TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d19ceaa2c676
Sample: 5d19ceaa2c676

Download results

Summary
ID: 5d19ceaa2c676
Date: Mon Jul 1 10:16:21 2019
Strain: lineage2.2
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6091c.852G>T1.000
gyrB6100c.861G>C1.000
gyrB6115c.876A>G1.000
gyrB6122p.Ala295Ser1.000
gyrB6127c.888G>A0.500
gyrB6130c.891T>C1.000
gyrB6133c.894G>C0.506
gyrB6154c.915C>G0.600
gyrB6160c.921C>G0.600
gyrB6172c.933C>T0.400
gyrB6181c.942C>T0.408
gyrB6182p.Thr315Val0.412
gyrB6202c.964 964del0.989
gyrA8888c.1587C>G0.700
rpoB760064c.258G>A1.000
rpoB760070c.264T>G1.000
rpoB760088c.282C>G0.962
rpoB760101c.295T>C1.000
rpoB760106c.300G>C0.966
rpoB760112c.306T>C1.000
rpoB760120p.Arg105His0.972
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>C1.000
rpoB760140p.Pro112Ser0.980
rpoB760148p.Asp114Glu0.982
rpoB760172c.366G>C0.985
rpoB760181c.375T>G1.000
rpoB760184c.378A>C1.000
rpoB760199c.393C>G0.987
rpoB760202c.396G>A0.987
rpoB760233c.427A>T1.000
rpoB760241c.435G>C1.000
rpoB760244c.438G>C1.000
rpoB760253c.447T>C1.000
rpoB760265p.Met153Ile1.000
rpoB760274p.Glu156Asp1.000
rpoB760282p.Thr159Ser1.000
rpoB760298c.492G>C1.000
rpoB760368p.Ser188Ala0.952
rpoB760376p.Asp190Glu0.957
rpoB760382c.576G>C0.960
rpoB760385c.579G>C0.963
rpoB760390p.Ser195Thr0.966
rpoB760394c.588C>G0.970
rpoB760400c.594G>C0.975
rpoB760407p.Ser201Gly0.978
rpoB760412c.606C>T1.000
rpoB760424c.618C>G1.000
rpoB760430c.624T>C1.000
rpoB760457c.651C>T0.984
rpoB760475c.669A>G0.981
rpoB760478c.672C>T1.000
rpoB760481c.675G>T1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G1.000
rpoB760508c.702G>T1.000
rpoB760511c.705G>C1.000
rpoB760520c.714C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760526c.720G>A1.000
rpoB760527p.Gln241Glu1.000
rpoB760532c.726T>C1.000
rpoB760533p.Val243Ser1.000
rpoB760541c.735G>C1.000
rpoB760916c.1110C>T0.923
rpoB760919c.1113C>T1.000
rpoB760928c.1122G>C1.000
rpoB760940c.1134G>C1.000
rpoB760946c.1140A>G1.000
rpoB760955c.1149C>T1.000
rpoB760958c.1152G>C1.000
rpoB760965p.Met387Leu1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761003c.1197C>G1.000
rpoB761015c.1209G>C1.000
rpoB761192c.1386C>G1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>C1.000
rpoB761213c.1407G>C1.000
rpoB761234c.1428G>C1.000
rpoB761240c.1434C>T0.982
rpoB761249c.1443A>G1.000
rpoB761261c.1455G>T1.000
rpoB761264c.1458C>G1.000
rpoB761282c.1476C>A1.000
rpoB761288c.1482G>C1.000
rpoB761318c.1512G>C1.000
rpoB761327c.1521A>G1.000
rpoB761345c.1539G>C1.000
rpoB761930c.2124G>A0.909
rpoB761936c.2130C>T0.929
rpoB761948c.2142G>C1.000
rpoB761954c.2148C>G1.000
rpoB761972c.2166C>T0.970
rpoB761990c.2184G>C0.941
rpoB762000c.2194T>A0.941
rpoB762003p.Asn733Gln0.941
rpoB762008c.2202C>G1.000
rpoB762011c.2205G>C0.970
rpoB762014c.2208C>G1.000
rpoB762017c.2211A>G1.000
rpoB762020c.2214G>A0.972
rpoB762026c.2220G>A0.981
rpoB762053c.2247T>C1.000
rpoB762062c.2256T>C1.000
rpoB762065c.2259T>C1.000
rpoB762080c.2274G>C0.985
rpoB762086c.2280G>C1.000
rpoB762098c.2292C>G0.985
rpoB762114p.Ile770Val0.983
rpoB762122c.2316C>T0.965
rpoB762128c.2322G>C0.965
rpoB762140c.2334G>C0.981
rpoB762143c.2337T>C0.981
rpoB762149c.2343G>C0.981
rpoB762161c.2355C>T0.982
rpoB762176c.2370T>C0.984
rpoB762179c.2373C>T0.966
rpoB762185c.2379G>C0.984
rpoB762206c.2400C>A0.951
rpoB762218c.2412T>C0.944
rpoB762233c.2427G>C0.958
rpoB762239c.2433G>A0.935
rpoB762245c.2439G>T0.952
rpoB762251c.2445G>C0.925
rpoB762254c.2448T>C0.925
rpoB762257c.2451C>G0.946
rpoB762275c.2469C>T0.968
rpoB762284c.2478G>T0.963
rpoB762293c.2487T>G0.958
rpoB762299c.2493G>C0.917
rpoB762308c.2502G>C0.895
rpoB762799p.Ala998Gly1.000
rpoB762812c.3006C>G1.000
rpoB762814p.Met1003Thr1.000
rpoB762818c.3012C>G1.000
rpoB762827c.3021G>T1.000
rpoB762830c.3024C>T1.000
rpoB762831c.3025A>T1.000
rpoB762857c.3051C>G1.000
rpoB762858p.Thr1018Ser1.000
rpoB762863c.3057T>C1.000
rpoB762881p.Met1025Ile0.982
rpoB762899c.3093G>C0.985
rpoB762917c.3111C>T0.987
rpoB762929c.3123G>T1.000
rpoB762959c.3153G>C0.984
rpoB762971c.3165G>C0.983
rpoB762989c.3183G>A0.980
rpoB762995c.3189G>T0.959
rpoB763007c.3201C>T0.978
rpoB763022c.3216C>G0.976
rpoB763028c.3222T>C0.976
rpoB763040c.3234C>G0.976
rpoB763053c.3247T>C0.971
rpoB763058c.3252C>G0.967
rpoB763070c.3264T>C0.952
rpoB763074p.Thr1090Val0.950
rpoB763094c.3288G>C0.976
rpoB763103c.3297G>C0.979
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763160c.3354G>C1.000
rpoB763166c.3360A>G1.000
rpoB763169c.3363A>G1.000
rpoB763178c.3372G>A1.000
rpoB763181c.3375G>C1.000
rpoB763185c.3379C>T1.000
rpoC763456c.87A>G0.971
rpoC763468c.99G>C0.975
rpoC763486c.117T>C0.957
rpoC763492c.123G>T0.959
rpoC763528c.159G>A0.964
rpoC763531c.162G>T0.962
rpoC763546c.177A>G0.985
rpoC763570c.201G>C0.986
rpoC763615c.246G>C0.985
rpoC763619p.Arg84Lys0.985
rpoC763633c.264T>C0.985
rpoC763660c.291T>G0.984
rpoC763669c.300C>G0.964
rpoC763699c.330G>A0.846
rpoC763702c.333C>G0.833
rpoC763703c.334T>A0.833
rpoC763708c.339G>C0.833
rpoC763714c.345G>C0.833
rpoC763717c.348T>C0.833
rpoC763723c.354G>C0.833
rpoC763729c.360G>C0.833
rpoC763732c.363C>G0.833
rpoC763741c.372C>T0.833
rpoC763744c.375G>C0.833
rpoC763765c.396T>C0.909
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764153p.Gln262Lys1.000
rpoC764161c.792G>C1.000
rpoC764162p.Ile265Leu1.000
rpoC764169p.Asn267Thr1.000
rpoC764188c.819A>G0.969
rpoC764203c.834G>C0.929
rpoC764206p.Asp279Glu0.923
rpoC764207p.Val280Thr0.923
rpoC764215c.846A>C0.929
rpoC764217p.Asn283Ser0.929
rpoC764221c.852C>T0.933
rpoC764227c.858G>C0.972
rpoC764239c.870T>G0.977
rpoC764245c.876C>G0.980
rpoC764254c.885G>A0.979
rpoC764257c.888G>C0.978
rpoC764263c.894G>C0.979
rpoC764266c.897T>C0.980
rpoC764278c.909A>G0.983
rpoC764297p.Met310Leu0.986
rpoC764308c.939G>T0.986
rpoC764320c.951C>G0.987
rpoC764344c.975C>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764395c.1026C>T1.000
rpoC764405c.1036A>C1.000
rpoC764410c.1041G>C1.000
rpoC764428c.1059G>C1.000
rpoC764452c.1083T>C0.300
rpoC764455c.1086G>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G0.917
rpoC764497c.1128A>G1.000
rpoC764500c.1131C>G1.000
rpoC764503c.1134G>T1.000
rpoC764509c.1140G>C1.000
rpoC764521c.1152T>C1.000
rpoC764536c.1167G>T1.000
rpoC764539c.1170C>G1.000
rpoC764548c.1179G>A1.000
rpoC764575c.1206T>G1.000
rpoC764578c.1209C>T1.000
rpoC764602c.1233C>G1.000
rpoC764605c.1236G>T1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764662c.1293G>C1.000
rpoC764686c.1317C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>C0.982
rpoC764749c.1380G>C0.965
rpoC764752c.1383G>C0.965
rpoC764755c.1386C>T0.965
rpoC764756c.1387C>T0.965
rpoC764764p.His465Gln0.965
rpoC764782c.1413C>T0.963
rpoC764785c.1416C>A0.963
rpoC764797c.1428G>C0.955
rpoC764803c.1434C>T0.946
rpoC764824c.1455T>C0.905
rpoC764827c.1458G>C0.905
rpoC764854c.1485G>C0.900
rpoC764948c.1579T>C1.000
rpoC764968c.1599T>C1.000
rpoC764980c.1611C>T1.000
rpoC765004c.1635G>T0.982
rpoC765007c.1638T>G0.982
rpoC765008c.1639T>C0.982
rpoC765013c.1644C>T0.982
rpoC765016c.1647C>G0.982
rpoC765019c.1650A>G0.982
rpoC765034c.1665T>G0.981
rpoC765040c.1671T>C0.979
rpoC765041c.1672T>C0.978
rpoC765052c.1683C>G0.976
rpoC765055c.1686C>G0.974
rpoC765073c.1704G>C0.955
rpoC765076c.1707A>G0.947
rpoC765079c.1710T>G0.938
rpoC765082c.1713G>T0.938
rpoC765085c.1716T>C0.938
rpoC765089c.1720T>C0.938
rpoC765103c.1734G>T0.923
rpoC765466c.2097C>T1.000
rpoC765469c.2100G>C1.000
rpoC765472c.2103C>A1.000
rpoC765478c.2109T>C1.000
rpoC765493c.2124G>T1.000
rpoC765499c.2130C>G1.000
rpoC765525p.Ala719Val1.000
rpoC765541c.2172C>T1.000
rpoC765547c.2178C>T1.000
rpoC765548c.2179A>T1.000
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765559c.2190G>C1.000
rpoC765580c.2211G>C1.000
rpoC765835c.2466C>T1.000
rpoC765875p.Val836Ile0.980
rpoC765886c.2517C>G0.961
rpoC765892c.2523T>C0.960
rpoC765898c.2529C>T0.956
rpoC765907c.2538G>C0.966
rpoC765908p.Leu847Ala0.929
rpoC765928c.2559C>G0.960
rpoC765934c.2565C>T0.909
rpoC765940c.2571A>T0.952
rpoC766321c.2952C>G1.000
rpoC766333c.2964G>C1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766357c.2988C>T0.964
rpoC766361p.Val998Ile0.964
rpoC766369c.3000C>A0.947
rpoC766375c.3006C>G0.950
rpoC766381c.3012C>T0.951
rpoC766384c.3015A>G0.955
rpoC766390c.3021C>T0.958
rpoC766402c.3033C>G0.959
rpoC766408c.3039C>T0.959
rpoC766411c.3042C>G0.959
rpoC766435p.Glu1022Asp0.959
rpoC766456c.3087C>G0.952
rpoC766459c.3090G>T0.951
rpoC766462c.3093G>C0.951
rpoC766471c.3102G>C0.946
rpoC766798c.3429C>G0.923
rpoC766799p.Ala1144Ser0.923
rpoC766804c.3435A>G0.923
rpoC766835p.Val1156Thr0.857
rpoC766843c.3474T>G0.857
rpoC766846c.3477C>T0.857
rpoC766858c.3489C>T0.857
rpoC766861c.3492G>C0.857
rpoC766867c.3498C>G0.857
rpoC766882c.3513C>T0.857
rpoC766960c.3591C>T0.909
rpoC766963c.3594T>C0.923
rpoC766972c.3603G>T0.435
rpoC766978c.3609C>A0.962
rpoC766987c.3618G>C0.963
rpoC766990c.3621G>C0.964
rpoC766996c.3627C>T0.967
rpoC767002c.3633G>C0.968
rpoC767008c.3639G>C0.970
rpoC767017c.3648C>G0.973
rpoC767023p.Asp1218Glu0.974
rpoC767026c.3657G>C0.977
rpoC767059c.3690T>G0.982
rpoC767062c.3693C>T0.982
rpoC767065c.3696G>C0.982
rpoC767080c.3711G>C0.981
rpoC767087p.Cys1240Ser1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767106p.Asn1246Ile1.000
rpoC767119c.3750A>G1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767155c.3786C>G0.950
rpoC767167c.3798C>G0.933
rpsL781781c.222G>C0.818
rpsL781802c.243G>C0.200
rpsL781832c.273T>C0.900
rpsL781838c.279G>T0.900
rpsL781845p.Lys96Arg0.900
rpsL781859c.300T>C0.900
rpsL781865c.306G>C0.900
rpsL781868c.309T>C0.900
rpsL781871c.312G>C0.900
rpsL781884p.Asn109Asp0.900
rpsL781892c.333A>G0.900
rpsL781898c.339A>T0.900
rpsL781907c.348T>C0.900
rrs1471923r.78t>c1.000
rrs1471924r.79c>cca0.967
rrs1471925r.80t>g1.000
rrs1471929r.84c>g1.000
rrs1471930r.85g>c1.000
rrs1471931r.86g>t1.000
rrs1471932r.87a>g1.000
rrs1471934r.89a>g1.000
rrs1471979r.134t>c0.987
rrs1471980r.135g>t0.987
rrs1471981r.136c>g0.987
rrs1471986r.141c>t0.987
rrs1472075r.230a>g1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472137r.292g>a1.000
rrs1472150r.305t>a1.000
rrs1472151r.306c>t1.000
rrs1472172r.327t>c1.000
rrs1472251r.406g>a0.977
rrs1472286r.441c>g0.979
rrs1472288r.443a>t0.936
rrs1472289r.444t>c0.978
rrs1472313r.468g>a0.978
rrs1472315r.470t>g0.980
rrs1472326r.481t>a0.976
rrs1472328r.483g>c1.000
rrs1472382r.537g>a0.990
rrs1472422r.577t>c0.989
rrs1472435r.590t>c0.975
rrs1472438r.593t>c0.974
rrs1472439r.594c>t0.974
rrs1472462r.617t>c0.976
rrs1472463r.618g>a0.976
rrs1472464r.619a>g0.976
rrs1472471r.626g>a0.989
rrs1472489r.644a>t0.991
rrs1472497r.652g>a0.991
rrs1472530r.685g>a1.000
rrs1472580r.735c>t0.990
rrs1472612r.767g>t0.981
rrs1472677r.832c>a1.000
rrs1472680r.835c>t1.000
rrs1472682r.837t>a1.000
rrs1472683r.838t>c1.000
rrs1472686r.841g>a1.000
rrs1472836r.991g>a0.935
rrs1472840r.995a>c0.949
rrs1472841r.996g>a0.949
rrs1472857r.1012a>g0.949
rrs1472859r.1014g>c0.933
rrs1472860r.1015c>t0.934
rrs1472873r.1028c>t0.969
rrs1472874r.1029c>t0.969
rrs1472875r.1030t>g0.969
rrs1472880r.1035g>a0.971
rrs1472956r.1111t>c0.983
rrs1472957r.1112c>t0.982
rrs1472958r.1113a>g0.982
rrs1472960r.1115g>a0.982
rrs1472969r.1124a>g0.982
rrs1472970r.1125c>g0.982
rrs1472973r.1128a>t0.982
rrs1472977r.1132g>c0.982
rrs1472978r.1133t>c0.982
rrs1472986r.1141c>t1.000
rrs1472988r.1143t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473081r.1236c>t0.991
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>g1.000
rrs1473100r.1255g>a0.987
rrs1473104r.1259c>t1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.971
rrs1473123r.1278a>t1.000
rrs1473130r.1285g>a0.991
rrs1473145r.1300c>t0.991
rrs1473166r.1321g>a1.000
rrs1473276r.1431a>g1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>gt0.992
rrl1473699r.42a>g0.900
rrl1473719r.62g>t0.976
rrl1473724r.67t>c0.977
rrl1473731r.74t>g0.978
rrl1473732r.75g>t0.978
rrl1473743r.86c>t0.981
rrl1473750r.93c>a0.981
rrl1473756r.99g>t1.000
rrl1473757r.100t>g1.000
rrl1473758r.101g>t1.000
rrl1473768r.111a>g1.000
rrl1473770r.113t>g1.000
rrl1473806r.149c>t0.986
rrl1473811r.154c>a0.986
rrl1473812r.155g>c0.985
rrl1473815r.158t>g0.985
rrl1473822r.165a>g0.984
rrl1473832r.175c>t0.984
rrl1473844r.187c>t0.991
rrl1473870r.213g>a0.991
rrl1473876r.219g>a0.991
rrl1473898r.241c>t0.989
rrl1473899r.242a>g0.989
rrl1473916r.259c>a0.988
rrl1473922r.265a>g0.985
rrl1473923r.266c>g0.985
rrl1473934r.277g>a0.974
rrl1473935r.278c>t0.973
rrl1473936r.279a>g0.973
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473949r.292c>t0.611
rrl1473968r.311c>t1.000
rrl1473971r.314g>t1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t0.979
rrl1474151r.494c>t0.981
rrl1474174r.517a>g0.986
rrl1474181r.524c>t0.986
rrl1474183r.526t>c0.986
rrl1474184r.527c>t0.986
rrl1474186r.529a>g0.987
rrl1474201r.544t>c0.989
rrl1474202r.545t>a0.989
rrl1474218r.561t>a0.989
rrl1474249r.592g>t0.986
rrl1474264r.607t>g0.952
rrl1474265r.608g>a0.952
rrl1474266r.609t>c0.952
rrl1474269r.612c>t0.952
rrl1474348r.691c>t1.000
rrl1474351r.694g>t1.000
rrl1474353r.696a>c1.000
rrl1474354r.697c>t1.000
rrl1474355r.698a>c1.000
rrl1474356r.699t>g1.000
rrl1474359r.702c>g1.000
rrl1474387r.730c>t1.000
rrl1474411r.754cgacccacacgcgcatacgcgcgt>c0.974
rrl1474496r.839c>t1.000
rrl1474497r.840g>c1.000
rrl1474506r.849c>g1.000
rrl1474507r.850g>t1.000
rrl1474529r.872a>c0.991
rrl1474530r.873g>a0.991
rrl1474537r.880g>a0.990
rrl1474539r.882c>t0.990
rrl1474540r.883t>g0.991
rrl1474552r.895c>t0.992
rrl1474627r.970g>c0.988
rrl1474628r.971c>t0.988
rrl1474632r.975g>t0.988
rrl1474721r.1064g>a1.000
rrl1474722r.1065t>g1.000
rrl1474734r.1077g>t1.000
rrl1474740r.1083g>c0.987
rrl1474747r.1090c>g0.987
rrl1474749r.1092c>t0.987
rrl1474760r.1103a>g0.989
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a0.989
rrl1474812r.1155g>a1.000
rrl1474823r.1166c>g1.000
rrl1474824r.1167a>g0.988
rrl1474830r.1173a>g0.989
rrl1474903r.1246t>c1.000
rrl1474904r.1247g>c1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>t0.966
rrl1475064r.1407g>a0.949
rrl1475076r.1419c>a0.974
rrl1475079r.1422t>c0.974
rrl1475080r.1423g>t0.974
rrl1475081r.1424c>g0.975
rrl1475090r.1433a>t0.986
rrl1475114r.1457c>t1.000
rrl1475116r.1459g>a1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475538r.1881t>a1.000
rrl1475539r.1882a>t1.000
rrl1475545r.1888t>g1.000
rrl1475550r.1893a>g1.000
rrl1475649r.1992a>g0.984
rrl1475655r.1998t>a0.985
rrl1475659r.2002g>a1.000
rrl1475699r.2042c>t0.989
rrl1475753r.2096c>g0.973
rrl1475758r.2101a>t0.971
rrl1475761r.2104c>cttcgg0.971
rrl1475769r.2112t>c1.000
rrl1475775r.2118g>t1.000
rrl1475883r.2226a>t1.000
rrl1475884r.2227a>g1.000
rrl1475897r.2240t>c1.000
rrl1475916r.2259c>g1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475997r.2340a>t0.990
rrl1476056r.2399g>a0.983
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>t1.000
rrl1476099r.2442a>g0.990
rrl1476105r.2448ga>g0.990
rrl1476115r.2458t>c0.990
rrl1476131r.2474c>t0.991
rrl1476194r.2537a>g0.991
rrl1476200r.2543a>t0.990
rrl1476201r.2544c>t0.990
rrl1476214r.2557g>t0.980
rrl1476215r.2558c>t0.981
rrl1476224r.2567a>g0.982
rrl1476245r.2588c>t0.991
rrl1476251r.2594t>g0.990
rrl1476256r.2599a>t0.990
rrl1476260r.2603a>g0.990
rrl1476281r.2624t>c0.988
rrl1476297r.2640c>a0.986
rrl1476298r.2641c>a0.986
rrl1476301r.2644a>t0.986
rrl1476309r.2652g>t0.988
rrl1476428r.2771c>t0.981
rrl1476524r.2867c>t0.985
rrl1476584r.2927c>t0.990
rrl1476585r.2928a>g0.981
rrl1476594r.2937c>t1.000
rrl1476603r.2946g>a1.000
rrl1476614r.2957a>t1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476629r.2972c>a1.000
rrl1476630r.2973a>g1.000
rrl1476661r.3004a>g1.000
rrl1476665r.3008t>g1.000
rrl1476666r.3009c>t1.000
rrl1476675r.3018c>g1.000
rrl1476689r.3032a>t1.000
rrl1476694r.3037g>a1.000
rrl1476695r.3038t>a1.000
rrl1476699r.3042a>t1.000
rpsA1833664c.123C>G0.980
rpsA1833676c.135A>G0.960
rpsA1833679c.138G>C0.980
rpsA1833682c.141C>T0.980
rpsA1833685c.144G>T0.980
rpsA1833694c.153G>T0.981
rpsA1833697c.156C>G0.981
rpsA1833709c.168C>T0.983
rpsA1833733c.192C>T1.000
rpsA1833734p.Ala65Ser1.000
rpsA1833748c.207C>G1.000
rpsA1833770p.Asn77Ser1.000
rpsA1833781c.240T>C1.000
rpsA1833782p.Ser81Asn1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833904c.363G>A1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>C1.000
rpsA1833979c.438T>C1.000
rpsA1833985c.444G>C1.000
rpsA1833988c.447C>G0.980
rpsA1833991c.450C>A0.958
rpsA1833997c.456G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>T1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834051c.510G>A1.000
rpsA1834069c.528G>C0.982
rpsA1834099c.558C>G1.000
rpsA1834105c.564C>T0.979
rpsA1834108c.567C>A0.978
rpsA1834114c.573G>C0.978
rpsA1834126c.585G>A0.950
rpsA1834135c.594G>C0.971
rpsA1834183c.642T>C0.909
rpsA1834210c.669C>T0.939
rpsA1834231c.690T>C0.971
rpsA1834234c.693G>C0.971
rpsA1834246c.705G>C0.972
rpsA1834249c.708T>C0.972
rpsA1834252c.711C>T0.974
rpsA1834261c.720A>C0.976
rpsA1834264c.723G>C0.976
rpsA1834279c.738C>T0.977
rpsA1834282c.741C>T0.953
rpsA1834294c.753G>C1.000
rpsA1834298p.Gln253Thr0.974
rpsA1834327c.786G>T1.000
rpsA1834339c.798C>T0.974
rpsA1834340p.Met267Leu0.974
rpsA1834348c.807T>C1.000
rpsA1834354c.813G>T0.976
rpsA1834357c.816T>G0.957
rpsA1834366c.825A>G0.964
rpsA1834375c.834G>A0.970
rpsA1834396c.855G>T0.971
rpsA1834399p.His286Gln0.971
rpsA1834411c.870T>C0.974
rpsA1834423c.882G>T0.974
rpsA1834451c.910T>C0.958
rpsA1834468c.927A>G0.961
rpsA1834483p.Glu314Asp0.946
rpsA1834486p.Glu315Asp0.945
rpsA1834489c.948T>C0.959
rpsA1834501c.960G>C0.960
rpsA1834528c.987T>C0.983
rpsA1834540c.999G>C0.961
rpsA1834543c.1002C>G0.961
rpsA1834546c.1005T>C0.980
rpsA1834552c.1011G>T0.980
rpsA1834555c.1014T>C0.960
rpsA1834600c.1059G>C0.981
rpsA1834606c.1065C>T1.000
rpsA1834612c.1071G>T0.956
rpsA1834619c.1078T>C0.971
rpsA1834622c.1081T>A0.969
rpsA1834633c.1092A>G0.981
rpsA1834639c.1098T>C0.981
rpsA1834666c.1125G>C0.966
rpsA1834667p.Ala376Ser0.948
rpsA1834690c.1149T>C0.985
rpsA1834732c.1191T>C0.983
rpsA1834738c.1197A>G0.981
rpsA1834753c.1212T>C0.917
rpsA1834756p.Glu405Asp0.833
rpsA1834759c.1218A>C0.833
rpsA1834761p.Phe407Tyr0.909
rpsA1834765c.1224A>G1.000
ahpC2726561c.369T>C0.889
ahpC2726564c.372C>T0.889
ahpC2726582c.390G>C0.900
ahpC2726588c.396C>T0.909
ahpC2726593p.Val134Ala0.909
ahpC2726597c.405C>G0.913
ahpC2726600c.408T>C0.917
ahpC2726604p.Val138Ile0.920
ahpC2726638p.Ala149Val0.929
ahpC2726651c.459G>C0.929
ahpC2726654c.462G>C0.963
ahpC2726657c.465A>C0.963
ahpC2726669c.477T>C1.000
ahpC2726675c.483A>G1.000
ahpC2726681c.489A>T1.000
ahpC2726684c.492G>T1.000
ahpC2726693c.501C>A1.000
ahpC2726696c.504C>G1.000
ahpC2726708c.516G>A1.000
ahpC2726714c.522C>T1.000
ahpC2726717c.525A>C1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;