TB-Profiler result

Run: DRR034412
Summary

Run ID: DRR034412

Sample name:

Date: 31-03-2023 06:58:00

Number of reads: 999526

Percentage reads mapped: 99.79

Strain: lineage4.9

Drug-resistance: Sensitive

Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.9 Euro-American (H37Rv-like) T1 None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
ccsA 620085 c.195G>A synonymous_variant 0.11
rpoC 764126 p.Thr253Ser missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 0.99
Rv1258c 1406244 p.Leu366Pro missense_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2169736 p.Gly293Ser missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
eis 2714916 p.Glu139Asp missense_variant 0.12
eis 2714988 c.345C>G synonymous_variant 0.13
folC 2746485 p.Phe372Leu missense_variant 0.11
folC 2747325 p.Arg92Ser missense_variant 1.0
embC 4243071 c.3212_3263delAGCCCGCTGATCTGAACCTAGGAACGGTGACTCGCAGCGGGCTGTGGAGTCC frameshift_variant 0.14
embB 4245881 c.-633C>T upstream_gene_variant 1.0
aftB 4268642 c.195T>C synonymous_variant 0.2
whiB6 4338507 c.15C>T synonymous_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0