TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d26dfeb7da52
Sample: 5d26dfeb7da52

Download results

Summary
ID: 5d26dfeb7da52
Date: Thu Jul 11 08:09:09 2019
Strain: lineage2.2.1;lineage4.1.1.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage4.1.1.1Euro-American (X-type)X2RD183

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G1.000
gyrB6121c.882C>T1.000
gyrB6127c.888G>C1.000
gyrB6133c.894G>C1.000
gyrB6136c.897G>A1.000
gyrB6151c.912C>T0.977
gyrB6172c.933C>T0.977
gyrB6184c.945C>T0.956
gyrB6193c.954G>A0.920
gyrB6196c.957C>T0.920
gyrB6202c.963C>T0.905
gyrB6203p.Ser322Ala0.905
gyrB6214c.975G>C0.900
gyrB6223c.984G>C0.905
gyrB6655c.1416T>C0.909
gyrB6664c.1425C>T0.947
gyrB6673c.1434A>C1.000
gyrB6676c.1437T>G1.000
gyrB6700c.1461T>C1.000
gyrB6703c.1464G>C1.000
gyrB6706c.1467G>A1.000
gyrB6709c.1470A>G1.000
gyrB6712c.1473G>C1.000
gyrB6727c.1488G>T1.000
gyrB6728c.1489C>T1.000
gyrB6739c.1500C>T1.000
gyrB6745c.1506T>C1.000
gyrB6754c.1515C>T0.978
gyrB6763c.1524G>C1.000
gyrB6775c.1536G>C1.000
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala1.000
gyrB6808c.1569C>G1.000
gyrB6824c.1585C>T1.000
gyrB6838c.1599C>T1.000
gyrB6841c.1602T>C1.000
gyrB6862c.1623C>G1.000
gyrB6869c.1630T>C1.000
gyrB6872c.1633T>C1.000
gyrB6878c.1639T>C1.000
gyrB6889c.1650G>A1.000
gyrB6898c.1659G>C1.000
gyrB7006c.1767T>G1.000
gyrB7010p.Leu591Met1.000
gyrB7015c.1776G>A1.000
gyrB7018c.1779G>C1.000
gyrB7024c.1785G>A1.000
gyrB7033c.1794G>C1.000
gyrB7051p.Glu604Asp1.000
gyrB7060c.1821T>C1.000
gyrB7066c.1827G>T1.000
gyrB7081c.1842T>C1.000
gyrB7084c.1845A>G1.000
gyrB7090c.1851C>T1.000
gyrB7093c.1854T>C1.000
gyrB7100c.1861T>C1.000
gyrA7343c.42G>C0.970
gyrA7355c.54T>A1.000
gyrA7362p.Glu21Gln1.000
gyrA7391c.90C>T1.000
gyrA7394c.93T>C1.000
gyrA7397c.96G>C1.000
gyrA7412c.111C>G1.000
gyrA7499c.198G>C1.000
gyrA7511c.210C>T1.000
gyrA7523c.222C>G1.000
gyrA7526c.225G>C1.000
gyrA7547c.246C>T1.000
gyrA7559c.258G>C1.000
gyrA7565c.264C>T1.000
gyrA7574c.273G>C1.000
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C1.000
gyrA7595c.294C>T1.000
gyrA7607c.306C>T1.000
gyrA7637c.336C>A0.981
gyrA8121c.820T>C0.952
gyrA8129c.828T>C0.952
gyrA8156c.855T>C0.952
gyrA8168c.867A>G0.952
gyrA8174c.873C>G0.952
gyrA8177c.876A>C0.952
gyrA8187p.Leu296Ile1.000
gyrA8192c.891C>G1.000
gyrA8198c.897T>C1.000
gyrA8207c.906T>C1.000
gyrA8267c.966G>T1.000
gyrA8283p.Ile328Leu1.000
gyrA8288c.987T>C1.000
gyrA8312c.1011G>A1.000
gyrA8327c.1026C>T1.000
gyrA8330c.1029C>G1.000
gyrA8339c.1038A>G1.000
gyrA8340p.Ala347Ser1.000
gyrA8354c.1053G>C1.000
gyrA8366c.1065G>A1.000
gyrA8372c.1071G>T1.000
gyrA8382c.1081C>T1.000
gyrA8571c.1270C>T1.000
gyrA8576c.1275C>G1.000
gyrA8580p.Ile427Val1.000
gyrA8603c.1302A>C1.000
gyrA8609c.1308G>C1.000
gyrA8619c.1318T>C1.000
gyrA8624c.1323G>T1.000
gyrA8633c.1332C>G1.000
gyrA8636c.1335A>T1.000
gyrA8642c.1341A>G1.000
gyrA8645c.1344C>G1.000
gyrA8649p.Arg450Lys1.000
gyrA8666c.1365G>C0.950
gyrA8672c.1371A>G0.950
gyrA8693c.1392T>C0.917
gyrA8696c.1395G>C0.917
gyrA8699c.1398A>G0.909
gyrA8786c.1485T>G0.800
gyrA8792c.1491G>C0.933
gyrA8799p.Ala500Ser0.955
gyrA8810c.1509A>G1.000
gyrA8817p.Ser506Ala1.000
gyrA8828c.1527T>C1.000
gyrA8829c.1528T>C1.000
gyrA8837c.1536C>G1.000
gyrA8840c.1539C>T1.000
gyrA8852c.1551T>C1.000
gyrA8858c.1557T>C1.000
gyrA8870c.1569G>C1.000
gyrA8873c.1572A>G1.000
gyrA8897c.1596T>C0.986
gyrA8903c.1602T>C1.000
gyrA8915c.1614A>G1.000
gyrA8924c.1623C>T1.000
gyrA8942c.1641G>C1.000
gyrA8945c.1644G>C1.000
gyrA8946c.1645T>C1.000
gyrA8967p.Ala556Lys1.000
gyrA8978c.1677C>T1.000
gyrA8987c.1686C>G1.000
gyrA8990c.1689C>A1.000
gyrA8993c.1692C>T1.000
gyrA8996c.1695T>C1.000
gyrA8998p.Leu566Trp1.000
rpoB760079c.273G>A0.971
rpoB760091c.285G>C1.000
rpoB760110c.304T>A1.000
rpoB760118c.312T>G1.000
rpoB760121c.315T>C1.000
rpoB760130p.Asp108Glu1.000
rpoB760139c.333A>G1.000
rpoB760142c.336C>T1.000
rpoB760181c.375T>C1.000
rpoB760184c.378A>G1.000
rpoB760196c.390C>G1.000
rpoB760235c.429T>C1.000
rpoB760244c.438G>C1.000
rpoB760256c.450C>T1.000
rpoB760274p.Glu156Asp0.978
rpoB760276p.Lys157Met0.977
rpoB760283c.477G>C0.974
rpoB760298c.492G>C0.968
rpoB760307c.501T>C0.964
rpoB760357p.Thr184Ser0.963
rpoB760361c.555T>C0.964
rpoB760370c.564C>G0.974
rpoB760376p.Asp190Glu0.977
rpoB760382c.576G>C0.979
rpoB760400c.594G>C0.981
rpoB760406c.600G>C0.946
rpoB760407p.Ser201Gly0.982
rpoB760415c.609C>T1.000
rpoB760418c.612G>C1.000
rpoB760430c.624T>C1.000
rpoB760460c.654G>C1.000
rpoB760475c.669A>G0.976
rpoB760481c.675G>T0.962
rpoB760484c.678A>G0.975
rpoB760502c.696C>G0.977
rpoB760522p.Ser239Asn0.975
rpoB760532c.726T>C0.974
rpoB760541c.735G>C0.973
rpoB760567p.Ser254Trp0.920
rpoB760571c.765G>C0.923
rpoB760588p.Thr261Ile0.952
rpoB760591p.Val262Ala0.952
rpoB760595c.789C>T0.952
rpoB760596p.Thr264Pro0.952
rpoB760608c.802C>T0.963
rpoB760611c.805T>C0.964
rpoB760634c.828T>C0.982
rpoB760646c.840C>G0.981
rpoB760655c.849A>G0.979
rpoB760661c.855A>G0.978
rpoB760668p.Thr288Ala0.976
rpoB760674c.868T>C0.976
rpoB760679c.873A>G0.976
rpoB760683c.877T>C0.976
rpoB760703c.897C>T0.974
rpoB760721c.915C>G1.000
rpoB760727c.921C>G0.963
rpoB760730c.924T>C0.960
rpoB760736c.930C>G0.950
rpoB760805c.999G>C0.818
rpoB760817c.1011A>G0.867
rpoB760820c.1014T>C0.867
rpoB760826c.1020C>G0.875
rpoB760830c.1024T>C0.882
rpoB760841c.1035T>C0.893
rpoB760858p.Val351Ala0.906
rpoB760862c.1056G>C0.909
rpoB760886p.Glu360Asp0.947
rpoB760887p.Thr361Val0.947
rpoB760910c.1104C>T0.955
rpoB760916c.1110C>T0.955
rpoB760928c.1122G>C0.951
rpoB760946c.1140A>G0.977
rpoB760965p.Met387Leu0.966
rpoB760970c.1164G>C0.960
rpoB760973c.1167G>T0.958
rpoB760979c.1173G>A0.913
rpoB760982c.1176G>T0.952
rpoB760985c.1179G>C1.000
rpoB760988c.1182C>G1.000
rpoB760991c.1185G>C1.000
rpoB760997c.1191G>C1.000
rpoB761006c.1200C>G1.000
rpoB761015c.1209G>C1.000
rpoB761027c.1221A>C0.979
rpoB761036c.1230G>C0.978
rpoB761037c.1231T>C0.978
rpoB761051c.1245G>T0.982
rpoB761054c.1248G>C0.982
rpoB761060c.1254C>G0.983
rpoB761063c.1257C>G0.984
rpoB761084c.1278C>A0.986
rpoB761097c.1291A>T0.984
rpoB761102c.1296A>G0.984
rpoB761132c.1326G>T0.984
rpoB761133c.1327T>C0.984
rpoB761147c.1341C>T0.985
rpoB761150c.1344A>T0.984
rpoB761165c.1359G>C0.972
rpoB761178p.Ser458Thr1.000
rpoB761186p.Glu460Asp1.000
rpoB761189c.1383T>C1.000
rpoB761195c.1389G>C1.000
rpoB761198c.1392G>T1.000
rpoB761219c.1413G>C1.000
rpoB761231c.1425C>T1.000
rpoB761234c.1428G>T1.000
rpoB761249c.1443A>G1.000
rpoB761255c.1449T>G1.000
rpoB761258c.1452G>A1.000
rpoB761261c.1455G>C0.981
rpoB761264c.1458C>G0.981
rpoB761273c.1467T>C1.000
rpoB761276c.1470G>C1.000
rpoB761297c.1491C>T1.000
rpoB761318c.1512G>C1.000
rpoB761327c.1521A>G1.000
rpoB761339c.1533C>G1.000
rpoB761516c.1710G>C0.967
rpoB761528c.1722C>T0.968
rpoB761537c.1731C>G0.974
rpoB761555c.1749G>C0.978
rpoB761558c.1752C>G0.979
rpoB761564c.1758G>C0.981
rpoB761573c.1767C>G0.984
rpoB761579c.1773G>C0.985
rpoB761606c.1800C>G0.976
rpoB761612c.1806G>T0.989
rpoB761615c.1809A>C0.978
rpoB761636c.1830G>T1.000
rpoB761645c.1839C>G1.000
rpoB761648c.1842T>C0.989
rpoB761669c.1863C>T1.000
rpoB761675c.1869G>C1.000
rpoB761687c.1881C>T1.000
rpoB761690c.1884G>C1.000
rpoB761693c.1887G>C1.000
rpoB761705c.1899C>A1.000
rpoB761718638AEES>638AEKA1.000
rpoB761741c.1935G>A1.000
rpoB761750c.1944G>T1.000
rpoB761760p.Ile652Val1.000
rpoB761765c.1959T>C1.000
rpoB761891c.2085G>C1.000
rpoB761892p.Ile696Val1.000
rpoB761909c.2103T>C1.000
rpoB761912c.2106T>C1.000
rpoB761915p.Asp703Glu1.000
rpoB761916p.Asp704Asn0.970
rpoB761924c.2118G>A1.000
rpoB761930c.2124G>C0.974
rpoB761933c.2127G>C0.974
rpoB761936c.2130C>T0.974
rpoB761948c.2142G>C0.979
rpoB761954c.2148C>A0.979
rpoB761955p.Ile717Val0.979
rpoB761969c.2163G>A0.983
rpoB761990c.2184G>C0.986
rpoB762008c.2202C>T0.972
rpoB762014c.2208C>G0.972
rpoB762038c.2232C>T0.965
rpoB762047c.2241G>A0.962
rpoB762053c.2247T>C0.979
rpoB762056c.2250G>A0.979
rpoB762065c.2259T>G0.979
rpoB762083c.2277T>C1.000
rpoB762086c.2280G>C1.000
rpoB762101c.2295C>G1.000
rpoB762114p.Ile770Val1.000
rpoB762122c.2316C>T1.000
rpoB762131c.2325C>G1.000
rpoB762134c.2328C>A1.000
rpoB762140c.2334G>C1.000
rpoB762143c.2337T>C1.000
rpoB762158c.2352G>C1.000
rpoB762167c.2361T>C1.000
rpoB762176c.2370T>C1.000
rpoB762185c.2379G>C1.000
rpoB762194c.2388G>C1.000
rpoB762233c.2427G>C0.984
rpoB762236c.2430G>C0.984
rpoB762239c.2433G>A0.952
rpoB762245c.2439G>C0.986
rpoB762254c.2448T>C0.959
rpoB762293c.2487T>C0.983
rpoB762296c.2490G>C0.983
rpoB762314c.2508C>T0.920
rpoB762317c.2511A>G0.958
rpoB762323c.2517C>A0.953
rpoB762329c.2523G>C0.953
rpoB762392c.2586G>C0.818
rpoB762395c.2589G>T0.833
rpoB762398c.2592T>C0.857
rpoB762404c.2598T>C0.944
rpoB762410c.2604T>G0.951
rpoB762416c.2610A>G0.952
rpoB762449c.2643C>A0.940
rpoB762452c.2646G>C0.940
rpoB762470c.2664G>C0.959
rpoB762488c.2682G>C0.955
rpoB762491c.2685T>C0.953
rpoB762509c.2703T>G0.889
rpoB762510p.Ala902Pro0.889
rpoB762515c.2709C>T0.970
rpoB762533c.2727T>C0.952
rpoB762536c.2730T>C0.944
rpoB762537c.2731T>C0.944
rpoB762551c.2745C>T0.929
rpoB762557c.2751G>A0.800
rpoB762827c.3021G>C1.000
rpoB762857c.3051C>G1.000
rpoB762860c.3054G>C1.000
rpoB762863c.3057T>C1.000
rpoB762866c.3060C>T1.000
rpoB762879p.Met1025Leu1.000
rpoB762894c.3088C>T1.000
rpoB762899c.3093G>C1.000
rpoB762917c.3111C>G1.000
rpoB762920c.3114C>T1.000
rpoB762923c.3117C>G1.000
rpoB762929c.3123G>C1.000
rpoB762959c.3153G>C1.000
rpoB762962c.3156C>T1.000
rpoB762995c.3189G>T1.000
rpoB763031c.3225T>G1.000
rpoB763034c.3228C>G1.000
rpoB763040c.3234C>G1.000
rpoB763070c.3264T>C0.984
rpoB763082c.3276C>T0.983
rpoB763088c.3282C>G0.982
rpoB763094c.3288G>C0.983
rpoB763115c.3309T>C0.981
rpoB763127c.3321G>C0.980
rpoB763136c.3330C>T0.980
rpoB763145c.3339G>A0.978
rpoB763157c.3351G>T0.973
rpoB763166c.3360A>G0.970
rpoB763172c.3366G>C0.967
rpoB763179c.3373C>T0.926
rpoB763193c.3387C>G0.957
rpoC763402c.33C>T1.000
rpoC763408c.39T>C1.000
rpoC763411c.42T>C1.000
rpoC763414c.45T>G1.000
rpoC763415p.Thr16Ser1.000
rpoC763423p.Glu18Asp1.000
rpoC763430c.61A>C1.000
rpoC763433p.Gln22Asn1.000
rpoC763443p.Tyr25Phe1.000
rpoC763450c.81G>A1.000
rpoC763456c.87A>G1.000
rpoC763468c.99G>C1.000
rpoC763486c.117T>C1.000
rpoC763492c.123G>C1.000
rpoC763528c.159G>A1.000
rpoC763531c.162G>T1.000
rpoC763546c.177A>G1.000
rpoC763570c.201G>C1.000
rpoC763594c.225C>T1.000
rpoC763609c.240C>T0.984
rpoC763621c.252C>T0.971
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G1.000
rpoC763675c.306C>G1.000
rpoC763696c.327T>C1.000
rpoC763699c.330G>T1.000
rpoC763702c.333C>G1.000
rpoC763708c.339G>C1.000
rpoC763711c.342G>C1.000
rpoC763714c.345G>C1.000
rpoC763717c.348T>C1.000
rpoC763723c.354G>C1.000
rpoC763732c.363C>G1.000
rpoC763741c.372C>T1.000
rpoC763744c.375G>C1.000
rpoC763747c.378G>A1.000
rpoC763765c.396T>C1.000
rpoC763894c.525A>G1.000
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser0.969
rpoC763945c.576T>C0.969
rpoC763947p.Ala193Val0.969
rpoC763951c.582G>C0.939
rpoC763960c.591T>G0.939
rpoC763969c.600C>T0.939
rpoC763987c.618C>T0.913
rpoC763991p.Ile208Leu0.889
rpoC763996c.627T>C0.889
rpoC763999c.630C>T0.889
rpoC764002c.633C>G0.889
rpoC764003p.Ala212Ser0.889
rpoC764024c.655T>C0.929
rpoC764029p.Glu220Asp0.889
rpoC764032p.Asp221Glu0.931
rpoC764040p.Ser224Thr0.950
rpoC764044c.675T>C0.950
rpoC764054c.685C>T0.944
rpoC764059c.690G>T0.923
rpoC764083c.714A>G0.925
rpoC764084p.Asn239Val0.925
rpoC764098c.729A>G0.949
rpoC764110c.741C>T0.974
rpoC764143c.774G>C0.955
rpoC764147p.Ser260Ala0.950
rpoC764150p.Ile261Val0.950
rpoC764165p.Glu266Gln0.950
rpoC764311c.942C>G1.000
rpoC764317c.948C>G1.000
rpoC764320c.951C>G1.000
rpoC764338c.969G>A1.000
rpoC764353c.984G>T1.000
rpoC764362c.993C>T0.966
rpoC764365c.996C>T1.000
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>T0.978
rpoC764431c.1062G>C0.978
rpoC764434c.1065A>G0.978
rpoC764435c.1066A>C0.978
rpoC764452c.1083T>C0.964
rpoC764458c.1089G>C0.982
rpoC764461c.1092A>G0.983
rpoC764497c.1128A>G0.985
rpoC764509c.1140G>A0.967
rpoC764510c.1141C>T0.983
rpoC764521c.1152T>C0.964
rpoC764527c.1158C>T0.953
rpoC764530c.1161C>T0.976
rpoC764533c.1164C>A0.953
rpoC764536c.1167G>T0.932
rpoC764539c.1170C>G0.953
rpoC764545c.1176C>A0.966
rpoC764575c.1206T>G0.985
rpoC764593c.1224C>T0.985
rpoC764611c.1242G>T0.985
rpoC764626c.1257C>T0.985
rpoC764632c.1263T>C0.984
rpoC764650c.1281G>T0.983
rpoC764668c.1299C>T0.984
rpoC764692c.1323C>T1.000
rpoC764696c.1327C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764731c.1362G>A1.000
rpoC764746c.1377G>T1.000
rpoC764752c.1383G>C0.983
rpoC764758c.1389C>G0.983
rpoC764764c.1395T>C1.000
rpoC764791c.1422C>G0.984
rpoC764803c.1434C>T1.000
rpoC764809c.1440C>T1.000
rpoC764810p.Pro481Ala0.984
rpoC764815c.1446A>G1.000
rpoC764824c.1455T>C1.000
rpoC764827c.1458G>C1.000
rpoC764858c.1489T>C1.000
rpoC764869c.1500C>T0.969
rpoC764875c.1506C>A0.985
rpoC764887c.1518G>C0.984
rpoC764888c.1519T>C0.984
rpoC764911c.1542A>G0.981
rpoC764912p.Met515Gln0.981
rpoC764932c.1563C>A0.984
rpoC764948c.1579T>C0.968
rpoC764968c.1599T>C0.983
rpoC765001c.1632C>T0.882
rpoC765004c.1635G>T0.938
rpoC765007c.1638T>G0.938
rpoC765008c.1639T>C0.938
rpoC765011c.1642A>T0.938
rpoC765016c.1647C>G1.000
rpoC765019c.1650A>G1.000
rpoC765040c.1671T>C1.000
rpoC765041c.1672T>C1.000
rpoC765047c.1678T>C1.000
rpoC765055c.1686C>G1.000
rpoC765343c.1974G>A1.000
rpoC765352c.1983G>C1.000
rpoC765356p.Met663Val1.000
rpoC765370c.2001G>A1.000
rpoC765379c.2010G>C1.000
rpoC765382c.2013G>T1.000
rpoC765383p.Met672Leu1.000
rpoC765403c.2034G>C1.000
rpoC765405p.Leu679His1.000
rpoC765409c.2040T>G1.000
rpoC765421c.2052C>G1.000
rpoC765449p.Ala694Ser1.000
rpoC765454c.2085C>G1.000
rpoC765469c.2100G>C0.981
rpoC765478c.2109T>G0.980
rpoC765480p.Tyr704Phe0.981
rpoC765499c.2130C>G0.979
rpoC765517c.2148C>G0.975
rpoC765529c.2160C>T0.972
rpoC765533p.Tyr722His0.972
rpoC765544c.2175C>G0.960
rpoC765547c.2178C>T0.958
rpoC765548c.2179A>T0.958
rpoC765553c.2184C>T0.958
rpoC765556c.2187G>C0.958
rpoC765562c.2193G>C0.958
rpoC765835c.2466C>T0.975
rpoC765841c.2472G>T0.977
rpoC765861p.Phe831Tyr0.982
rpoC765875p.Val836Ile0.984
rpoC765895c.2526G>A0.984
rpoC765907c.2538G>T0.982
rpoC765910c.2541G>C0.982
rpoC765928c.2559C>G0.978
rpoC765940c.2571A>T1.000
rpoC765947c.2578T>C1.000
rpoC765962c.2593T>C1.000
rpoC765967c.2598C>T1.000
rpoC765973c.2604C>G1.000
rpoC765979c.2610C>G1.000
rpoC765982c.2613C>T1.000
rpoC765994c.2625A>T1.000
rpoC766321c.2952C>G0.938
rpoC766333c.2964G>T0.944
rpoC766345c.2976T>C0.944
rpoC766348c.2979A>G0.944
rpoC766351c.2982C>G0.944
rpoC766353p.Val995Ala0.944
rpoC766369c.3000C>G0.971
rpoC766375c.3006C>G0.971
rpoC766381c.3012C>T0.971
rpoC766384c.3015A>G0.972
rpoC766390c.3021C>T0.973
rpoC766393c.3024C>T0.974
rpoC766408c.3039C>T0.979
rpoC766435p.Glu1022Asp1.000
rpoC766513c.3144C>T1.000
rpoC766522c.3153C>A0.909
rpoC766528c.3159T>G0.909
rpoC766531c.3162G>C0.909
rpoC766534c.3165C>G0.909
rpoC766537c.3168G>A0.909
rpoC766540p.Asp1057Glu0.909
rpoC766549c.3180G>C0.957
rpoC766570c.3201T>C0.957
rpoC766573c.3204T>G1.000
rpoC766582c.3213C>T0.957
rpoC766594c.3225G>T0.957
rpoC766607p.Ile1080Leu0.957
rpoC766618c.3249G>T0.957
rpoC766624c.3255G>C0.957
rpoC766630c.3261G>C0.944
rpoC766633c.3264G>C0.944
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C1.000
rpoC766843c.3474T>G1.000
rpoC766846c.3477C>A1.000
rpoC766858c.3489C>T1.000
rpoC766861c.3492G>C1.000
rpoC766867c.3498C>G1.000
rpoC766876c.3507C>T1.000
rpoC766931p.Ala1188Ser1.000
rpoC766942c.3573C>T1.000
rpoC766945c.3576A>C1.000
rpoC766963c.3594T>C1.000
rpoC766996c.3627C>T1.000
rpoC767002c.3633G>C1.000
rpoC767008c.3639G>A1.000
rpoC767023c.3654C>T1.000
rpoC767044c.3675G>C1.000
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C1.000
rpsL781572p.Gln5Asn1.000
rpsL781586c.27C>T1.000
rpsL781595c.36T>C1.000
rpsL781608p.Ser17Ala1.000
rpsL781616c.57C>G1.000
rpsL781628c.69T>C1.000
rpsL781649c.90T>C1.000
rpsL781655c.96T>C1.000
rpsL781658c.99A>C1.000
rpsL781670c.111G>C1.000
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T1.000
rpsL781802c.243G>C1.000
rpsL781814c.255C>T1.000
rpsL781817c.258G>T1.000
rpsL781829c.270G>C1.000
rpsL781832c.273T>C1.000
rpsL781859c.300T>C0.978
rpsL781868c.309T>C0.978
rpsL781871c.312G>C0.977
rpsL781877c.318T>A0.975
rpsL781892c.333A>G0.971
rpsL781898c.339A>T0.971
rpsL781907c.348T>C0.968
rpsL781916c.357T>C0.964
rpsL781929p.Gly124Ser0.950
rpsL781933374G>A0.947
rplC800796c.-13ATTGG>A1.000
rrs1471922r.77gt>g1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c1.000
rrs1471986r.141c>t1.000
rrs1472030r.185g>a1.000
rrs1472031r.186g>c1.000
rrs1472032r.187g>a1.000
rrs1472033r.188a>c1.000
rrs1472035r.190g>t1.000
rrs1472040r.195t>g1.000
rrs1472041r.196c>t1.000
rrs1472042r.197t>g1.000
rrs1472043r.198t>a1.000
rrs1472050r.205g>c1.000
rrs1472053r.208agc>a1.000
rrs1472061r.216a>t1.000
rrs1472106r.261g>a1.000
rrs1472108r.263c>t1.000
rrs1472113r.268t>c1.000
rrs1472150r.305t>a0.984
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a1.000
rrs1472452r.607g>a1.000
rrs1472464r.619a>g1.000
rrs1472612r.767g>t1.000
rrs1472734r.889c>t1.000
rrs1472741r.896g>a1.000
rrs1472846r.1001c>t1.000
rrs1472848r.1003t>c0.979
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c0.980
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a1.000
rrs1473088r.1243a>g1.000
rrs1473099r.1254t>a1.000
rrs1473104r.1259c>t1.000
rrs1473105r.1260g>a1.000
rrs1473110r.1265t>g1.000
rrs1473111r.1266a>g1.000
rrs1473121r.1276t>c1.000
rrs1473123r.1278a>t1.000
rrs1473129r.1284c>t1.000
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t0.982
rrs1473290r.1445c>t0.982
rrs1473291r.1446g>t0.982
rrl1473684r.27g>a1.000
rrl1473695r.38a>ac1.000
rrl1473697r.40c>a1.000
rrl1473699r.42ag>a1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c1.000
rrl1473831r.174g>t1.000
rrl1473832r.175c>t1.000
rrl1473839r.182g>a1.000
rrl1473876r.219g>a1.000
rrl1473887r.230t>c1.000
rrl1473888r.231t>c1.000
rrl1473898r.241c>t1.000
rrl1473899r.242a>g1.000
rrl1473916r.259c>a1.000
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474061r.404t>c1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.885
rrl1474184r.527c>a1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474291r.634tttcctctccggagga>t1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.984
rrl1474497r.840g>c0.984
rrl1474506r.849c>g0.982
rrl1474507r.850g>c0.982
rrl1474626r.969t>c1.000
rrl1474632r.975g>t1.000
rrl1474636r.979a>t1.000
rrl1474637r.980c>t1.000
rrl1474638r.981c>g1.000
rrl1474639r.982g>t1.000
rrl1474640r.983c>t1.000
rrl1474708r.1051c>caataa0.735
rrl1474710r.1053tggtg>t1.000
rrl1474717r.1060a>g1.000
rrl1474722r.1065t>c0.971
rrl1474743r.1086t>g0.980
rrl1474760r.1103a>g1.000
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t0.980
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a0.983
rrl1475202r.1545g>c0.970
rrl1475209r.1552g>a0.967
rrl1475213r.1556c>t0.966
rrl1475220r.1563g>t0.964
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a1.000
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t0.971
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a0.944
rrl1475760r.2103ccg>c0.958
rrl1475764r.2107a>t0.955
rrl1475765r.2108a>t0.955
rrl1475975r.2318c>t1.000
rrl1475977r.2320a>g1.000
rrl1475988r.2331a>g1.000
rrl1475989r.2332t>c1.000
rrl1475993r.2336c>t1.000
rrl1475997r.2340a>t1.000
rrl1476085r.2428g>a0.944
rrl1476086r.2429g>a0.944
rrl1476088r.2431a>c0.944
rrl1476099r.2442a>g0.941
rrl1476103r.2446c>g0.944
rrl1476105r.2448g>a0.944
rrl1476106r.2449a>t0.944
rrl1476110r.2453g>c0.944
rrl1476114r.2457t>c0.944
rrl1476115r.2458t>c0.944
rrl1476131r.2474c>t0.979
rrl1476160r.2503t>c0.981
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c0.980
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t1.000
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a0.985
rrl1476608r.2951c>g0.984
rrl1476619r.2962c>t0.983
rrl1476628r.2971t>a0.982
rrl1476665r.3008t>a0.973
rrl1476666r.3009c>t0.973
rrl1476674r.3017t>c0.943
rpsA1833536c.-6A>C1.000
rpsA1833538c.-4CA>C1.000
rpsA1833541c.-1T>C1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C1.000
rpsA1833595c.54T>G1.000
rpsA1833596p.Ser19Ala1.000
rpsA1833604c.63C>T1.000
rpsA1833616c.75A>T1.000
rpsA1833619c.78A>C1.000
rpsA1833625c.84A>G0.980
rpsA1833664c.123C>G0.981
rpsA1833676c.135A>G0.977
rpsA1833679c.138G>T0.974
rpsA1833685c.144G>C0.973
rpsA1833691c.150G>A0.973
rpsA1833694c.153G>T0.972
rpsA1833697c.156C>T0.974
rpsA1833700c.159C>T0.975
rpsA1833709c.168C>T0.980
rpsA1833724c.183C>T0.978
rpsA1833727c.186G>C0.978
rpsA1833733c.192C>G0.978
rpsA1833734p.Ala65Ser0.978
rpsA1833742c.201A>G0.980
rpsA1833745c.204G>C0.980
rpsA1833748c.207C>G0.980
rpsA1833760c.219C>T0.982
rpsA1833787c.246C>G0.982
rpsA1833790c.249T>C0.981
rpsA1833802c.261A>G0.982
rpsA1833811c.270G>T0.982
rpsA1833823c.282G>A0.984
rpsA1833832c.291G>A0.981
rpsA1833835c.294C>T0.981
rpsA1833838c.297G>C0.981
rpsA1833841c.300C>G0.981
rpsA1833847c.306C>G1.000
rpsA1833862c.321G>T0.985
rpsA1833874c.333T>G0.987
rpsA1833877c.336C>G0.974
rpsA1833886c.345C>G0.988
rpsA1833894p.Ala118Glu0.988
rpsA1833928c.387G>C0.987
rpsA1833949c.408T>C0.986
rpsA1833961c.420C>G0.986
rpsA1833970c.429G>T0.969
rpsA1833979c.438T>C0.985
rpsA1833991c.450C>G0.984
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834348c.807T>C1.000
rpsA1834357c.816T>C1.000
rpsA1834366c.825A>G1.000
rpsA1834375c.834G>T1.000
rpsA1834396c.855G>C1.000
rpsA1834411c.870T>G1.000
rpsA1834414c.873C>T1.000
rpsA1834417c.876G>C1.000
rpsA1834423c.882G>C1.000
rpsA1834429c.888C>T1.000
rpsA1834438c.897C>T1.000
rpsA1834451c.910T>C1.000
rpsA1834456c.915T>G1.000
rpsA1834468c.927A>G1.000
rpsA1834477c.936C>T1.000
rpsA1834489c.948T>C1.000
rpsA1834516c.975G>A1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C1.000
rpsA1834543c.1002C>G1.000
rpsA1834546c.1005T>C1.000
rpsA1834552c.1011G>T1.000
rpsA1834555c.1014T>G1.000
rpsA1834557p.Ala339Gly1.000
rpsA1834606c.1065C>T1.000
rpsA1834609c.1068T>C1.000
rpsA1834619c.1078T>C1.000
rpsA1834622c.1081T>A1.000
rpsA1834633c.1092A>G1.000
rpsA1834639c.1098T>C1.000
rpsA1834645c.1104C>T1.000
rpsA1834666c.1125G>C1.000
rpsA1834667p.Ala376Ser1.000
rpsA1834690c.1149T>C1.000
rpsA1834700p.Gln387Ala1.000
rpsA1834705c.1164C>G1.000
rpsA1834720c.1179C>G1.000
rpsA1834732c.1191T>C1.000
rpsA1834738c.1197A>G0.985
rpsA1834747c.1206A>G0.986
rpsA1834759c.1218A>C0.970
rpsA1834765p.Glu408Asp0.984
rpsA1834774c.1233C>T0.979
rpsA1834776p.Ala412Glu0.979
rpsA1834780c.1239A>G0.979
rpsA1834789c.1248T>C0.979
rpsA1834813c.1272G>T0.971
rpsA1834830p.Ala430Val0.968
kasA2518738c.624G>C1.000
kasA2518756c.642G>C1.000
kasA2518768c.654C>G1.000
kasA2518771c.657C>G1.000
kasA2518774c.660C>T1.000
kasA2518783c.669T>G0.979
kasA2518787p.Arg225Lys1.000
kasA2518792c.678C>T1.000
kasA2518795c.681C>T1.000
kasA2518798c.684G>C1.000
kasA2518822c.708C>A1.000
kasA2518825c.711T>C1.000
kasA2518846c.732G>T1.000
kasA2518849c.735G>C1.000
kasA2518853p.Leu247Val1.000
kasA2518864c.750G>C1.000
thyX3067814c.132A>G1.000
thyX3067841c.105C>G1.000
thyX3067847c.99G>C1.000
thyX3067862c.84G>A1.000
thyX3067869p.Thr26Ser1.000
embC4240729c.867C>G0.914
embC4240735c.873C>G0.944
embC4240741c.879C>T0.949
embC4240756c.894G>C0.958
embC4240771c.909G>C0.953
embC4240772p.Ser304Ala0.953
embC4240778p.His306Gly0.953
embC4240781p.Ala307Ser0.953
embC4240789c.927T>C0.966
embC4240819c.957A>C0.970
embC4240826p.Ala322Ser0.967
embC4240831c.969T>G0.966
embC4240856p.Ala332Thr0.923
embC4240859p.Leu333Ile0.923
embC4240876c.1014C>T0.939
embC4240879c.1017G>T0.970
embC4240885c.1023T>C0.969
embC4240886p.Ile342Val0.969
embC4240897c.1035C>G0.964
embC4240900c.1038A>G0.958

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;