>G1.000
rpoB761972c.2166C>G1.000
rpoB761997c.2191C>T1.000
rpoB762003p.Asn733Gln1.000
rpoB762008c.2202C>G1.000
rpoB762009c.2203C>T1.000
rpoB762014c.2208C>G1.000
rpoB762017c.2211A>G1.000
rpoB762018p.Glu738Gln1.000
rpoB762023c.2217C>T1.000
rpoB762027c.2221C>T1.000
rpoB762041c.2235C>T1.000
rpoB762053c.2247T>C1.000
rpoB762068c.2262C>T1.000
rpoB762080c.2274G>C1.000
rpoB762086c.2280G>C1.000
rpoB762098c.2292C>T1.000
rpoB762107c.2301C>T1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762161c.2355C>G1.000
rpoB762170c.2364C>G1.000
rpoB762176c.2370T>G1.000
rpoB762179c.2373C>T1.000
rpoB762182c.2376C>T1.000
rpoB762185c.2379G>T1.000
rpoB762200c.2394C>T1.000
rpoB762209c.2403C>G1.000
rpoB762212c.2406G>C1.000
rpoB762246c.2440C>T1.000
rpoB762254c.2448T>G1.000
rpoB762257c.2451C>G1.000
rpoB762266c.2460T>G1.000
rpoB762275c.2469C>G1.000
rpoB762278c.2472C>T1.000
rpoB762287c.2481C>T1.000
rpoB762290c.2484C>T1.000
rpoB762293c.2487T>C1.000
rpoB762297c.2491C>T1.000
rpoB762308c.2502G>C1.000
rpoB762314c.2508C>T1.000
rpoB762317c.2511A>G1.000
rpoB762320c.2514C>G0.955
rpoB762329c.2523G>C0.957
rpoB762335c.2529C>G0.958
rpoB762338c.2532T>C0.966
rpoB762347c.2541T>C0.966
rpoB762350c.2544C>T0.414
rpoB762353c.2547C>G0.969
rpoB762362p.Glu852Asp0.973
rpoB762368p.Glu854Asp0.973
rpoB762369c.2563T>C0.974
rpoB762375p.Ala857Pro0.978
rpoB762390c.2584C>T0.981
rpoB762398c.2592T>G0.982
rpoB762410c.2604T>G0.983
rpoB762416c.2610A>G0.984
rpoB762426p.Ser874Gln0.985
rpoB762449c.2643C>T1.000
rpoB762458c.2652C>G1.000
rpoB762467c.2661C>T1.000
rpoB762488c.2682G>T0.408
rpoB762489p.Val895Thr1.000
rpoB762507c.2702 2702del1.000
rpoC763375c.6C>A0.923
rpoC763402c.33C>G1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>G1.000
rpoC763414c.45T>C1.000
rpoC763420c.51G>C0.960
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763435c.66A>G1.000
rpoC763444c.75T>C1.000
rpoC763453c.84C>G0.978
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763505c.136C>T0.986
rpoC763528c.159G>T0.982
rpoC763531c.162G>C1.000
rpoC763534c.165T>C1.000
rpoC763537c.168C>G1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C0.962
rpoC763594c.225C>T0.964
rpoC763603c.234C>T0.965
rpoC763660c.291T>G0.955
rpoC763666c.297G>C0.957
rpoC763696c.327T>C0.951
rpoC763699c.330G>C0.955
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C0.979
rpoC763732c.363C>G1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763765c.396T>C1.000
rpoC763774c.405G>C1.000
rpoC763796p.Met143Leu0.974
rpoC763807c.438T>C0.978
rpoC763819c.450G>C0.975
rpoC763828c.459C>G0.964
rpoC763831c.462A>G0.962
rpoC763836p.Ala156Glu0.962
rpoC763840c.471G>C0.962
rpoC763844p.Arg159Lys0.960
rpoC763857p.Glu163Ala0.973
rpoC763872p.Gly168Ala0.975
rpoC763876p.Glu169Asp0.925
rpoC763879c.510A>C0.951
rpoC763888c.519G>C0.953
rpoC763894c.525A>G0.957
rpoC763900c.531G>C0.956
rpoC763940p.Ala191Ser0.976
rpoC763945c.576T>C0.951
rpoC763947p.Ala193Val0.950
rpoC763951c.582G>C0.947
rpoC763960c.591T>C0.947
rpoC763961p.Arg198Lys0.947
rpoC763996c.627T>C0.963
rpoC764005c.636G>C0.980
rpoC764024c.655T>C0.950
rpoC764029p.Glu220Asp0.973
rpoC764032p.Asp221Glu0.973
rpoC764040p.Ser224Asn0.975
rpoC764044c.675T>C0.975
rpoC764059c.690G>C0.974
rpoC764071c.702G>C0.971
rpoC764077c.708C>G0.971
rpoC764083c.714A>G0.957
rpoC764084p.Asn239Val0.957
rpoC764098c.729A>G1.000
rpoC764102p.Val245Thr1.000
rpoC764131c.762T>C1.000
rpoC764140c.771C>T1.000
rpoC764149c.780G>C1.000
rpoC764164p.Ile265Met1.000
rpoC764188c.819A>G1.000
rpoC764203c.834G>C1.000
rpoC764206p.Asp279Glu1.000
rpoC764207p.Val280Thr1.000
rpoC764215c.846A>C1.000
rpoC764217p.Asn283Thr1.000
rpoC764227c.858G>C1.000
rpoC764239c.870T>G1.000
rpoC764245c.876C>G1.000
rpoC764257c.888G>C1.000
rpoC764263c.894G>C1.000
rpoC764266c.897T>C1.000
rpoC764272c.903G>C1.000
rpoC764274302FQQS>302FQAN1.000
rpoC764320c.951C>T1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>C1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764410c.1041G>C0.968
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764446c.1077T>C0.964
rpoC764449c.1080G>C0.964
rpoC764452c.1083T>C0.964
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764500c.1131C>G1.000
rpoC764521c.1152T>C1.000
rpoC764536c.1167G>T1.000
rpoC764539c.1170C>G1.000
rpoC764548c.1179G>A1.000
rpoC764575c.1206T>G1.000
rpoC764578c.1209C>G1.000
rpoC764611c.1242G>C1.000
rpoC764650c.1281G>T1.000
rpoC764653c.1284G>C1.000
rpoC764662c.1293G>C1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>C1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764780c.1411A>T0.980
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>G1.000
rpoC764812c.1443C>G0.979
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764863c.1494G>C0.971
rpoC764872c.1503A>G0.973
rpoC764887c.1518G>C0.972
rpoC764888c.1519T>C0.972
rpoC764911c.1542A>G0.946
rpoC764912p.Met515Gln0.946
rpoC764935c.1566T>C0.956
rpoC764948c.1579T>C0.977
rpoC764953c.1584G>C0.955
rpoC764959c.1590G>A0.955
rpoC764968c.1599T>C0.976
rpoC765466c.2097C>T0.897
rpoC765469c.2100G>C0.871
rpoC765478c.2109T>G0.912
rpoC765751c.2382C>G0.929
rpoC765753p.Asp795Ala0.933
rpoC765772c.2403C>G0.909
rpoC765784c.2415C>G0.929
rpoC765793c.2424C>G0.906
rpoC765796c.2427C>T0.909
rpoC765811c.2442T>C0.921
rpoC765814c.2445A>T0.921
rpoC765817c.2448G>C0.921
rpoC765820c.2451G>C0.921
rpoC765844c.2475C>G0.918
rpoC765871c.2502T>G0.918
rpoC765875p.Val836Ile0.918
rpoC765904c.2535C>G0.960
rpoC765907c.2538G>T0.961
rpoC765937c.2568T>G0.977
rpoC765940c.2571A>T0.976
rpoC765946c.2577C>T0.974
rpoC765947c.2578T>C0.974
rpoC765952c.2583G>C0.977
rpoC765962c.2593T>C0.981
rpoC765967c.2598C>T0.982
rpoC765979c.2610C>G0.981
rpoC765994c.2625A>T1.000
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G1.000
rpoC766043p.Gln892Gly0.967
rpoC766280p.Ser971Gly1.000
rpoC766291c.2922G>C1.000
rpoC766309c.2940G>C0.971
rpoC766312c.2943T>C0.971
rpoC766315c.2946C>G0.971
rpoC766345c.2976T>C0.979
rpoC766348c.2979A>G0.980
rpoC766363c.2994G>C0.981
rpoC766381c.3012C>T0.980
rpoC766384c.3015A>G0.980
rpoC766390c.3021C>T0.980
rpoC766408c.3039C>T0.980
rpoC766428p.Val1020Ala0.930
rpoC766435p.Glu1022Asp0.953
rpoC766456c.3087C>G0.968
rpoC766459c.3090G>T0.968
rpoC766765c.3396A>C0.900
rpoC766774c.3405T>C0.960
rpoC766776p.Arg1136His0.962
rpoC766798c.3429C>G0.971
rpoC766799p.Ala1144Ser0.971
rpoC766804c.3435A>G0.971
rpoC766837c.3468G>C0.976
rpoC766843c.3474T>G1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766882c.3513C>T1.000
rpoC766894c.3525T>C1.000
rpoC766895c.3526T>C1.000
rpoC766945c.3576A>G1.000
rpoC766948c.3579G>C1.000
rpoC766963c.3594T>C1.000
rpoC766972c.3603G>C1.000
rpoC766973p.Ala1202Ser1.000
rpoC766978c.3609C>T1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767023c.3654C>T1.000
rpoC767059c.3690T>C1.000
rpoC767060c.3691C>A1.000
rpoC767065c.3696G>C1.000
rpoC767071c.3702C>G1.000
rpoC767074c.3705T>C1.000
rpoC767093c.3724A>T1.000
rpoC767098c.3729T>C1.000
rpoC767106p.Asn1246Ile1.000
rpoC767119c.3750A>G1.000
rpoC767158c.3789T>C1.000
rpoC767180p.Ala1271Gln1.000
rpoC767185c.3816G>T1.000
rpoC767191c.3822C>G1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>T1.000
rpoC767209c.3840T>C1.000
rpsL781628c.69T>C1.000
rpsL781631c.72G>C1.000
rpsL781637c.78C>G1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>G1.000
rpsL781679c.120C>G1.000
rpsL781682c.123T>C1.000
rpsL781700c.141G>C1.000
rpsL781706c.147T>G1.000
rpsL781709c.150G>C1.000
rpsL781736c.177T>C1.000
rpsL781760c.201T>C1.000
rpsL781769c.210G>A0.979
rpsL781802c.243G>C0.976
rpsL781805c.246G>C0.976
rpsL781808c.249C>T0.974
rpsL781814c.255C>T0.974
rpsL781817c.258G>T0.974
rpsL781829c.270G>C0.970
rpsL781832c.273T>C0.970
rpsL781841c.282C>T0.966
rpsL781859c.300T>C0.909
rpsL781862c.303G>C0.909
rpsL781865c.306G>C0.909
rpsL781868c.309T>C0.909
rpsL781871c.312G>C0.913
rpsL781880c.321C>G0.935
rpsL781892c.333A>G0.933
rpsL781898c.339A>C0.931
rpsL781907c.348T>C0.917
rpsL781916c.357T>C0.952
rpsL781929p.Gly124Ser0.938
rrs1471914r.69a>g0.968
rrs1471918r.73a>t0.977
rrs1471925r.80t>c0.963
rrs1471934r.89a>g0.965
rrs1471938r.93t>a0.976
rrs1471943r.98t>c0.977
rrs1471981r.136c>t0.991
rrs1472075r.230a>g1.000
rrs1472106r.261g>a0.987
rrs1472108r.263c>t0.987
rrs1472148r.303t>c0.988
rrs1472150r.305t>a0.988
rrs1472172r.327t>c0.987
rrs1472225r.380c>a0.988
rrs1472251r.406g>a1.000
rrs1472285r.440a>g1.000
rrs1472286r.441c>a1.000
rrs1472289r.444t>g1.000
rrs1472290r.445c>g1.000
rrs1472313r.468g>a1.000
rrs1472315r.470t>g1.000
rrs1472324r.479g>c1.000
rrs1472325r.480g>c1.000
rrs1472328r.483g>t1.000
rrs1472416r.571c>t1.000
rrs1472422r.577t>c1.000
rrs1472435r.590t>c1.000
rrs1472438r.593t>c1.000
rrs1472446r.601t>a1.000
rrs1472449r.604c>t1.000
rrs1472450r.605a>g1.000
rrs1472451r.606c>g1.000
rrs1472456r.611t>c1.000
rrs1472460r.615t>c1.000
rrs1472461r.616g>c1.000
rrs1472462r.617t>c1.000
rrs1472463r.618g>a1.000
rrs1472467r.622g>t1.000
rrs1472489r.644a>t1.000
rrs1472530r.685g>a1.000
rrs1472597r.752g>a1.000
rrs1472612r.767g>t1.000
rrs1472660r.815t>c0.990
rrs1472661r.816a>g0.980
rrs1472682r.837t>a0.978
rrs1472683r.838t>c0.978
rrs1472713r.868t>c0.981
rrs1472714r.869a>g0.981
rrs1472836r.991g>a1.000
rrs1472840r.995a>c1.000
rrs1472844r.999c>a1.000
rrs1472845r.1000g>a1.000
rrs1472847r.1002g>c1.000
rrs1472849r.1004c>g1.000
rrs1472850r.1005t>c1.000
rrs1472863r.1018t>c1.000
rrs1472873r.1028c>t1.000
rrs1472875r.1030t>g1.000
rrs1472880r.1035g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472958r.1113a>g1.000
rrs1472969r.1124a>g0.986
rrs1472973r.1128a>t1.000
rrs1472978r.1133t>c1.000
rrs1472988r.1143t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473026r.1181t>c0.988
rrs1473088r.1243a>g0.990
rrs1473100r.1255g>a1.000
rrs1473104r.1259c>t1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.946
rrs1473123r.1278a>t0.979
rrs1473173r.1328c>t0.990
rrs1473276r.1431a>g0.983
rrs1473288r.1443c>ccttg0.821
rrs1473301r.1456t>c0.982
rrl1473696r.39t>c0.987
rrl1473698r.41g>a0.987
rrl1473699r.42a>g0.987
rrl1473717r.60g>a0.990
rrl1473731r.74t>a0.991
rrl1473756r.99g>t1.000
rrl1473757r.100t>g0.991
rrl1473758r.101g>a1.000
rrl1473806r.149c>t0.991
rrl1473814r.157a>g1.000
rrl1473815r.158t>c1.000
rrl1473832r.175c>t1.000
rrl1473833r.176g>gt1.000
rrl1473844r.187c>t1.000
rrl1473870r.213g>a1.000
rrl1473871r.214t>c1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>g1.000
rrl1473888r.231t>a1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473922r.265a>t1.000
rrl1473923r.266c>g1.000
rrl1474135r.478g>a1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474174r.517a>g1.000
rrl1474183r.526t>c1.000
rrl1474184r.527c>t1.000
rrl1474186r.529a>g1.000
rrl1474201r.544t>c1.000
rrl1474218r.561t>a1.000
rrl1474249r.592g>t1.000
rrl1474266r.609t>c1.000
rrl1474269r.612c>t1.000
rrl1474348r.691c>t1.000
rrl1474351r.694g>t1.000
rrl1474353r.696a>g1.000
rrl1474359r.702c>g1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474402r.745t>c0.979
rrl1474412r.755gacccacacgcgcatacgcgcgt>g1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474435r.778g>t0.944
rrl1474444r.787g>c0.955
rrl1474454r.797g>a0.983
rrl1474496r.839c>a1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>t1.000
rrl1474537r.880g>a1.000
rrl1474626r.969t>c0.986
rrl1474627r.970g>a0.986
rrl1474632r.975g>t0.986
rrl1474638r.981c>g0.986
rrl1474639r.982g>c0.986
rrl1474664r.1007g>t0.983
rrl1474666r.1009t>g0.983
rrl1474670r.1013c>g0.984
rrl1474676r.1019t>a0.983
rrl1474679r.1022g>c0.967
rrl1474684r.1027t>c0.967
rrl1474687r.1030c>a0.968
rrl1474710r.1053t>g0.980
rrl1474711r.1054g>t0.980
rrl1474717r.1060a>g0.960
rrl1474734r.1077g>t0.986
rrl1474749r.1092c>t1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474823r.1166c>g1.000
rrl1474824r.1167a>g1.000
rrl1474830r.1173a>g1.000
rrl1474903r.1246t>c1.000
rrl1474904r.1247g>c1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1474953r.1296ca>c1.000
rrl1475060r.1403ac>a1.000
rrl1475065r.1408g>a1.000
rrl1475067r.1410a>g1.000
rrl1475076r.1419c>a1.000
rrl1475079r.1422t>c1.000
rrl1475081r.1424c>t1.000
rrl1475090r.1433a>t1.000
rrl1475113r.1456c>t1.000
rrl1475114r.1457c>t1.000
rrl1475116r.1459g>a1.000
rrl1475419r.1762c>t1.000
rrl1475422r.1765a>g1.000
rrl1475429r.1772g>a1.000
rrl1475436r.1779c>t1.000
rrl1475443r.1786g>a0.973
rrl1475452r.1795c>a0.974
rrl1475460r.1803a>g0.975
rrl1475475r.1818c>t0.975
rrl1475479r.1822c>t0.975
rrl1475480r.1823a>t0.975
rrl1475481r.1824c>g0.975
rrl1475482r.1825a>g0.975
rrl1475483r.1826c>t0.975
rrl1475526r.1869c>a0.988
rrl1475532r.1875a>g0.988
rrl1475538r.1881t>a0.988
rrl1475539r.1882a>t0.988
rrl1475545r.1888t>g0.989
rrl1475550r.1893a>g0.989
rrl1475649r.1992a>g1.000
rrl1475655r.1998t>a0.985
rrl1475659r.2002g>a1.000
rrl1475699r.2042c>t0.979
rrl1475735r.2078t>c0.978
rrl1475753r.2096c>g0.953
rrl1475758r.2101a>g0.975
rrl1475761r.2104c>g1.000
rrl1475769r.2112t>c0.952
rrl1475775r.2118g>t0.971
rrl1475791r.2134a>g0.976
rrl1475883r.2226a>t0.980
rrl1475884r.2227a>g0.980
rrl1475897r.2240t>c0.981
rrl1475916r.2259c>t0.991
rrl1475975r.2318c>t0.989
rrl1475977r.2320a>g0.989
rrl1475988r.2331a>g0.989
rrl1476031r.2374c>g1.000
rrl1476033r.2376t>c1.000
rrl1476034r.2377c>a1.000
rrl1476035r.2378g>c1.000
rrl1476044r.2387t>g1.000
rrl1476045r.2388g>t1.000
rrl1476048r.2391g>t1.000
rrl1476049r.2392c>g1.000
rrl1476058r.2401t>c1.000
rrl1476086r.2429g>a0.989
rrl1476088r.2431a>t1.000
rrl1476099r.2442a>g1.000
rrl1476100r.2443a>g1.000
rrl1476103r.2446c>a1.000
rrl1476110r.2453g>t1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476194r.2537a>g0.988
rrl1476200r.2543a>t0.987
rrl1476201r.2544c>t0.988
rrl1476214r.2557g>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476245r.2588c>t1.000
rrl1476252r.2595t>g1.000
rrl1476255r.2598a>g1.000
rrl1476256r.2599a>g1.000
rrl1476260r.2603a>g1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>g1.000
rrl1476298r.2641c>g1.000
rrl1476300r.2643g>a0.985
rrl1476301r.2644a>t1.000
rrl1476309r.2652g>c1.000
rrl1476428r.2771c>t0.988
rrl1476539r.2882a>g0.977
rrl1476540r.2883c>g0.977
rrl1476584r.2927c>t0.988
rrl1476585r.2928a>g0.988
rrl1476596r.2939c>t0.987
rrl1476601r.2944g>a0.987
rrl1476608r.2951c>t0.986
rrl1476614r.2957a>t0.985
rrl1476619r.2962c>t0.984
rrl1476628r.2971t>a0.981
rrl1476629r.2972c>a0.981
rrl1476630r.2973a>g0.981
rrl1476661r.3004a>g1.000
rrl1476665r.3008t>g1.000
rrl1476666r.3009c>t1.000
rrl1476675r.3018c>g1.000
rpsA1833571c.30A>G1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>C1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833607c.66T>C1.000
rpsA1833616c.75A>C1.000
rpsA1833619c.78A>C1.000
rpsA1833623p.Lys28Ala1.000
rpsA1833646c.105T>C1.000
rpsA1833664c.123C>A1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>C1.000
rpsA1833682c.141C>T1.000
rpsA1833685c.144G>C1.000
rpsA1833694c.153G>C1.000
rpsA1833697c.156C>G1.000
rpsA1833709c.168C>T0.944
rpsA1833727c.186G>C1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833828p.Lys96Arg0.200
rpsA1833832c.291G>A0.900
rpsA1833838c.297G>C0.900
rpsA1833841c.300C>G0.900
rpsA1833847c.306C>G0.909
rpsA1833850c.309C>G0.909
rpsA1833856c.315A>G0.909
rpsA1833859c.318C>G0.917
rpsA1833877c.336C>G0.966
rpsA1833894p.Ala118Glu0.970
rpsA1833928c.387G>C0.975
rpsA1833949c.408T>C0.956
rpsA1833970c.429G>C1.000
rpsA1833979c.438T>C1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>G1.000
rpsA1834012c.471G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834034p.Ile165Val0.980
rpsA1834069c.528G>C0.981
rpsA1834093c.552G>C0.979
rpsA1834099c.558C>G1.000
rpsA1834105c.564C>T1.000
rpsA1834135c.594G>C1.000
rpsA1834186c.645C>G1.000
rpsA1834189c.648G>C1.000
rpsA1834213c.672G>C1.000
rpsA1834222c.681T>C1.000
rpsA1834225c.684C>G1.000
rpsA1834231c.690T>C1.000
rpsA1834240c.699T>C1.000
rpsA1834249c.708T>C1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834294c.753G>C1.000
rpsA1834298p.Gln253Glu1.000
rpsA1834303c.762T>C1.000
rpsA1834306c.765T>C1.000
rpsA1834307p.Asp256Asn1.000
rpsA1834340p.Met267Leu1.000
rpsA1834348c.807T>C1.000
rpsA1834354c.813G>C1.000
rpsA1834357c.816T>G1.000
rpsA1834361c.820T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>C1.000
rpsA1834378c.837T>C1.000
rpsA1834396c.855G>T1.000
rpsA1834399p.His286Gln1.000
rpsA1834411c.870T>C1.000
rpsA1834423c.882G>C1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834465c.924T>C1.000
rpsA1834468c.927A>G1.000
rpsA1834489c.948T>C1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>C1.000
rpsA1834555c.1014T>G1.000
rpsA1834561c.1020C>G1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C0.955
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834650p.Thr370Ser0.944
rpsA1834652p.Glu371Pro0.944
rpsA1834667p.Ala376Ser0.976
rpsA1834690c.1149T>C1.000
rpsA1834732c.1191T>C1.000
rpsA1834733p.Ala398Pro0.977
rpsA1834738c.1197A>G0.977
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834761p.Phe407Tyr1.000
rpsA1834765c.1224A>G1.000
rpsA1834774c.1233C>G1.000
rpsA1834776p.Ala412Asp1.000
rpsA1834780c.1239A>G1.000
rpsA1834786c.1245A>G0.950
rpsA1834787p.Ala416Ser0.950
rpsA1834792c.1251G>C1.000
rpsA1834810c.1269C>T1.000
rpsA1834813c.1272G>C0.947
rpsA1834831c.1290G>C0.923
katG2155674c.438C>G0.941
katG2155680c.432C>G0.941
katG2155691c.421A>G0.941
katG2155696p.Ala139Gly1.000
katG2155716c.396A>G1.000
katG2155722c.390C>A1.000
katG2155728c.384C>G1.000
ahpC2726564c.372C>G1.000
ahpC2726579c.387T>C0.944
ahpC2726582c.390G>C0.955
ahpC2726593p.Val134Ala0.963
ahpC2726600c.408T>C1.000
ahpC2726612c.420C>G0.971
ahpC2726638p.Ala149Val0.976
ahpC2726654c.462G>C1.000
ahpC2726657c.465A>C1.000
ahpC2726669c.477T>C1.000
ahpC2726675c.483A>G1.000
ahpC2726681c.489A>G1.000
ahpC2726696c.504C>G1.000
ahpC2726717c.525A>C1.000
thyA3073910p.Met188Val0.700
thyA3073925c.547A>G0.833
thyA3073929c.543A>G0.846
thyA3073932c.540G>A0.857
thyA3073953c.519A>C0.812
thyA3073959c.513A>G0.812
thyA3073968c.504G>C0.812
thyA3073977c.495T>C0.812
thyA3073989c.483A>G0.812
thyA3073994c.478C>G0.812
thyA3074000p.Arg158Lys0.812
thyA3074004c.468A>G0.765
thyA3074010c.462G>C0.765
thyA3074031c.441A>G0.800
thyA3074034c.438A>G0.786
thyA3074042p.Pro144Ala0.727

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;