TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d244a194b6d4
Sample: 5d244a194b6d4

Download results

Summary
ID: 5d244a194b6d4
Date: Tue Jul 9 09:05:33 2019
Strain: lineage2.2;lineage2.2.1;lineage4.3.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage4.3.2.1Euro-American (LAM)LAM3RD761

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.963
gyrB6115c.876A>G0.968
gyrB6121c.882C>T0.968
gyrB6127c.888G>C0.968
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T1.000
gyrB6172c.933C>T1.000
gyrB6184c.945C>T1.000
gyrB6193c.954G>A1.000
gyrB6196c.957C>T1.000
gyrB6202c.963C>T1.000
gyrB6203p.Ser322Ala1.000
gyrB6214c.975G>C1.000
gyrB6223c.984G>C1.000
gyrB6229c.990G>A1.000
gyrB6634c.1395T>C0.923
gyrB6637c.1398T>G0.923
gyrB6640c.1401A>C0.923
gyrB6643c.1404A>G0.923
gyrB6646c.1407C>T0.923
gyrB6655c.1416T>C0.962
gyrB6673c.1434A>C0.970
gyrB6676c.1437T>G0.971
gyrB6703c.1464G>C0.975
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T1.000
gyrB6763c.1524G>C1.000
gyrB6772c.1533C>G1.000
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C0.976
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A0.974
gyrB6898c.1659G>T0.970
gyrB6988c.1749C>G0.778
gyrB7006c.1767T>G0.867
gyrB7010p.Leu591Met0.867
gyrB7015c.1776G>A0.867
gyrB7018c.1779G>C0.867
gyrB7024c.1785G>C0.867
gyrB7033c.1794G>C0.867
gyrB7051p.Glu604Asp0.929
gyrB7060c.1821T>C0.929
gyrB7066c.1827G>T0.929
gyrB7078c.1839A>G0.929
gyrB7081c.1842T>C0.929
gyrB7084c.1845A>G0.929
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T0.980
gyrA7523c.222C>G0.981
gyrA7526c.225G>A0.981
gyrA7547c.246C>T0.987
gyrA7553c.252C>T0.987
gyrA7559c.258G>C0.988
gyrA7565c.264C>T0.988
gyrA7574c.273G>C0.989
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.989
gyrA7595c.294C>T0.989
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C0.833
gyrA8129c.828T>C0.833
gyrA8156c.855T>C0.909
gyrA8159c.858G>C0.909
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>C1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8294c.993T>C1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G0.980
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8382c.1081C>T1.000
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8846c.1545C>T0.978
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C0.980
gyrA8872c.1572 1572del0.981
gyrA8873r.1572a>g1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp1.000
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C1.000
rpoB760406c.600G>C0.981
rpoB760406r.600ga>g1.000
rpoB760407p.Ser201Gly1.000
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G1.000
rpoB760481c.675G>C1.000
rpoB760484c.678A>G1.000
rpoB760502c.696C>G0.986
rpoB760522p.Ser239Asn0.984
rpoB760532c.726T>C0.983
rpoB760541c.735G>C0.982
rpoB760567p.Ser254Trp0.950
rpoB760571c.765G>C0.957
rpoB760588p.Thr261Ile0.970
rpoB760591p.Val262Ala0.970
rpoB760595c.789C>T0.970
rpoB760596p.Thr264Pro0.970
rpoB760608c.802C>T0.977
rpoB760611c.805T>C0.977
rpoB760634c.828T>C0.980
rpoB760646c.840C>G0.978
rpoB760655c.849A>G1.000
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C0.973
rpoB760703c.897C>T0.971
rpoB760721c.915C>G0.960
rpoB760727c.921C>G0.955
rpoB760730c.924T>C0.952
rpoB760736c.930C>G0.952
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760865c.1059C>T1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760943c.1137C>T1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760982c.1176G>C1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>T1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761057c.1251G>C0.969
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>C1.000
rpoB761133c.1327T>C0.988
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C1.000
rpoB761171c.1365C>T1.000
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp0.986
rpoB761189c.1383T>C0.986
rpoB761195c.1389G>C0.986
rpoB761198c.1392G>C0.986
rpoB761219c.1413G>C0.976
rpoB761234c.1428G>C0.987
rpoB761249c.1443A>G0.988
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C0.984
rpoB761264c.1458C>G0.984
rpoB761273c.1467T>C0.985
rpoB761303c.1497G>C0.967
rpoB761318c.1512G>T0.981
rpoB761327c.1521A>G0.980
rpoB761333c.1527G>T0.953
rpoB761339c.1533C>G0.976
rpoB761345c.1539G>C0.909
rpoB761346p.Val514Ser0.909
rpoB761354c.1548C>A0.909
rpoB761357c.1551G>T0.909
rpoB761360c.1554T>C0.909
rpoB761362p.Ser519Thr0.909
rpoB761373p.Val523His0.909
rpoB761384c.1578C>G0.909
rpoB761393c.1587G>A1.000
rpoB761516c.1710G>C0.952
rpoB761528c.1722C>T0.962
rpoB761531c.1725C>T0.963
rpoB761537c.1731C>G0.969
rpoB761555c.1749G>C0.973
rpoB761558c.1752C>G0.973
rpoB761564c.1758G>C0.974
rpoB761570c.1764T>C0.955
rpoB761573c.1767C>G0.904
rpoB761579c.1773G>C0.982
rpoB761612c.1806G>T0.986
rpoB761615c.1809A>C0.986
rpoB761636c.1830G>T0.984
rpoB761645c.1839C>G0.983
rpoB761657c.1851C>T0.981
rpoB761666c.1860G>C0.977
rpoB761669c.1863C>T0.953
rpoB761675c.1869G>T0.975
rpoB761681c.1875G>A0.974
rpoB761682c.1876C>T0.974
rpoB761687c.1881C>T0.974
rpoB761690c.1884G>C0.974
rpoB761693c.1887G>C0.974
rpoB761705c.1899C>A0.970
rpoB761873c.2067A>G0.909
rpoB761891c.2085G>C0.962
rpoB761909c.2103T>C0.969
rpoB761912c.2106T>C0.969
rpoB761915p.Asp703Glu0.969
rpoB761916p.Asp704Asn0.969
rpoB761924c.2118G>A0.971
rpoB761930c.2124G>C0.971
rpoB761933c.2127G>C0.971
rpoB761936c.2130C>T0.973
rpoB761948c.2142G>C0.980
rpoB761954c.2148C>A1.000
rpoB761955p.Ile717Val1.000
rpoB761969c.2163G>A1.000
rpoB761990c.2184G>C1.000
rpoB762008c.2202C>T1.000
rpoB762014c.2208C>G1.000
rpoB762038c.2232C>T0.982
rpoB762047c.2241G>A1.000
rpoB762053c.2247T>C1.000
rpoB762056c.2250G>A0.980
rpoB762065c.2259T>G1.000
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T0.976
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A0.962
rpoB762137c.2331C>T1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762149c.2343G>T1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762245c.2439G>C1.000
rpoB762275c.2469C>T1.000
rpoB762284c.2478G>C1.000
rpoB762293c.2487T>C1.000
rpoB762296c.2490G>C1.000
rpoB762317c.2511A>G1.000
rpoB762323c.2517C>A1.000
rpoB762329c.2523G>C1.000
rpoB762404c.2598T>C1.000
rpoB762410c.2604T>G1.000
rpoB762416c.2610A>G1.000
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C1.000
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762509c.2703T>G0.909
rpoB762510p.Ala902Pro0.909
rpoB762515c.2709C>T1.000
rpoB762533c.2727T>C1.000
rpoB762827c.3021G>C1.000
rpoB762830c.3024C>G1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C0.987
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C1.000
rpoB763082c.3276C>T1.000
rpoB763088c.3282C>G1.000
rpoB763094c.3288G>C1.000
rpoB763115c.3309T>C1.000
rpoB763127c.3321G>C1.000
rpoB763136c.3330C>T1.000
rpoB763145c.3339G>A1.000
rpoB763157c.3351G>T1.000
rpoB763166c.3360A>G1.000
rpoB763172c.3366G>C1.000
rpoB763193c.3387C>G1.000
rpoC763402c.33C>T0.950
rpoC763408c.39T>C0.950
rpoC763411c.42T>C0.950
rpoC763414c.45T>G0.950
rpoC763415p.Thr16Ser0.950
rpoC763423p.Glu18Asp0.950
rpoC763430c.61A>C0.950
rpoC763433p.Gln22Asn0.950
rpoC763443p.Tyr25Phe0.905
rpoC763450c.81G>A0.957
rpoC763456c.87A>G0.962
rpoC763468c.99G>C0.966
rpoC763486c.117T>C0.985
rpoC763492c.123G>C0.986
rpoC763528c.159G>A0.986
rpoC763531c.162G>T0.986
rpoC763546c.177A>G0.986
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A0.982
rpoC763660c.291T>G0.982
rpoC763666c.297G>C0.982
rpoC763669c.300C>G0.982
rpoC763675c.306C>G0.982
rpoC763696c.327T>C0.962
rpoC763699c.330G>T0.960
rpoC763702c.333C>G0.960
rpoC763708c.339G>C0.960
rpoC763711c.342G>C0.960
rpoC763714c.345G>C0.960
rpoC763717c.348T>C0.960
rpoC763723c.354G>C0.960
rpoC763732c.363C>A0.950
rpoC763741c.372C>T0.947
rpoC763744c.375G>C0.929
rpoC763747c.378G>A0.929
rpoC763888c.519G>T1.000
rpoC763891c.522G>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T1.000
rpoC764098c.729A>G1.000
rpoC764110c.741C>T1.000
rpoC764143c.774G>C1.000
rpoC764147p.Ser260Ala1.000
rpoC764150p.Ile261Val1.000
rpoC764165p.Glu266Gln1.000
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G0.988
rpoC764470c.1101C>T1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G1.000
rpoC764530c.1161C>G1.000
rpoC764534c.1165C>A0.983
rpoC764539c.1170C>T0.983
rpoC764542c.1173C>T0.982
rpoC764545c.1176C>A0.982
rpoC764560c.1191T>C0.985
rpoC764575c.1206T>G0.969
rpoC764611c.1242G>T0.970
rpoC764626c.1257C>T0.974
rpoC764632c.1263T>C0.974
rpoC764650c.1281G>T0.988
rpoC764668c.1299C>T0.988
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C1.000
rpoC764888c.1519T>C1.000
rpoC764911c.1542A>G0.982
rpoC764912p.Met515Gln0.982
rpoC764932c.1563C>A0.986
rpoC764948c.1579T>C0.987
rpoC764968c.1599T>C0.986
rpoC765004c.1635G>C0.968
rpoC765007c.1638T>G0.967
rpoC765008c.1639T>C0.967
rpoC765011c.1642A>T0.967
rpoC765016c.1647C>G0.967
rpoC765019c.1650A>G0.967
rpoC765040c.1671T>C0.974
rpoC765041c.1672T>C0.974
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765073c.1704G>C1.000
rpoC765076c.1707A>G1.000
rpoC765079c.1710T>G1.000
rpoC765082c.1713G>C1.000
rpoC765085c.1716T>C1.000
rpoC765089c.1720T>C1.000
rpoC765100c.1731G>C1.000
rpoC765103c.1734G>T1.000
rpoC765343c.1974G>A0.909
rpoC765352c.1983G>C0.929
rpoC765356p.Met663Val0.929
rpoC765370c.2001G>C0.958
rpoC765379c.2010G>C0.958
rpoC765382c.2013G>T0.958
rpoC765383p.Met672Leu0.960
rpoC765403c.2034G>C0.974
rpoC765405p.Leu679His0.974
rpoC765409c.2040T>G0.976
rpoC765421c.2052C>G0.981
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C0.984
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe0.984
rpoC765499c.2130C>G1.000
rpoC765517c.2148C>G1.000
rpoC765533p.Tyr722His0.974
rpoC765544c.2175C>G0.929
rpoC765547c.2178C>T0.923
rpoC765548c.2179A>T0.923
rpoC765553c.2184C>T1.000
rpoC765556c.2187G>C1.000
rpoC765562c.2193G>T0.923
rpoC765826c.2457T>C0.971
rpoC765835c.2466C>T0.973
rpoC765841c.2472G>T0.975
rpoC765861p.Phe831Tyr0.980
rpoC765875p.Val836Ile0.981
rpoC765886c.2517C>T0.984
rpoC765907c.2538G>T0.981
rpoC765910c.2541G>C0.980
rpoC765928c.2559C>G0.977
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766009c.2640G>C1.000
rpoC766012c.2643C>G1.000
rpoC766321c.2952C>G0.909
rpoC766333c.2964G>T0.944
rpoC766345c.2976T>C0.947
rpoC766348c.2979A>G0.947
rpoC766351c.2982C>G0.947
rpoC766353p.Val995Ala0.947
rpoC766369c.3000C>G0.978
rpoC766375c.3006C>G0.980
rpoC766381c.3012C>T0.980
rpoC766384c.3015A>G0.961
rpoC766390c.3021C>T0.965
rpoC766393c.3024C>T0.966
rpoC766408c.3039C>T0.955
rpoC766435p.Glu1022Asp0.955
rpoC766501c.3132G>C0.833
rpoC766507c.3138C>T0.846
rpoC766513c.3144C>T0.857
rpoC766522c.3153C>A0.857
rpoC766528c.3159T>G0.857
rpoC766531c.3162G>C0.857
rpoC766534c.3165C>G0.923
rpoC766537c.3168G>A0.923
rpoC766540p.Asp1057Glu0.923
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C0.952
rpoC766573c.3204T>G0.952
rpoC766588c.3219G>A0.952
rpoC766594c.3225G>T0.952
rpoC766607p.Ile1080Leu0.952
rpoC766618c.3249G>T0.952
rpoC766624c.3255G>C0.909
rpoC766630c.3261G>C0.944
rpoC766633c.3264G>C0.889
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C0.987
rpoC767098c.3729T>C0.985
rpoC767104c.3735C>G0.985
rpoC767107c.3738C>T0.985
rpoC767119c.3750A>G0.985
rpoC767125c.3756G>C0.985
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781766c.207C>T1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C1.000
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.979
rrs1471986r.141c>t0.979
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472286r.441c>g1.000
rrs1472287r.442c>t1.000
rrs1472289r.444t>g1.000
rrs1472290r.445c>g1.000
rrs1472313r.468g>a1.000
rrs1472315r.470t>g1.000
rrs1472324r.479g>c1.000
rrs1472325r.480g>c1.000
rrs1472327r.482g>a1.000
rrs1472328r.483g>c1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t0.978
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472848r.1003t>c1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.976
rrs1473088r.1243a>g0.977
rrs1473099r.1254t>a0.971
rrs1473104r.1259c>t0.970
rrs1473105r.1260g>a0.970
rrs1473110r.1265t>g0.969
rrs1473111r.1266a>g0.971
rrs1473121r.1276t>c0.925
rrs1473123r.1278a>t0.974
rrs1473129r.1284c>t0.976
rrs1473145r.1300c>t0.977
rrs1473166r.1321g>a0.982
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a0.944
rrl1473697r.40c>a0.900
rrl1473707r.50t>a0.939
rrl1473717r.60g>a0.946
rrl1473731r.74t>a0.975
rrl1473746r.89t>c0.979
rrl1473756r.99g>t0.980
rrl1473758r.101g>t0.980
rrl1473770r.113t>c0.983
rrl1473806r.149c>t0.982
rrl1473812r.155g>a0.980
rrl1473814r.157a>t0.979
rrl1473815r.158t>g0.979
rrl1473829r.172g>c0.980
rrl1473831r.174g>t0.980
rrl1473832r.175c>t0.980
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t0.976
rrl1473899r.242a>g0.974
rrl1473916r.259c>a0.970
rrl1473923r.266c>g0.960
rrl1473937r.280c>t0.958
rrl1473943r.286g>t0.947
rrl1473945r.288t>a0.947
rrl1473946r.289a>t0.947
rrl1473950r.293g>t0.947
rrl1474051r.394t>c1.000
rrl1474054r.397t>c1.000
rrl1474056r.399t>c1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474184r.527c>a1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t0.981
rrl1474409r.752ggcgacccacac>g0.958
rrl1474412r.755ga>g1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474435r.778gtgaa>g1.000
rrl1474496r.839c>g0.976
rrl1474497r.840g>c0.977
rrl1474506r.849c>g0.976
rrl1474507r.850g>c0.977
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c0.971
rrl1475061r.1404ca>c0.978
rrl1475076r.1419c>a0.958
rrl1475090r.1433a>t0.949
rrl1475114r.1457c>t0.949
rrl1475120r.1463g>t0.948
rrl1475129r.1472g>a0.943
rrl1475202r.1545g>c0.943
rrl1475209r.1552g>a0.933
rrl1475213r.1556c>t0.933
rrl1475220r.1563g>t0.933
rrl1475429r.1772g>a0.971
rrl1475443r.1786g>a0.947
rrl1475452r.1795c>a0.976
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t0.977
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a0.923
rrl1476086r.2429g>a0.923
rrl1476088r.2431a>c0.923
rrl1476099r.2442a>g0.917
rrl1476103r.2446c>g0.917
rrl1476105r.2448g>a0.917
rrl1476106r.2449a>t0.917
rrl1476110r.2453g>c0.917
rrl1476114r.2457t>c0.917
rrl1476115r.2458t>c0.923
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c1.000
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
inhA1674876c.675C>T0.923
inhA1674879c.678T>C0.923
inhA1674892p.Asn231Asp0.923
inhA1674903c.702T>C0.923
inhA1674904p.Ala235Pro0.923
inhA1674909c.708G>A0.923
inhA1674912c.711G>C0.923
inhA1674915c.714C>G0.923
inhA1674942c.741T>C0.923
inhA1674949c.748C>T0.923
inhA1674954c.753G>C0.923
inhA1674957c.756G>C0.923
inhA1674963c.762G>C0.923
inhA1674966c.765T>C0.923
inhA1674975c.774C>T1.000
inhA1674977p.Tyr259Phe1.000
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.981
rpsA1833734p.Ala65Ser0.981
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G0.981
rpsA1833790c.249T>C0.981
rpsA1833802c.261A>G0.984
rpsA1833811c.270G>T0.984
rpsA1833823c.282G>A0.984
rpsA1833832c.291G>A0.985
rpsA1833838c.297G>C0.984
rpsA1833841c.300C>G0.985
rpsA1833847c.306C>G0.986
rpsA1833856c.315A>G0.986
rpsA1833862c.321G>T0.985
rpsA1833874c.333T>G0.986
rpsA1833886c.345C>G0.987
rpsA1833894p.Ala118Glu0.973
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C0.978
rpsA1834246c.705G>T0.978
rpsA1834249c.708T>C0.979
rpsA1834252c.711C>G0.979
rpsA1834261c.720A>G0.982
rpsA1834264c.723G>C0.982
rpsA1834279c.738C>T0.982
rpsA1834294c.753G>T0.982
rpsA1834297c.756C>T0.982
rpsA1834303c.762T>G0.982
rpsA1834306c.765T>C0.982
rpsA1834327c.786G>T0.985
rpsA1834357c.816T>C0.974
rpsA1834366c.825A>G0.986
rpsA1834375c.834G>C0.973
rpsA1834396c.855G>C0.987
rpsA1834411c.870T>G0.985
rpsA1834414c.873C>T0.969
rpsA1834417c.876G>C0.969
rpsA1834420c.879C>T0.969
rpsA1834423c.882G>C0.985
rpsA1834429c.888C>T0.974
rpsA1834438c.897C>T0.988
rpsA1834451c.910T>C0.987
rpsA1834456c.915T>G0.974
rpsA1834468c.927A>G0.959
rpsA1834477c.936C>T0.958
rpsA1834489c.948T>C0.957
rpsA1834519c.978G>C0.967
rpsA1834520p.Ala327Ser0.967
rpsA1834528c.987T>C0.967
rpsA1834534c.993C>T0.967
rpsA1834543c.1002C>G0.966
rpsA1834546c.1005T>C0.966
rpsA1834552c.1011G>T0.965
rpsA1834555c.1014T>G0.964
rpsA1834557p.Ala339Gly0.964
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834753c.1212T>C1.000
rpsA1834759c.1218A>C1.000
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T1.000
rpsA1834776p.Ala412Glu1.000
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C0.958
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
panD4044138c.144A>G0.938
panD4044150c.132T>G0.944
panD4044156c.126T>C0.944
panD4044167c.115G>A0.944
panD4044171c.111G>A0.944
panD4044174c.108G>A0.944
panD4044180p.Asp34Glu0.944
panD4044188c.94C>G0.944
panD4044189c.93G>A0.944
panD4044194p.Ala30Pro0.947
panD4044195c.87A>G0.952
panD4044233p.Cys17His0.980
panD4044234c.48G>C0.980
panD4044249c.33G>A0.980
panD4044266p.Leu6Met0.978
panD4044273c.9C>G1.000
panD4044276p.Leu2Phe1.000
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240778p.His306Gly1.000
embC4240781p.Ala307Ser1.000
embC4240789c.927T>C1.000
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000
embB4248220c.1707A>G1.000
embB4248226c.1713G>C1.000
embB4248232c.1719G>T1.000
embB4248233p.Leu574Val1.000
embB4248236p.Met575Leu1.000
embB4248245p.Ile578Val1.000
embB4248250c.1737C>T1.000
embB4248259p.Met582Ile1.000
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;