TB-Profiler result

Run: ERR4407486

Summary

Run ID: ERR4407486

Sample name:

Date: 01-04-2023 05:46:03

Number of reads: 1346058

Percentage reads mapped: 99.67

Strain: lineage4.8

Drug-resistance: Sensitive


Download CSV Download TXT Download PDF Download JSON
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family Main Spoligotype RDs Frequency
lineage4 Euro-American LAM;T;S;X;H None 1.0
lineage4.8 Euro-American (mainly T) T1;T2;T3;T5 RD219 1.0
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction
gyrA 7362 p.Glu21Gln missense_variant 1.0
gyrA 8613 p.Met438Val missense_variant 1.0
mmpL5 775639 p.Ile948Val missense_variant 1.0
rpsL 781395 c.-165T>C upstream_gene_variant 1.0
rrs 1471659 n.-187C>T upstream_gene_variant 1.0
rrl 1474001 n.344C>T non_coding_transcript_exon_variant 1.0
tlyA 1917972 c.33A>G synonymous_variant 1.0
PPE35 2169053 c.1560T>C synonymous_variant 0.13
PPE35 2169059 c.1554G>A synonymous_variant 0.14
PPE35 2169063 p.Met517Thr missense_variant 0.14
PPE35 2169065 p.Ala516Thr missense_variant 0.14
PPE35 2169068 c.1545G>T synonymous_variant 0.2
PPE35 2169071 c.1464_1541delGGCGGTGACGACGCCGGCCAACGTTACCGTGGGTGCGTTTGATTTGCCGGGGTTGACGGTGCCGTCGTTGACGATTCC disruptive_inframe_deletion 1.0
Rv1979c 2223197 c.-33T>C upstream_gene_variant 1.0
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0
ald 3087095 c.276C>T synonymous_variant 1.0
Rv3083 3448497 c.-7T>A upstream_gene_variant 1.0
Rv3083 3448500 c.-4A>G upstream_gene_variant 1.0
rpoA 3878578 c.-71C>A upstream_gene_variant 0.6
rpoA 3878669 c.-162A>T upstream_gene_variant 0.11
clpC1 4040021 c.684A>C synonymous_variant 1.0
embA 4242643 c.-590C>T upstream_gene_variant 1.0
embA 4243905 p.Asp225Asn missense_variant 1.0
whiB6 4338595 c.-75delG upstream_gene_variant 1.0
PPE35 2169071 c.1463_1541delNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA frameshift_variant 1.0
Rv3083 3448507 c.5_*1408del frameshift_variant&stop_lost&splice_region_variant 1.0