TB Profiler
This tool processes raw sequence data to infer strain type and identify known drug resistance markers.
A stand alone version of this tool is now available and can now be run on linux or mac. Installation instructions can be found on GitHub and on the bioconda page.



This tool is for Research Use Only. Data and information provided through use of this tool are not intended for medical purpose or objective and should not be used for clinical diagnosis, patient management, or human clinical trials.
Back to results page.
Single nucleotide polymorphisms (SNPs) in coding regions are annotated using the reference amino acid, codon number and alternative amino acid (e.g. Ser315Thr in katG). SNPs in non-coding regions (i.e. RNA genes and intergenic regions) are annotated using the reference nucleotide, gene coordinate and alternative nucleotide (e.g. A1401G in rrs or C-37A in eis promoter). Indels are annotated using the reference VCF allele, gene coordinate and alternative VCF allele (e.g. T902TA insertion in katG).
Name: 5d80470c9b048
Sample: 5d80470c9b048

Download results

Summary
ID: 5d80470c9b048
Date: Tue Sep 17 03:49:08 2019
Strain: lineage2.2.1
Drug-resistance: Sensitive

Drug1ResistanceSupporting Mutations (frequency)
Isoniazid
Rifampicin
Ethambutol
Pyrazinamide
Streptomycin
Ethionamide
Fluoroquinolones
Amikacin
Capreomycin
Kanamycin

Lineage2FamilyMain SpoligotypeRDS
lineage2East-AsianBeijingRD105
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181

Mutations in candidate genes:
GeneChromosome PositionMutationEstimated fraction
gyrB6100c.861G>A1.000
gyrB6115c.876A>G0.957
gyrB6121c.882C>T0.957
gyrB6127c.888G>C0.957
gyrB6133c.894G>C0.957
gyrB6136c.897G>A0.913
gyrB6151c.912C>T0.957
gyrB6172c.933C>T0.957
gyrB6184c.945C>T0.957
gyrB6193c.954G>A0.923
gyrB6196c.957C>T0.917
gyrB6202c.963C>T0.900
gyrB6203p.Ser322Ala0.900
gyrB6214c.975G>C0.900
gyrB6223c.984G>C0.900
gyrB6646c.1407C>T0.909
gyrB6655c.1416T>C0.957
gyrB6673c.1434A>C0.964
gyrB6676c.1437T>G0.967
gyrB6703c.1464G>C0.969
gyrB6706c.1467G>A0.969
gyrB6709c.1470A>G0.969
gyrB6712c.1473G>C0.969
gyrB6727c.1488G>T0.973
gyrB6728c.1489C>T0.973
gyrB6739c.1500C>T0.978
gyrB6745c.1506T>C0.980
gyrB6754c.1515C>T0.982
gyrB6763c.1524G>C0.983
gyrB6772c.1533C>G0.966
gyrB6775c.1536G>C0.966
gyrB6793c.1554T>C1.000
gyrB6798p.Gly520Ala0.987
gyrB6808c.1569C>G0.986
gyrB6824c.1585C>T0.985
gyrB6841c.1602T>C0.985
gyrB6862c.1623C>G0.985
gyrB6869c.1630T>C0.981
gyrB6872c.1633T>C0.981
gyrB6878c.1639T>C0.981
gyrB6889c.1650G>A0.979
gyrB6898c.1659G>T0.975
gyrB7006c.1767T>G0.867
gyrB7010p.Leu591Met0.867
gyrB7015c.1776G>A0.875
gyrB7018c.1779G>C0.812
gyrB7024c.1785G>C0.812
gyrB7033c.1794G>C0.882
gyrB7051p.Glu604Asp0.895
gyrB7060c.1821T>C0.941
gyrB7066c.1827G>T0.941
gyrB7078c.1839A>G0.941
gyrB7081c.1842T>C0.941
gyrB7084c.1845A>G0.941
gyrB7090c.1851C>T0.941
gyrB7093c.1854T>C0.941
gyrB7100c.1861T>C0.941
gyrA7499c.198G>C0.900
gyrA7511c.210C>T0.935
gyrA7523c.222C>G0.923
gyrA7526c.225G>A0.927
gyrA7547c.246C>T0.958
gyrA7553c.252C>T0.960
gyrA7559c.258G>C0.961
gyrA7565c.264C>T0.981
gyrA7574c.273G>C0.983
gyrA7585p.Ser95Thr1.000
gyrA7589c.288G>C0.967
gyrA7595c.294C>T0.968
gyrA7607c.306C>T0.965
gyrA7637c.336C>A0.955
gyrA8121c.820T>C0.909
gyrA8129c.828T>C1.000
gyrA8156c.855T>C1.000
gyrA8159c.858G>C1.000
gyrA8168c.867A>G1.000
gyrA8174c.873C>G0.909
gyrA8177c.876A>C0.909
gyrA8187p.Leu296Ile0.909
gyrA8192c.891C>G0.909
gyrA8198c.897T>C0.909
gyrA8207c.906T>C0.909
gyrA8264c.963T>C0.963
gyrA8267c.966G>C0.969
gyrA8283p.Ile328Leu0.973
gyrA8288c.987T>C0.974
gyrA8294c.993T>C0.976
gyrA8327c.1026C>T0.978
gyrA8330c.1029C>G0.978
gyrA8339c.1038A>G0.978
gyrA8340p.Ala347Ser0.978
gyrA8354c.1053G>C0.978
gyrA8366c.1065G>A0.976
gyrA8372c.1071G>T0.974
gyrA8382c.1081C>T0.968
gyrA8792c.1491G>C0.929
gyrA8799p.Ala500Ser0.941
gyrA8810c.1509A>G0.947
gyrA8817p.Ser506Ala0.947
gyrA8828c.1527T>C0.952
gyrA8829c.1528T>C0.952
gyrA8837c.1536C>G0.969
gyrA8846c.1545C>T0.972
gyrA8852c.1551T>C0.974
gyrA8858c.1557T>C0.976
gyrA8870c.1569G>C0.977
gyrA8873c.1572A>G0.979
gyrA8897c.1596T>C0.952
gyrA8903c.1602T>C0.952
gyrA8915c.1614A>G0.955
gyrA8942c.1641G>T0.958
gyrA8945c.1644G>C0.958
gyrA8946c.1645T>C0.958
gyrA8957c.1656C>T0.956
gyrA8967p.Ala556Lys0.946
gyrA8978c.1677C>T0.944
gyrA8987c.1686C>G0.931
gyrA8990c.1689C>G0.923
gyrA8993c.1692C>T0.920
gyrA8996c.1695T>C0.920
gyrA8998p.Leu566Trp0.920
gyrA9018p.Gln573Lys0.941
gyrA9023c.1722A>C0.867
gyrA9026c.1725G>C0.857
gyrA9029c.1728T>C0.857
gyrA9035c.1734G>C0.846
gyrA9044c.1743C>G0.800
rpoB760079c.273G>A0.957
rpoB760091c.285G>C0.958
rpoB760101c.295T>C1.000
rpoB760110c.304T>A0.958
rpoB760118c.312T>G0.920
rpoB760121c.315T>C0.926
rpoB760130p.Asp108Glu0.909
rpoB760139c.333A>G0.917
rpoB760181c.375T>C0.929
rpoB760184c.378A>G0.929
rpoB760196c.390C>G0.927
rpoB760235c.429T>C0.943
rpoB760244c.438G>C0.943
rpoB760256c.450C>T0.941
rpoB760274p.Glu156Asp0.931
rpoB760276p.Lys157Met0.931
rpoB760283c.477G>C0.963
rpoB760298c.492G>C0.955
rpoB760307c.501T>C0.947
rpoB760357p.Thr184Ser1.000
rpoB760361c.555T>C1.000
rpoB760370c.564C>G1.000
rpoB760376p.Asp190Glu1.000
rpoB760382c.576G>C1.000
rpoB760388c.582C>T1.000
rpoB760400c.594G>C0.974
rpoB760406c.600G>C0.886
rpoB760407p.Ser201Gly0.976
rpoB760415c.609C>T0.981
rpoB760418c.612G>C0.981
rpoB760430c.624T>C0.983
rpoB760460c.654G>C0.987
rpoB760475c.669A>G0.986
rpoB760481c.675G>C0.986
rpoB760484c.678A>G0.986
rpoB760502c.696C>G1.000
rpoB760522p.Ser239Asn1.000
rpoB760532c.726T>C1.000
rpoB760541c.735G>C1.000
rpoB760567c.763 764insGC1.000
rpoC763435p.Gln22His0.800
rpoC763443p.Tyr25Phe0.800
rpoC763450c.81G>A0.951
rpoC763456c.87A>G0.952
rpoC763468c.99G>C0.940
rpoC763486c.117T>C0.946
rpoC763492c.123G>C0.950
rpoC763528c.159G>A0.968
rpoC763531c.162G>T0.969
rpoC763546c.177A>G0.967
rpoC763570c.201G>C0.984
rpoC763594c.225C>T1.000
rpoC763633c.264T>C1.000
rpoC763657c.288G>A1.000
rpoC763660c.291T>G1.000
rpoC763666c.297G>C1.000
rpoC763669c.300C>G0.973
rpoC763675c.306C>G0.971
rpoC763696c.327T>C0.917
rpoC763699c.330G>T0.917
rpoC763702c.333C>G0.917
rpoC763708c.339G>C0.909
rpoC763711c.342G>C0.909
rpoC763714c.345G>C0.909
rpoC763717c.348T>C0.909
rpoC763723c.354G>C0.909
rpoC763732c.363C>A0.900
rpoC763741c.372C>T0.900
rpoC763744c.375G>C0.900
rpoC763900c.531G>C1.000
rpoC763933c.564C>T1.000
rpoC763940p.Ala191Ser1.000
rpoC763947p.Ala193Val1.000
rpoC763951c.582G>C1.000
rpoC763960c.591T>G1.000
rpoC763969c.600C>T1.000
rpoC763987c.618C>T1.000
rpoC763991p.Ile208Leu1.000
rpoC763996c.627T>C1.000
rpoC763999c.630C>T1.000
rpoC764002c.633C>G1.000
rpoC764003p.Ala212Ser1.000
rpoC764024c.655T>C1.000
rpoC764029p.Glu220Asp1.000
rpoC764032p.Asp221Glu1.000
rpoC764040p.Ser224Thr1.000
rpoC764044c.675T>C1.000
rpoC764054c.685C>T1.000
rpoC764059c.690G>T1.000
rpoC764083c.714A>G1.000
rpoC764084p.Asn239Val1.000
rpoC764095c.726C>T0.952
rpoC764098c.729A>G0.952
rpoC764110c.741C>T0.952
rpoC764143c.774G>C0.929
rpoC764147p.Ser260Ala0.917
rpoC764150p.Ile261Val0.909
rpoC764165p.Glu266Gln0.909
rpoC764311c.942C>G0.846
rpoC764317c.948C>G0.857
rpoC764320c.951C>G0.867
rpoC764338c.969G>A0.926
rpoC764353c.984G>T0.943
rpoC764365c.996C>T0.971
rpoC764371c.1002G>C1.000
rpoC764377c.1008C>G1.000
rpoC764380c.1011G>C1.000
rpoC764387c.1018T>C1.000
rpoC764405c.1036A>C1.000
rpoC764428c.1059G>C1.000
rpoC764431c.1062G>C1.000
rpoC764434c.1065A>G1.000
rpoC764435c.1066A>C1.000
rpoC764458c.1089G>C1.000
rpoC764461c.1092A>G1.000
rpoC764470c.1101C>T1.000
rpoC764497c.1128A>G1.000
rpoC764510c.1141C>T1.000
rpoC764524c.1155C>G0.982
rpoC764530c.1161C>G0.981
rpoC764534c.1165C>A0.980
rpoC764539c.1170C>T0.980
rpoC764542c.1173C>T0.980
rpoC764545c.1176C>A0.980
rpoC764560c.1191T>C0.982
rpoC764575c.1206T>G0.982
rpoC764611c.1242G>T0.982
rpoC764626c.1257C>T0.983
rpoC764632c.1263T>C0.982
rpoC764650c.1281G>T0.981
rpoC764668c.1299C>T0.981
rpoC764692c.1323C>T1.000
rpoC764713c.1344G>T1.000
rpoC764716c.1347G>C1.000
rpoC764746c.1377G>T0.966
rpoC764752c.1383G>C0.968
rpoC764758c.1389C>G0.969
rpoC764764c.1395T>C0.956
rpoC764791c.1422C>G0.956
rpoC764803c.1434C>T0.952
rpoC764809c.1440C>T0.943
rpoC764810p.Pro481Ala0.943
rpoC764815c.1446A>G0.943
rpoC764824c.1455T>C0.942
rpoC764827c.1458G>C0.942
rpoC764858c.1489T>C0.950
rpoC764869c.1500C>T0.945
rpoC764875c.1506C>A0.964
rpoC764887c.1518G>C0.961
rpoC764888c.1519T>C0.962
rpoC764911c.1542A>G0.957
rpoC764912p.Met515Gln0.956
rpoC764932c.1563C>A0.981
rpoC764948c.1579T>C0.984
rpoC764968c.1599T>C0.985
rpoC765004c.1635G>C0.969
rpoC765007c.1638T>G0.968
rpoC765008c.1639T>C0.968
rpoC765011c.1642A>T0.968
rpoC765016c.1647C>G0.968
rpoC765019c.1650A>G0.968
rpoC765040c.1671T>C0.981
rpoC765041c.1672T>C0.981
rpoC765047c.1678T>C0.981
rpoC765055c.1686C>G0.981
rpoC765073c.1704G>C0.967
rpoC765076c.1707A>G0.964
rpoC765079c.1710T>G0.963
rpoC765082c.1713G>C0.963
rpoC765085c.1716T>C0.963
rpoC765089c.1720T>C0.963
rpoC765100c.1731G>C0.963
rpoC765103c.1734G>T0.963
rpoC765121c.1752G>T0.955
rpoC765129p.Tyr587Phe0.955
rpoC765143p.Val592Ile0.952
rpoC765370c.2001G>C0.941
rpoC765379c.2010G>C0.941
rpoC765382c.2013G>T0.941
rpoC765383p.Met672Leu0.941
rpoC765403c.2034G>C0.964
rpoC765405p.Leu679His0.964
rpoC765409c.2040T>G0.966
rpoC765421c.2052C>G0.973
rpoC765449p.Ala694Ser0.976
rpoC765454c.2085C>G0.976
rpoC765469c.2100G>C0.980
rpoC765478c.2109T>G0.978
rpoC765480p.Tyr704Phe0.957
rpoC765499c.2130C>G0.979
rpoC765517c.2148C>G0.973
rpoC765533p.Tyr722His0.967
rpoC765544c.2175C>G0.950
rpoC765547c.2178C>T0.950
rpoC765548c.2179A>T0.950
rpoC765553c.2184C>T0.950
rpoC765556c.2187G>C0.950
rpoC765562c.2193G>T0.950
rpoC765826c.2457T>C0.957
rpoC765835c.2466C>T0.960
rpoC765841c.2472G>T0.963
rpoC765861p.Phe831Tyr0.971
rpoC765875p.Val836Ile1.000
rpoC765886c.2517C>T1.000
rpoC765907c.2538G>T1.000
rpoC765910c.2541G>C1.000
rpoC765928c.2559C>G0.971
rpoC765940c.2571A>T0.971
rpoC765947c.2578T>C0.969
rpoC765962c.2593T>C0.950
rpoC765967c.2598C>T0.944
rpoC765973c.2604C>G0.944
rpoC765979c.2610C>G0.944
rpoC765982c.2613C>T0.944
rpoC765994c.2625A>T0.941
rpoC766003c.2634G>C0.917
rpoC766321c.2952C>G0.882
rpoC766333c.2964G>T0.882
rpoC766345c.2976T>C0.938
rpoC766348c.2979A>G0.938
rpoC766351c.2982C>G0.938
rpoC766353p.Val995Ala0.938
rpoC766369c.3000C>G0.966
rpoC766375c.3006C>G0.969
rpoC766381c.3012C>T0.969
rpoC766384c.3015A>G0.969
rpoC766390c.3021C>T0.971
rpoC766393c.3024C>T0.971
rpoC766408c.3039C>T0.974
rpoC766435p.Glu1022Asp0.974
rpoC766549c.3180G>C1.000
rpoC766570c.3201T>C1.000
rpoC766573c.3204T>G1.000
rpoC766588c.3219G>A1.000
rpoC766594c.3225G>T1.000
rpoC766607p.Ile1080Leu1.000
rpoC766618c.3249G>T1.000
rpoC766792c.3423C>G1.000
rpoC766799p.Ala1144Ser1.000
rpoC766804c.3435A>G1.000
rpoC766837c.3468G>C0.929
rpoC766843c.3474T>G0.929
rpoC766846c.3477C>A0.929
rpoC766858c.3489C>T0.929
rpoC766861c.3492G>C0.929
rpoC766867c.3498C>G0.929
rpoC766876c.3507C>T0.929
rpoC766931p.Ala1188Ser0.941
rpoC766942c.3573C>T0.943
rpoC766945c.3576A>C0.946
rpoC766963c.3594T>C0.979
rpoC766996c.3627C>T0.984
rpoC767002c.3633G>C0.985
rpoC767008c.3639G>A0.984
rpoC767023c.3654C>T0.984
rpoC767044c.3675G>C0.984
rpoC767080c.3711G>C1.000
rpoC767098c.3729T>C1.000
rpoC767104c.3735C>G1.000
rpoC767107c.3738C>T1.000
rpoC767119c.3750A>G1.000
rpoC767125c.3756G>C1.000
rpoC767134c.3765C>T1.000
rpoC767138c.3769C>T1.000
rpoC767149c.3780C>T1.000
rpoC767158c.3789T>C1.000
rpoC767179c.3810C>T1.000
rpoC767180p.Ala1271Ser1.000
rpoC767191c.3822C>G1.000
rpoC767197c.3828G>A1.000
rpoC767203c.3834C>G1.000
rpoC767206c.3837C>G1.000
rpoC767209c.3840T>C1.000
rpoC767212c.3843G>C1.000
rpoC767221c.3852C>G1.000
rpoC767230c.3861G>C1.000
rpoC767233c.3864T>C1.000
rpoC767254c.3885G>C1.000
rpoC767264p.Ala1299Ser1.000
rpoC767267p.Ala1300Asn1.000
rpoC767281c.3912C>G1.000
rpoC767284c.3915C>G1.000
rpsL781559c.-1G>C0.952
rpsL781572p.Gln5Asn0.962
rpsL781586c.27C>T0.967
rpsL781595c.36T>C0.970
rpsL781608p.Ser17Ala0.971
rpsL781616c.57C>G0.977
rpsL781628c.69T>C0.964
rpsL781649c.90T>C0.983
rpsL781655c.96T>C0.982
rpsL781658c.99A>C0.982
rpsL781670c.111G>C0.981
rpsL781706c.147T>C1.000
rpsL781715c.156T>G1.000
rpsL781772c.213C>T0.957
rpsL781802c.243G>C0.933
rpsL781814c.255C>T0.939
rpsL781817c.258G>T0.939
rpsL781829c.270G>C0.951
rpsL781832c.273T>C0.953
rpsL781859c.300T>C0.952
rpsL781868c.309T>C0.951
rpsL781871c.312G>C0.949
rpsL781877c.318T>A0.946
rpsL781892c.333A>G0.970
rpsL781898c.339A>T0.941
rpsL781907c.348T>C0.931
rpsL781916c.357T>C0.913
rpsL781929p.Gly124Ser0.900
rpsL781933374G>A0.900
rrs1471922r.77gt>g1.000
rrs1471924r.79ct>c1.000
rrs1471925r.80t>c1.000
rrs1471931r.86ga>g1.000
rrs1471934r.89a>g1.000
rrs1471985r.140t>c0.976
rrs1471986r.141c>t0.974
rrs1472030r.185g>a0.867
rrs1472031r.186g>c0.867
rrs1472032r.187g>a0.867
rrs1472033r.188a>c0.867
rrs1472035r.190g>t0.867
rrs1472040r.195t>g0.867
rrs1472041r.196c>t0.867
rrs1472042r.197t>g0.867
rrs1472043r.198t>a0.867
rrs1472050r.205g>c0.875
rrs1472053r.208agc>a0.875
rrs1472061r.216a>t0.933
rrs1472106r.261g>a0.972
rrs1472108r.263c>t0.971
rrs1472113r.268t>c0.976
rrs1472150r.305t>a1.000
rrs1472251r.406g>a1.000
rrs1472337r.492c>g1.000
rrs1472380r.535g>c1.000
rrs1472446r.601t>a0.981
rrs1472452r.607g>a0.981
rrs1472464r.619a>g0.961
rrs1472612r.767g>t1.000
rrs1472734r.889c>t0.972
rrs1472741r.896g>a0.973
rrs1472846r.1001c>t0.977
rrs1472847r.1002g>a0.977
rrs1472848r.1003t>c0.978
rrs1472860r.1015c>t1.000
rrs1472861r.1016g>a1.000
rrs1472956r.1111t>c1.000
rrs1472957r.1112c>t1.000
rrs1472969r.1124a>g1.000
rrs1472970r.1125c>g1.000
rrs1472977r.1132g>c1.000
rrs1472978r.1133t>c0.977
rrs1472989r.1144g>a1.000
rrs1472990r.1145a>g1.000
rrs1473082r.1237g>a0.976
rrs1473088r.1243a>g0.975
rrs1473099r.1254t>a0.960
rrs1473104r.1259c>t0.952
rrs1473105r.1260g>a0.952
rrs1473110r.1265t>g0.952
rrs1473111r.1266a>g0.957
rrs1473121r.1276t>c0.969
rrs1473123r.1278a>t0.969
rrs1473129r.1284c>t0.971
rrs1473145r.1300c>t1.000
rrs1473166r.1321g>a1.000
rrs1473288r.1443c>t1.000
rrs1473290r.1445c>t1.000
rrs1473291r.1446g>t1.000
rrl1473707r.50t>a1.000
rrl1473717r.60g>a1.000
rrl1473731r.74t>a1.000
rrl1473746r.89t>c1.000
rrl1473756r.99g>t1.000
rrl1473758r.101g>t1.000
rrl1473770r.113t>c1.000
rrl1473806r.149c>t1.000
rrl1473812r.155g>a1.000
rrl1473814r.157a>t1.000
rrl1473815r.158t>g1.000
rrl1473829r.172g>c0.974
rrl1473831r.174g>t0.973
rrl1473832r.175c>t0.973
rrl1473839r.182g>a0.978
rrl1473876r.219g>a0.978
rrl1473887r.230t>c0.976
rrl1473888r.231t>c0.976
rrl1473898r.241c>t0.974
rrl1473899r.242a>g0.973
rrl1473916r.259c>a0.972
rrl1473923r.266c>g1.000
rrl1473924r.267a>at1.000
rrl1473937r.280c>t1.000
rrl1473943r.286g>t1.000
rrl1473945r.288t>a1.000
rrl1473946r.289a>t1.000
rrl1473950r.293g>t1.000
rrl1474074r.417c>t1.000
rrl1474089r.432c>t1.000
rrl1474093r.436g>a1.000
rrl1474100r.443c>t1.000
rrl1474103r.446a>c1.000
rrl1474130r.473c>t1.000
rrl1474140r.483c>t1.000
rrl1474151r.494c>t1.000
rrl1474181r.524c>ct0.837
rrl1474184r.527c>a1.000
rrl1474185r.528ga>g1.000
rrl1474249r.592g>t1.000
rrl1474263r.606g>a1.000
rrl1474282r.625g>a1.000
rrl1474290r.633ttttcctctccggagg>t1.000
rrl1474306r.649a>c1.000
rrl1474308r.651g>t1.000
rrl1474310r.653t>g1.000
rrl1474356r.699t>c1.000
rrl1474362r.705a>g1.000
rrl1474387r.730c>t1.000
rrl1474413r.756a>c1.000
rrl1474415r.758ccacacgcgcatacgcgcgtgtga>c1.000
rrl1474496r.839c>g0.977
rrl1474497r.840g>c0.978
rrl1474506r.849c>g1.000
rrl1474507r.850g>c1.000
rrl1474626r.969t>c0.974
rrl1474632r.975g>t0.960
rrl1474636r.979a>t0.960
rrl1474637r.980c>t0.960
rrl1474638r.981c>g0.960
rrl1474639r.982g>t0.960
rrl1474640r.983c>t0.960
rrl1474717r.1060a>g0.963
rrl1474722r.1065t>c0.964
rrl1474743r.1086t>g0.979
rrl1474760r.1103a>g0.979
rrl1474794r.1137c>t1.000
rrl1474803r.1146g>a1.000
rrl1474812r.1155g>a1.000
rrl1474830r.1173a>g1.000
rrl1474913r.1256t>c1.000
rrl1474932r.1275c>t1.000
rrl1475031r.1374g>c1.000
rrl1475061r.1404ca>c1.000
rrl1475076r.1419c>a1.000
rrl1475090r.1433a>t1.000
rrl1475114r.1457c>t1.000
rrl1475120r.1463g>t1.000
rrl1475129r.1472g>a1.000
rrl1475202r.1545g>c1.000
rrl1475209r.1552g>a1.000
rrl1475213r.1556c>t1.000
rrl1475220r.1563g>t1.000
rrl1475429r.1772g>a1.000
rrl1475443r.1786g>a1.000
rrl1475452r.1795c>a0.958
rrl1475475r.1818c>t1.000
rrl1475479r.1822c>t1.000
rrl1475480r.1823a>t1.000
rrl1475505r.1848g>a1.000
rrl1475526r.1869c>a1.000
rrl1475531r.1874c>t1.000
rrl1475573r.1916g>a1.000
rrl1475649r.1992a>g1.000
rrl1475659r.2002g>a1.000
rrl1475760r.2103ccg>c1.000
rrl1475764r.2107a>t1.000
rrl1475765r.2108a>t1.000
rrl1475975r.2318c>t0.979
rrl1475977r.2320a>g0.979
rrl1475988r.2331a>g0.976
rrl1475989r.2332t>c0.976
rrl1475993r.2336c>t0.976
rrl1475997r.2340a>t0.976
rrl1476085r.2428g>a1.000
rrl1476086r.2429g>a1.000
rrl1476088r.2431a>c1.000
rrl1476099r.2442a>g1.000
rrl1476103r.2446c>g1.000
rrl1476105r.2448g>a1.000
rrl1476106r.2449a>t1.000
rrl1476110r.2453g>c1.000
rrl1476114r.2457t>c1.000
rrl1476115r.2458t>c1.000
rrl1476131r.2474c>t1.000
rrl1476160r.2503t>c1.000
rrl1476214r.2557g>t1.000
rrl1476215r.2558c>t1.000
rrl1476221r.2564t>c1.000
rrl1476224r.2567a>g1.000
rrl1476251r.2594t>c1.000
rrl1476281r.2624t>c0.978
rrl1476297r.2640c>t1.000
rrl1476299r.2642c>t1.000
rrl1476584r.2927c>t1.000
rrl1476594r.2937c>t0.976
rrl1476597r.2940g>a1.000
rrl1476603r.2946g>a1.000
rrl1476608r.2951c>g1.000
rrl1476619r.2962c>t1.000
rrl1476628r.2971t>a1.000
rrl1476665r.3008t>a1.000
rrl1476666r.3009c>t1.000
rrl1476674r.3017t>c1.000
rpsA1833547c.6G>A1.000
rpsA1833589c.48A>C0.957
rpsA1833595c.54T>G0.957
rpsA1833596p.Ser19Ala0.957
rpsA1833604c.63C>T0.967
rpsA1833616c.75A>T0.970
rpsA1833619c.78A>C0.970
rpsA1833625c.84A>G0.970
rpsA1833664c.123C>G0.976
rpsA1833676c.135A>G0.952
rpsA1833679c.138G>T0.976
rpsA1833685c.144G>C0.974
rpsA1833691c.150G>A0.974
rpsA1833694c.153G>T0.973
rpsA1833697c.156C>T0.974
rpsA1833700c.159C>T0.974
rpsA1833709c.168C>T0.976
rpsA1833724c.183C>T0.968
rpsA1833727c.186G>C0.966
rpsA1833733c.192C>G0.966
rpsA1833734p.Ala65Ser0.966
rpsA1833742c.201A>G1.000
rpsA1833745c.204G>C1.000
rpsA1833748c.207C>G1.000
rpsA1833760c.219C>T1.000
rpsA1833787c.246C>G1.000
rpsA1833790c.249T>C1.000
rpsA1833802c.261A>G1.000
rpsA1833811c.270G>T1.000
rpsA1833823c.282G>A1.000
rpsA1833832c.291G>A1.000
rpsA1833838c.297G>C1.000
rpsA1833841c.300C>G1.000
rpsA1833847c.306C>G1.000
rpsA1833856c.315A>G1.000
rpsA1833862c.321G>T1.000
rpsA1833874c.333T>G1.000
rpsA1833886c.345C>G1.000
rpsA1833894p.Ala118Glu1.000
rpsA1833928c.387G>C1.000
rpsA1833949c.408T>C1.000
rpsA1833961c.420C>G1.000
rpsA1833970c.429G>T1.000
rpsA1833979c.438T>C1.000
rpsA1833991c.450C>G1.000
rpsA1834000c.459G>C1.000
rpsA1834009c.468C>T1.000
rpsA1834012c.471G>C1.000
rpsA1834015c.474G>C1.000
rpsA1834021c.480C>T1.000
rpsA1834030c.489C>G1.000
rpsA1834033c.492C>T1.000
rpsA1834073p.Lys178Arg1.000
rpsA1834096c.555G>C1.000
rpsA1834099c.558C>G1.000
rpsA1834108c.567C>G1.000
rpsA1834114c.573G>C1.000
rpsA1834177c.636A>C1.000
rpsA1834228c.687C>A1.000
rpsA1834231c.690T>G1.000
rpsA1834234c.693G>T1.000
rpsA1834240c.699T>C1.000
rpsA1834246c.705G>T1.000
rpsA1834249c.708T>C1.000
rpsA1834252c.711C>G1.000
rpsA1834261c.720A>G1.000
rpsA1834264c.723G>C1.000
rpsA1834279c.738C>T1.000
rpsA1834294c.753G>T1.000
rpsA1834297c.756C>T1.000
rpsA1834303c.762T>G1.000
rpsA1834306c.765T>C1.000
rpsA1834327c.786G>T1.000
rpsA1834357c.816T>C0.977
rpsA1834366c.825A>G0.979
rpsA1834375c.834G>C0.980
rpsA1834396c.855G>C0.981
rpsA1834411c.870T>G0.977
rpsA1834414c.873C>T0.975
rpsA1834417c.876G>C0.975
rpsA1834420c.879C>T0.975
rpsA1834423c.882G>C0.978
rpsA1834429c.888C>T0.980
rpsA1834438c.897C>T0.981
rpsA1834451c.910T>C0.982
rpsA1834456c.915T>G0.982
rpsA1834468c.927A>G0.982
rpsA1834477c.936C>T0.982
rpsA1834489c.948T>C1.000
rpsA1834519c.978G>C1.000
rpsA1834520p.Ala327Ser1.000
rpsA1834528c.987T>C0.971
rpsA1834534c.993C>T0.971
rpsA1834543c.1002C>G0.971
rpsA1834546c.1005T>C0.971
rpsA1834552c.1011G>T0.971
rpsA1834555c.1014T>G0.971
rpsA1834557p.Ala339Gly0.971
rpsA1834606c.1065C>T0.979
rpsA1834609c.1068T>C0.979
rpsA1834619c.1078T>C0.971
rpsA1834622c.1081T>A0.941
rpsA1834633c.1092A>G0.955
rpsA1834639c.1098T>C0.955
rpsA1834645c.1104C>T0.956
rpsA1834666c.1125G>C0.951
rpsA1834667p.Ala376Ser0.951
rpsA1834690c.1149T>C0.975
rpsA1834700p.Gln387Ala0.969
rpsA1834705c.1164C>G0.970
rpsA1834720c.1179C>G0.974
rpsA1834732c.1191T>C0.957
rpsA1834738c.1197A>G0.957
rpsA1834753c.1212T>C0.952
rpsA1834759c.1218A>C0.949
rpsA1834765p.Glu408Asp0.946
rpsA1834774c.1233C>T0.970
rpsA1834776p.Ala412Glu0.970
rpsA1834780c.1239A>G0.970
rpsA1834789c.1248T>C0.970
rpsA1834813c.1272G>T1.000
rpsA1834830p.Ala430Val1.000
kasA2518738c.624G>C0.929
kasA2518756c.642G>C0.913
kasA2518768c.654C>G0.917
kasA2518771c.657C>G0.917
kasA2518774c.660C>T0.917
kasA2518783c.669T>G0.917
kasA2518787p.Arg225Lys0.917
kasA2518792c.678C>T0.917
kasA2518795c.681C>T0.917
kasA2518798c.684G>C0.923
kasA2518822c.708C>A0.957
kasA2518825c.711T>C0.957
kasA2518846c.732G>T0.952
kasA2518849c.735G>C0.952
kasA2518853p.Leu247Val0.951
kasA2518864c.750G>C0.951
panD4044138c.144A>G0.800
panD4044150c.132T>G0.800
panD4044156c.126T>C0.800
panD4044167c.115G>A0.800
panD4044171c.111G>A0.800
panD4044174c.108G>A0.800
panD4044180p.Asp34Glu0.800
panD4044188c.94C>G0.800
panD4044189c.93G>A0.800
panD4044194p.Ala30Pro0.800
panD4044195c.87A>G0.800
panD4044219c.63G>A0.750
panD4044233p.Cys17His0.667
panD4044234c.48G>C0.750
panD4044249c.33G>A0.818
panD4044266p.Leu6Met0.900
embC4240729c.867C>G1.000
embC4240735c.873C>G1.000
embC4240741c.879C>T1.000
embC4240756c.894G>C1.000
embC4240771c.909G>C1.000
embC4240772p.Ser304Ala1.000
embC4240776c.915 916insG0.947
embB4248220c.1707A>G0.917
embB4248226c.1713G>C0.920
embB4248232c.1719G>T0.958
embB4248233p.Leu574Val0.958
embB4248236p.Met575Leu0.964
embB4248245p.Ile578Val0.972
embB4248250c.1737C>T0.973
embB4248259p.Met582Ile0.975
embB4248275p.Thr588Ala1.000
embB4248292c.1779G>A1.000

Analysis pipeline specifications

TBProfiler Version: 2.1.1

AnalysisProgram
Mappingbwa
Variant CallingBCFtools


Log

Drug Details
The estimated accuracy of drug resistance predictions is:

Drug1Sensitivity (%)Specificity (%)
Isoniazid 92.8 (89.9-95.7)100 (100-100)
Rifampicin 96.2 (93.9-98.5)98.1 (96.8-99.4)
Ethambutal 88.7 (83.6-93.8)81.7 (77.6-85.8)
Pyrazinamide70.9 (62.4-79.4)93.9 (90.6-97.2)
Streptomycin87.1 (82.7-91.5)89.7 (86.0-93.4)
Ethionamide 73.6 (66.7-80.5)93.3 (89.6-97.0)
Moxifloxacin60.0 (29.6-90.4)68.7 (52.6-84.8)
Ofloxacin 85.5 (79.1-91.9)94.9 (91.8-98.0)
Amikacin 82.9 (74.4-91.4)98.3 (96.0-100)
Capreomycin 60.7 (50.6-70.8)90.7 (87.2-94.2)
Kanamycin 87.3 (81.3-93.3)93.4 (89.9-96.9)
Para-aminosalisylic acidNot determinedNot determined
Linezolid Not determinedNot determined
Clofazimine Not determinedNot determined
Bedaquiline Not determinedNot determined
Multi drug resistance91.2 (87.8-94.6)98.4 (97.2-99.6)
Extremely drug resistance75.9 (64.5-87.3)98.4 (97.3-99.5)

Lineages
Lineage2LocationStrainRD type
lineage1Indo-OceanicEAIRD239
lineage1.1Indo-OceanicEAI3;EAI4;EAI5;EAI6RD239
lineage1.1.1Indo-OceanicEAI4;EAI5RD239
lineage1.1.1.1Indo-OceanicEAI4;ZERORD239
lineage1.1.2Indo-OceanicEAI3;EAI5RD239
lineage1.1.3Indo-OceanicEAI6RD239
lineage1.2Indo-OceanicEAI1;EAI2RD239
lineage1.2.1Indo-OceanicEAI2RD239
lineage1.2.2Indo-OceanicEAI1RD239
lineage2East-AsianBeijingRD105
lineage2.1East-Asian (non-Beijing)NoneNone
lineage2.2East-Asian (Beijing)Beijing-RD207RD105;RD207
lineage2.2.2East-Asian (Beijing)Beijing-RD105/RD207RD105;RD207
lineage2.2.1East-Asian (Beijing)Beijing-RD181RD105;RD207;RD181
lineage2.2.1.2East-Asian (Beijing)Beijing-RD142RD105;RD207;RD181;RD142
lineage2.2.1.1East-Asian (Beijing)Beijing-RD150RD105;RD207;RD181;RD150
lineage3East-African-IndianCASRD750
lineage3.1East-African-IndianNon-CAS1-DelhiRD750
lineage3.1.1East-African-IndianCAS1-KiliRD750
lineage3.1.2East-African-IndianCAS;CAS2RD750
lineage3.1.2.1East-African-IndianCAS2RD750
lineage3.1.2.2East-African-IndianCASRD750
lineage4Euro-AmericanLAM;T;S;X;HNone
lineage4.1Euro-AmericanT;X;HNone
lineage4.1.2Euro-American (X-type)T;HNone
lineage4.1.2.1Euro-American (X-type)T1;H1RD182
lineage4.1.1Euro-American (X-type)X1;X2;X3None
lineage4.1.1.2Euro-American (X-type)X1None
lineage4.1.1.1Euro-American (X-type)X2RD183
lineage4.1.1.3Euro-American (Haarlem)X1;X3RD193
lineage4.2Euro-AmericanH;T;LAMNone
lineage4.2.2Euro-American (Ural)T;LAM7-TURNone
lineage4.2.2.1Euro-AmericanLAM7-TURNone
lineage4.2.1Euro-American (TUR)H3;H4None
lineage4.3Euro-American (LAM)mainly-LAMNone
lineage4.3.1Euro-American (LAM)LAM9None
lineage4.3.3Euro-American (LAM)LAM;TRD115
lineage4.3.4Euro-American (LAM)LAMRD174
lineage4.3.4.1Euro-American (LAM)LAM1;LAM2RD174
lineage4.3.4.2Euro-American (LAM)LAM1;LAM4;LAM11RD174
lineage4.3.4.2.1Euro-American (LAM)LAM11RD174
lineage4.3.2Euro-American (LAM)LAM3None
lineage4.3.2.1Euro-American (LAM)LAM3RD761
lineage4.4Euro-AmericanS;TNone
lineage4.4.2Euro-AmericanT1;T2None
lineage4.4.1Euro-American (S-type)S;TNone
lineage4.4.1.2Euro-AmericanT1None
lineage4.4.1.1Euro-AmericanS;OrphansNone
lineage4.5Euro-AmericanH;TRD122
lineage4.6Euro-AmericanT;LAMNone
lineage4.6.1Euro-American (Uganda)T2RD724
lineage4.6.1.1Euro-American T2-UgandaRD724
lineage4.6.1.2Euro-AmericanT2RD724
lineage4.6.2Euro-AmericanT;LAMRD726
lineage4.6.2.1Euro-AmericanT3RD726
lineage4.6.2.2Euro-American (Cameroon)LAM10-CAMRD726
lineage4.7Euro-American (mainly T)T1;T5None
lineage4.8Euro-American (mainly T)T1;T2;T3;T5RD219
lineage4.9Euro-American (H37Rv-like)T1None
lineage5West-Africa 1AFRI_2;AFRI_3RD711
lineage6West-Africa 2AFRI_1RD702
lineage7Lineage 7NoneNone
lineageBOVM. bovisBOV_1;BOV_2None

Citations
1. Coll F, et al. Rapid determination of anti-tuberculosis drug resistance from whole genome sequences. Genome Medicine (in press)
2. Coll F, et al. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains. Nature Communications 2014.

Disclaimer
This tool is for Research Use Only and is offered free for use. The London School of Hygiene and Tropical Medicine shall have no liability for any loss or damages of any kind, however sustained relating to the use of this tool.
© 2019 London School of Hygiene and Tropical Medicine;