TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d258eb2a96b4
Sample: 5d258eb2a96b4

Download results

Summary
ID: 5d258eb2a96b4
Date: Wed Jul 10 08:10:15 2019
Strain: lineage2.2.1;lineage4.2.2;lineage4.3.2.1;lineage4.1.1.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.1.1.1Euro-American (X-type)X2RD183

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A0.957
gyrB6115c.876A>G0.964
gyrB6121c.882C>T0.964
gyrB6127c.888G>C0.964
gyrB6133c.894G>C0.964
gyrB6136c.897G>A0.964
gyrB6151c.912C>T0.931
gyrB6172c.933C>T0.931
gyrB6184c.945C>T0.964
gyrB6193c.954G>A0.929
gyrB6196c.957C>T0.929
gyrB6202c.963C>T0.917
gyrB6203p.Ser322Ala0.917
gyrB6214c.975G>C0.846
gyrB6223c.984G>C0.846
gyrB6655c.1416T>C0.818
gyrB6664c.1425C>T0.846
gyrB6673c.1434A>C0.867
gyrB6676c.1437T>G0.875
gyrB6700c.1461T>C0.947
gyrB6703c.1464G>C0.947
gyrB6706c.1467G>A0.947
gyrB6709c.1470A>G0.947
gyrB6712c.1473G>C0.950
gyrB6727c.1488G>T0.952
gyrB6728c.1489C>T0.952
gyrB6739c.1500C>T0.971
gyrB6745c.1506T>C0.971
gyrB6754c.1515C>T0.974
gyrB6763c.1524G>C0.977
gyrB6775c.1536G>C0.981
gyrB6793c.1554T>C0.983
gyrB6798p.Gly520Ala0.968
gyrB6808c.1569C>G0.965
gyrB6824c.1585C>T0.960
gyrB6838c.1599C>T0.959
gyrB6841c.1602T>C0.959
gyrB6862c.1623C>G0.958
gyrB6869c.1630T>C0.952
gyrB6872c.1633T>C0.952
gyrB6878c.1639T>C0.952
gyrB6889c.1650G>A0.938
gyrB6898c.1659G>C0.933
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>A1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C0.941
gyrB7066c.1827G>T1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T0.944
gyrB7093c.1854T>C0.944
gyrB7100c.1861T>C0.944
gyrA7343c.42G>C0.962
gyrA7355c.54T>A0.962
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T0.962
gyrA7394c.93T>C0.962
gyrA7397c.96G>C0.962
gyrA7412c.111C>G1.000
gyrA7421c.120G>C1.000
gyrA7424c.123G>C1.000
gyrA7427c.126G>C1.000
gyrA7433c.132G>C1.000
gyrA7439c.138C>T1.000
gyrA7442c.141G>C1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A1.000
gyrA8121c.820T>C1.000
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G1.000
gyrA8177c.876A>C1.000
gyrA8267c.966G>C0.967
gyrA8283p.Ile328Leu0.972
gyrA8288c.987T>C0.973
gyrA8294c.993T>C0.977
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8366c.1065G>A1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T0.909
gyrA8576c.1275C>G0.929
gyrA8580p.Ile427Val0.933
gyrA8603c.1302A>C0.933
gyrA8609c.1308G>C0.875
gyrA8619c.1318T>C0.824
gyrA8624c.1323G>T0.824
gyrA8633c.1332C>G0.824
gyrA8636c.1335A>C0.824
gyrA8642c.1341A>G0.824
gyrA8645c.1344C>G0.824
gyrA8649p.Arg450Lys0.824
gyrA8666c.1365G>C0.824
gyrA8672c.1371A>G0.824
gyrA8693c.1392T>C0.800
gyrA8696c.1395G>C0.786
gyrA8699c.1398A>G0.786
gyrA8792c.1491G>C1.000
gyrA8799p.Ala500Ser1.000
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C1.000
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8924c.1623C>T1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>G1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
gyrA9018p.Gln573Lys1.000
rpoB760079c.273G>A1.000
rpoB760091c.285G>C1.000
rpoB760101c.295T>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G0.978
rpoB760121c.315T>C0.978
rpoB760130p.Asp108Glu0.982
rpoB760139c.333A>G0.984
rpoB760181c.375T>C0.986
rpoB760184c.378A>G0.986
rpoB760196c.390C>G0.986
rpoB760235c.429T>C0.983
rpoB760244c.438G>C0.981
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp0.968
rpoB760276p.Lys157Met1.000
rpoB760283c.477G>C1.000
rpoB760298c.492G>C1.000
rpoB760307c.501T>C1.000
rpoB760357p.Thr184Ser0.957
rpoB760361c.555T>C0.929
rpoB760370c.564C>G0.969
rpoB760376p.Asp190Glu0.974
rpoB760382c.576G>C0.976
rpoB760400c.594G>C0.980
rpoB760406c.600G>C0.943
rpoB760407p.Ser201Gly0.982
rpoB760415c.609C>T0.984
rpoB760418c.612G>C0.985
rpoB760430c.624T>C0.985
rpoB760460c.654G>C0.988
rpoB760475c.669A>G0.975
rpoB760481c.675G>T0.986
rpoB760484c.678A>G0.986
rpoB760502c.696C>G0.988
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760561252MRS>252MMG1.000
rpoB760571c.765G>C1.000
rpoB760588p.Thr261Ile1.000
rpoB760591p.Val262Ala1.000
rpoB760595c.789C>T1.000
rpoB760596p.Thr264Pro1.000
rpoB760608c.802C>T1.000
rpoB760611c.805T>C1.000
rpoB760634c.828T>C1.000
rpoB760646c.840C>G1.000
rpoB760655c.849A>G0.974
rpoB760661c.855A>G1.000
rpoB760668p.Thr288Ala1.000
rpoB760674c.868T>C1.000
rpoB760679c.873A>G1.000
rpoB760683c.877T>C1.000
rpoB760703c.897C>T1.000
rpoB760721c.915C>G1.000
rpoB760727c.921C>G1.000
rpoB760730c.924T>C1.000
rpoB760736c.930C>G1.000
rpoB760793c.987A>G1.000
rpoB760799c.993C>T0.917
rpoB760805c.999G>C1.000
rpoB760817c.1011A>G1.000
rpoB760820c.1014T>C1.000
rpoB760826c.1020C>G1.000
rpoB760830c.1024T>C1.000
rpoB760841c.1035T>C1.000
rpoB760858p.Val351Ala1.000
rpoB760862c.1056G>C1.000
rpoB760886p.Glu360Asp1.000
rpoB760887p.Thr361Val1.000
rpoB760910c.1104C>T1.000
rpoB760916c.1110C>T1.000
rpoB760928c.1122G>C1.000
rpoB760946c.1140A>G1.000
rpoB760965p.Met387Leu1.000
rpoB760970c.1164G>C1.000
rpoB760973c.1167G>T1.000
rpoB760979c.1173G>A1.000
rpoB760982c.1176G>T1.000
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>C1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C1.000
rpoB761036c.1230G>C1.000
rpoB761037c.1231T>C1.000
rpoB761051c.1245G>T1.000
rpoB761054c.1248G>C1.000
rpoB761060c.1254C>G1.000
rpoB761063c.1257C>G1.000
rpoB761084c.1278C>A1.000
rpoB761097c.1291A>T1.000
rpoB761102c.1296A>G1.000
rpoB761132c.1326G>T1.000
rpoB761133c.1327T>C1.000
rpoB761147c.1341C>T1.000
rpoB761150c.1344A>T1.000
rpoB761165c.1359G>C0.984
rpoB761171c.1365C>T0.985
rpoB761178p.Ser458Thr0.980
rpoB761186p.Glu460Asp0.980
rpoB761189c.1383T>C0.980
rpoB761195c.1389G>C0.981
rpoB761198c.1392G>T0.981
rpoB761219c.1413G>C0.983
rpoB761231c.1425C>T0.967
rpoB761234c.1428G>T0.983
rpoB761249c.1443A>G0.984
rpoB761255c.1449T>G0.979
rpoB761258c.1452G>A0.978
rpoB761261c.1455G>C0.915
rpoB761264c.1458C>G0.917
rpoB761273c.1467T>C0.983
rpoB761297c.1491C>T0.946
rpoB761318c.1512G>C0.977
rpoB761327c.1521A>G0.976
rpoB761339c.1533C>G0.974
rpoB761345c.1539G>C0.923
rpoB761346p.Val514Ser0.923
rpoB761354c.1548C>A0.923
rpoB761357c.1551G>T0.923
rpoB761360c.1554T>C0.923
rpoB761362p.Ser519Thr0.923
rpoB761373p.Val523His0.923
rpoB761387c.1581C>T0.857
rpoB761393c.1587G>A0.857
rpoB761414c.1608A>G0.800
rpoB761516c.1710G>C0.947
rpoB761528c.1722C>T0.957
rpoB761537c.1731C>G0.979
rpoB761555c.1749G>C0.983
rpoB761558c.1752C>G0.983
rpoB761564c.1758G>C0.985
rpoB761573c.1767C>G0.986
rpoB761579c.1773G>C0.986
rpoB761606c.1800C>G0.989
rpoB761612c.1806G>T0.988
rpoB761615c.1809A>C0.988
rpoB761636c.1830G>T0.987
rpoB761645c.1839C>G0.986
rpoB761648c.1842T>C0.986
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>C1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761722p.Glu639Gly1.000
rpoB761727p.Ser641Gly1.000
rpoB761741c.1935G>A1.000
rpoB761750c.1944G>T1.000
rpoB761760p.Ile652Val0.909
rpoB761765c.1959T>C0.900
rpoB761891c.2085G>C0.960
rpoB761892p.Ile696Val0.962
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn1.000
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C1.000
rpoB761933c.2127G>C1.000
rpoB761936c.2130C>T1.000
rpoB761948c.2142G>C0.981
rpoB761954c.2148C>A0.982
rpoB761955p.Ile717Val0.982
rpoB761969c.2163G>A0.986
rpoB761990c.2184G>C0.988
rpoB762008c.2202C>T0.987
rpoB762014c.2208C>G0.988
rpoB762038c.2232C>T0.985
rpoB762047c.2241G>A0.984
rpoB762053c.2247T>C0.983
rpoB762056c.2250G>A0.983
rpoB762065c.2259T>G0.981
rpoB762074c.2268C>T0.980
rpoB762083c.2277T>C0.977
rpoB762086c.2280G>C0.977
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C0.970
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C1.000
rpoB762236c.2430G>C1.000
rpoB762239c.2433G>A1.000
rpoB762245c.2439G>C1.000
rpoB762254c.2448T>C1.000
rpoB762293c.2487T>C0.979
rpoB762296c.2490G>C0.978
rpoB762314c.2508C>T0.971
rpoB762317c.2511A>G0.969
rpoB762323c.2517C>A0.966
rpoB762329c.2523G>C0.960
rpoB762398c.2592T>C0.900
rpoB762404c.2598T>C0.970
rpoB762410c.2604T>G0.977
rpoB762416c.2610A>G0.978
rpoB762449c.2643C>A1.000
rpoB762452c.2646G>C0.982
rpoB762470c.2664G>C1.000
rpoB762488c.2682G>C1.000
rpoB762491c.2685T>C1.000
rpoB762507c.2702 2702del1.000
rpoC763402c.33C>T0.909
rpoC763408c.39T>C0.909
rpoC763411c.42T>C0.909
rpoC763414c.45T>G0.909
rpoC763415p.Thr16Ser0.909
rpoC763423p.Glu18Asp0.909
rpoC763430c.61A>C0.909
rpoC763433p.Gln22Asn0.909
rpoC763443p.Tyr25Phe0.920
rpoC763450c.81G>A0.958
rpoC763456c.87A>G0.981
rpoC763468c.99G>C0.983
rpoC763486c.117T>C0.985
rpoC763492c.123G>C0.986
rpoC763528c.159G>A0.974
rpoC763531c.162G>T0.987
rpoC763546c.177A>G0.986
rpoC763570c.201G>C0.986
rpoC763594c.225C>T0.986
rpoC763609c.240C>T0.971
rpoC763621c.252C>T0.972
rpoC763633c.264T>C0.986
rpoC763657c.288G>A0.982
rpoC763660c.291T>G0.981
rpoC763666c.297G>C0.979
rpoC763669c.300C>G0.978
rpoC763675c.306C>G1.000
rpoC763696c.327T>C0.962
rpoC763699c.330G>T0.960
rpoC763702c.333C>G0.957
rpoC763708c.339G>C0.955
rpoC763711c.342G>C0.955
rpoC763714c.345G>C0.955
rpoC763717c.348T>C0.955
rpoC763723c.354G>C0.955
rpoC763732c.363C>G0.955
rpoC763741c.372C>T0.952
rpoC763744c.375G>C0.950
rpoC763747c.378G>A0.950
rpoC763765c.396T>C0.944
rpoC763900c.531G>C0.926
rpoC763933c.564C>T0.967
rpoC763940p.Ala191Ser0.967
rpoC763945c.576T>C0.967
rpoC763947p.Ala193Val0.967
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp0.950
rpoC764032p.Asp221Glu0.950
rpoC764040p.Ser224Thr0.966
rpoC764044c.675T>C0.966
rpoC764054c.685C>T0.967
rpoC764059c.690G>T0.968
rpoC764083c.714A>G0.971
rpoC764084p.Asn239Val0.971
rpoC764098c.729A>G0.971
rpoC764110c.741C>T0.971
rpoC764143c.774G>C0.955
rpoC764147p.Ser260Ala0.947
rpoC764150p.Ile261Val0.941
rpoC764165p.Glu266Gln0.941
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764362c.993C>T1.000
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>T1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G0.977
rpoC764435c.1066A>C0.977
rpoC764452c.1083T>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764497c.1128A>G1.000
rpoC764509c.1140G>A1.000
rpoC764510c.1141C>T1.000
rpoC764521c.1152T>C1.000
rpoC764527c.1158C>T1.000
rpoC764530c.1161C>T1.000
rpoC764533c.1164C>A1.000
rpoC764536c.1167G>T1.000
rpoC764539c.1170C>G1.000
rpoC764545c.1176C>A1.000
rpoC764575c.1206T>G1.000
rpoC764593c.1224C>T1.000
rpoC764611c.1242G>T1.000
rpoC764626c.1257C>T1.000
rpoC764632c.1263T>C1.000
rpoC764650c.1281G>T1.000
rpoC764668c.1299C>T1.000
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C1.000
rpoC764758c.1389C>G1.000
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G1.000
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala1.000
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T1.000
rpoC764875c.1506C>A1.000
rpoC764887c.1518G>C0.983
rpoC764888c.1519T>C0.983
rpoC764911c.1542A>G0.982
rpoC764912p.Met515Gln0.982
rpoC764932c.1563C>A0.983
rpoC764948c.1579T>C0.981
rpoC764968c.1599T>C0.977
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>A1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G0.975
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C1.000
rpoC765478c.2109T>G1.000
rpoC765480p.Tyr704Phe1.000
rpoC765499c.2130C>G0.981
rpoC765517c.2148C>G0.974
rpoC765529c.2160C>T0.970
rpoC765533p.Tyr722His0.970
rpoC765544c.2175C>G0.950
rpoC765547c.2178C>T0.947
rpoC765548c.2179A>T0.947
rpoC765553c.2184C>T0.947
rpoC765556c.2187G>C0.947
rpoC765562c.2193G>C0.947
rpoC765835c.2466C>T0.951
rpoC765841c.2472G>T0.959
rpoC765861p.Phe831Tyr0.982
rpoC765875p.Val836Ile0.985
rpoC765895c.2526G>A1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G1.000
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766003c.2634G>C1.000
rpoC766321c.2952C>G0.944
rpoC766333c.2964G>T1.000
rpoC766345c.2976T>C1.000
rpoC766348c.2979A>G1.000
rpoC766351c.2982C>G1.000
rpoC766353p.Val995Ala1.000
rpoC766369c.3000C>G1.000
rpoC766375c.3006C>G1.000
rpoC766381c.3012C>T1.000
rpoC766384c.3015A>G1.000
rpoC766390c.3021C>T1.000
rpoC766393c.3024C>T1.000
rpoC766408c.3039C>T1.000
rpoC766435p.Glu1022Asp1.000
rpoC766501c.3132G>C0.923
rpoC766507c.3138C>T0.923
rpoC766513c.3144C>T0.923
rpoC766522c.3153C>A0.923
rpoC766528c.3159T>G0.923
rpoC766531c.3162G>C0.923
rpoC766534c.3165C>G0.923
rpoC766537c.3168G>A0.929
rpoC766540p.Asp1057Glu0.929
rpoC766549c.3180G>C0.962
rpoC766570c.3201T>C0.962
rpoC766573c.3204T>G0.962
rpoC766582c.3213C>T0.962
rpoC766594c.3225G>T0.962
rpoC766607p.Ile1080Leu0.962
rpoC766618c.3249G>T0.960
rpoC766624c.3255G>C0.955
rpoC766630c.3261G>C1.000
rpoC766633c.3264G>C1.000
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C0.982
rpoC767264p.Ala1299Ser0.973
rpoC767267p.Ala1300Asn0.972
rpoC767278c.3909T>C0.944
rpoC767281c.3912C>G0.972
rpoC767284c.3915C>G0.946
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G0.976
rpsL781721c.162C>T0.900
rpsL781751c.192G>C0.909
rpsL781754c.195G>T0.909
rpsL781760c.201T>C0.909
rpsL781763c.204C>G0.917
rpsL781766c.207C>T0.923
rpsL781772c.213C>T0.972
rpsL781802c.243G>C0.977
rpsL781814c.255C>T0.973
rpsL781817c.258G>T0.974
rpsL781829c.270G>C0.976
rpsL781832c.273T>C0.978
rpsL781859c.300T>C0.974
rpsL781868c.309T>C1.000
rpsL781871c.312G>C1.000
rpsL781877c.318T>A1.000
rpsL781892c.333A>G1.000
rpsL781898c.339A>T1.000
rpsL781907c.348T>C1.000
rpsL781916c.357T>C1.000
rpsL781929p.Gly124Ser1.000
rpsL781933374G>A0.938
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g0.983
rrs1471925r.80t>c0.981
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a0.973
rrs1472108r.263c>t0.973
rrs1472113r.268t>c0.976
rrs1472150r.305t>a0.982
rrs1472251r.406g>a1.000
rrs1472286r.441c>g1.000
rrs1472328r.483g>c1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472847r.1002g>a1.000
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c1.000
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a0.977
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a0.976
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c0.947
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t0.982
rrs1473145r.1300c>t0.983
rrs1473166r.1321g>a0.984
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac1.000
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474106r.449a>act1.000
rrl1474109r.452aat>a1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474184r.527c>a1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a0.979
rrl1474282r.625g>a0.947
rrl1474291r.634tttcctctccggagga>t0.970
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.969
rrl1474497r.840g>c0.969
rrl1474506r.849c>g0.985
rrl1474507r.850g>c0.985
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474710r.1053tggtg>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c1.000
rrl1474743r.1086t>g1.000
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c0.964
rrl1475061r.1404ca>c0.972
rrl1475076r.1419c>a0.976
rrl1475090r.1433a>t0.979
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t0.973
rrl1475429r.1772g>a0.905
rrl1475443r.1786g>a0.917
rrl1475452r.1795c>a0.926
rrl1475475r.1818c>t0.923
rrl1475479r.1822c>t0.917
rrl1475480r.1823a>t0.920
rrl1475505r.1848g>a0.923
rrl1475526r.1869c>a0.913
rrl1475531r.1874c>t0.923
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g0.981
rrl1475659r.2002g>a0.982
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c0.971
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a0.944
rrl1476086r.2429g>a0.944
rrl1476088r.2431a>c0.944
rrl1476099r.2442a>g0.944
rrl1476103r.2446c>g0.944
rrl1476105r.2448g>a0.944
rrl1476106r.2449a>t0.944
rrl1476110r.2453g>c0.944
rrl1476114r.2457t>c0.944
rrl1476115r.2458t>c0.944
rrl1476131r.2474c>t0.975
rrl1476160r.2503t>c0.980
rrl1476214r.2557g>t0.979
rrl1476215r.2558c>t0.979
rrl1476221r.2564t>c0.980
rrl1476224r.2567a>g0.980
rrl1476251r.2594t>c0.982
rrl1476281r.2624t>c0.981
rrl1476297r.2640c>t0.981
rrl1476299r.2642c>t0.981
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t0.981
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c0.969
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G1.000
rpsA1833664c.123C>G1.000
rpsA1833676c.135A>G1.000
rpsA1833679c.138G>T1.000
rpsA1833685c.144G>C1.000
rpsA1833691c.150G>A1.000
rpsA1833694c.153G>T1.000
rpsA1833697c.156C>T1.000
rpsA1833700c.159C>T1.000
rpsA1833709c.168C>T1.000
rpsA1833724c.183C>T1.000
rpsA1833727c.186G>C1.000
rpsA1833733c.192C>G0.977
rpsA1833734p.Ala65Ser0.978
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833835c.294C>T1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833844c.303C>T1.000
rpsA1833847c.306C>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833877c.336C>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C0.983
rpsA1834228c.687C>A0.958
rpsA1834231c.690T>G0.957
rpsA1834234c.693G>T0.958
rpsA1834240c.699T>C0.957
rpsA1834246c.705G>T0.957
rpsA1834249c.708T>C0.957
rpsA1834252c.711C>G0.938
rpsA1834261c.720A>G0.949
rpsA1834264c.723G>C0.954
rpsA1834279c.738C>T0.938
rpsA1834294c.753G>T0.965
rpsA1834297c.756C>T0.982
rpsA1834303c.762T>G0.982
rpsA1834306c.765T>C0.981
rpsA1834327c.786G>T0.966
rpsA1834348c.807T>C0.968
rpsA1834357c.816T>C0.984
rpsA1834366c.825A>G0.985
rpsA1834375c.834G>T0.985
rpsA1834396c.855G>C0.987
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T0.988
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T0.989
rpsA1834489c.948T>C1.000
rpsA1834516c.975G>A0.984
rpsA1834519c.978G>C0.984
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T0.980
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C0.980
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C0.978
rpsA1834667p.Ala376Ser0.979
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala0.976
rpsA1834705c.1164C>G0.977
rpsA1834720c.1179C>G0.980
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G1.000
rpsA1834747c.1206A>G0.982
rpsA1834759c.1218A>C0.981
rpsA1834765p.Glu408Asp1.000
rpsA1834774c.1233C>T0.976
rpsA1834776p.Ala412Glu0.975
rpsA1834780c.1239A>G1.000
rpsA1834789c.1248T>C1.000
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G1.000
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A0.984
kasA2518825c.711T>C0.984
kasA2518846c.732G>T0.980
kasA2518849c.735G>C0.980
kasA2518853p.Leu247Val0.979
kasA2518864c.750G>C0.978
thyX3067814c.132A>G1.000
thyX3067841c.105C>G1.000
thyX3067847c.99G>C1.000
thyX3067862c.84G>A1.000
thyX3067869p.Thr26Ser1.000
embC4240729c.867C>G0.985
embC4240735c.873C>G0.985
embC4240741c.879C>T0.986
embC4240756c.894G>C0.974
embC4240771c.909G>C0.964
embC4240772p.Ser304Ala0.964
embC4240778p.His306Gly0.962
embC4240781p.Ala307Ser0.962
embC4240789c.927T>C0.986
embC4240819c.957A>C1.000
embC4240826p.Ala322Ser1.000
embC4240831c.969T>G1.000
embC4240856p.Ala332Thr1.000
embC4240859p.Leu333Ile1.000
embC4240876c.1014C>T1.000
embC4240879c.1017G>T1.000
embC4240885c.1023T>C1.000
embC4240886p.Ile342Val1.000
embC4240897c.1035C>G1.000
embC4240900c.1038A>G1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;