TB-Profiler result

Run: ERR2503420

Summary

Run ID: ERR2503420

Sample name:

Date: 31-03-2023 18:27:05

Number of reads: 1304081

Percentage reads mapped: 99.58

Strain: lineage4

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 7585 p.Ser95Thr missense_variant 1.0
gyrA 9016 p.Thr572Ser missense_variant 1.0
gyrA 9304 p.Gly668Asp missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
embR 1416730 c.578_617delAGCTCGAGGCTCTGACATTCGAACACCCCTACCGGGAGCC frameshift_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1475361 n.1704G>A non_coding_transcript_exon_variant 1.0
rrl 1475696 n.2039T>A non_coding_transcript_exon_variant 0.14
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2169223 p.Ser464Pro missense_variant 1.0
Rv1979c 2221792 p.Val458Gly missense_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
eis 2714888 p.Phe149Val missense_variant 1.0
ahpC 2726152 c.-41C>T upstream_gene_variant 1.0
ald 3086788 c.-32T>C upstream_gene_variant 1.0
fprA 3473996 c.-11_-10insA upstream_gene_variant 1.0
alr 3840225 p.Thr399Ile missense_variant 1.0
rpoA 3878567 c.-60C>G upstream_gene_variant 0.5
embC 4241151 p.Ile430Ser missense_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embB 4249106 c.2593C>T synonymous_variant 1.0
whiB6 4338593 c.-72C>G upstream_gene_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
embR 1416730 c.577_617delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG frameshift_variant 1.0